Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8291893.1

Orthogroup ID

OG0000248

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 556

Gene Structure 555 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8291893.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 555 bp

atggatatatcacataatcgcctttgtggagatataccatcacaggtgattggtctctcttcctttctctggctcgatttatcacaaaactcgctaagtggcaacctgcctgtggaagtgggtaaactgaagaatatttatgcctttaacatctctgaaaataatttgaccggagaaatcccagaaaccattggaaactgtctgagccttgaatttcttagccttcaagggaatctctttcaaggaatcataccttcttctttggcttctttgagaggtcttcagtatctagatctttcaagaagcaacttgtccggacatattccaaaagacctacagacacttccattcctgatttatttgaacctttcgtccaataacctggagggtgaggtaccgaaagaaggagtttttcgaaacacaagtgcaatatcattgcatggaaataccaaactttgtggtggtgtttcggaactacagctaccagcatgccccatcaaagtaccaaagcagagaaagttgcatggtttcaaattgaagttcacaatttcttta

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0007275 GO:0008150 GO:0009790 GO:0009791 GO:0009793 GO:0009888 GO:0010065 GO:0010067 GO:0010087 GO:0010154 GO:0022414 GO:0032501 GO:0032502 GO:0048316 GO:0048507 GO:0048508 GO:0048608 GO:0048731 GO:0048856 GO:0061458

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05169 map04010 map04064 map04620 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05169

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

185

Amino Acids

20.2

Weight (kDa)

7.69

Isoelectric Point (pI)

46.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000248)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g31390 FvH4_5g31630 FvH4_5g31631 FvH4_7g24151 FvH4_7g24160 FvH4_7g24240 FvH4_7g24242 FvH4_7g24243 FvH4_7g24510 FvH4_7g24920 FvH4_7g24920 FvH4_7g24920 FvH4_7g29910
malus_domestica	MD01G1131800.v1.1 MD01G1150000.v1.1 MD01G1151300.v1.1
prunus_persica	Prupe.2G248300_v2.0.a1
pyrus_communis	pycom01g16800
rosa_chinensis	RchiOBHm_Chr1g0339821 RchiOBHm_Chr1g0345151 RchiOBHm_Chr1g0346851 RchiOBHm_Chr1g0351981 RchiOBHm_Chr1g0369731 RchiOBHm_Chr1g0369841 RchiOBHm_Chr1g0369861 RchiOBHm_Chr1g0369931 RchiOBHm_Chr1g0369961 RchiOBHm_Chr1g0370261 RchiOBHm_Chr1g0370281 RchiOBHm_Chr5g0076391 RchiOBHm_Chr6g0248051 RchiOBHm_Chr6g0248071
rosa_laevigata	RLG00000002548 RLG00000013479 RLG00000027042 RLG00000027045 RLG00000027047 RLG00000027060 RLG00000027063 RLG00000027082 RLG00000027084 RLG00000027087 RLG00000027089 RLG00000027090 RLG00000027091 RLG00000027092 RLG00000027094 RLG00000027097 RLG00000027100 RLG00000027101 RLG00000027111 RLG00000028769 RLG00000028851 RLG00000029244 RLG00000030021
rosa_multiflora	Rmu_co7968444.1_g000001 Rmu_co8060564.1_g000001 Rmu_co8098766.1_g000001 Rmu_co8172886.1_g000001 Rmu_co8291893.1_g000001 Rmu_co8327887.1_g000001 Rmu_co8406981.1_g000001 Rmu_co8449189.1_g000001 Rmu_co8470871.1_g000001 Rmu_sc0000756.1_g000006 Rmu_sc0001154.1_g000028 Rmu_sc0001565.1_g000055 Rmu_sc0001657.1_g000002 Rmu_sc0002095.1_g000014 Rmu_sc0002147.1_g000001 Rmu_sc0002705.1_g000004 Rmu_sc0002705.1_g000005 Rmu_sc0004087.1_g000025 Rmu_sc0005500.1_g000022 Rmu_sc0006707.1_g000005 Rmu_sc0006707.1_g000009 Rmu_sc0008140.1_g000012 Rmu_sc0008140.1_g000019 Rmu_sc0016176.1_g000001 Rmu_sc0016906.1_g000006 Rmu_sc0028980.1_g000001 Rmu_sc0041369.1_g000001
rosa_roxburghii	Rroxscaffold_3G00232610 Rroxscaffold_4G00286690 Rroxscaffold_4G00286920 Rroxscaffold_4G00286930 Rroxscaffold_4G00286960 Rroxscaffold_4G00286980 Rroxscaffold_4G00287030 Rroxscaffold_4G00287040 Rroxscaffold_4G00287070 Rroxscaffold_4G00287090 Rroxscaffold_4G00287330 Rroxscaffold_4G00287430 Rroxscaffold_4G00303380 Rroxscaffold_4G00303400 Rroxscaffold_4G00303410 Rroxscaffold_4G00308100 Rroxscaffold_4G00308480 Rroxscaffold_4G00313700 Rroxscaffold_4G00322910 Rroxscaffold_7G00190680 Rroxscaffold_7G00193490
rosa_rugosa	Rorug01G0032200 Rorug01G0139400.1 Rorug01G0139600.1 Rorug01G0139700.1 Rorug01G0184400 Rorug01G0351900 Rorug01G0351900 Rorug01G0352600 Rorug01G0352600 Rorug01G0352800 Rorug01G0355300 Rorug01G0355400 Rorug01G0356700.1 Rorug01G0356800 Rorug06G0090600 Rorug07G0276100
rosa_samantha	Rh1AG201900 Rh1AG361300 Rh1AG365100 Rh6AG204000
rosa_wichuraiana	Rw0G015480 Rw1G007000 Rw1G008190 Rw1G012880 Rw1G012990 Rw1G016950 Rw1G031720 Rw1G031800 Rw1G031820 Rw1G032020 Rw1G032180 Rw6G017720 Rw7G035600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	114
Acc65I	GGTACC	1 cut(s)	394
AccB1I	GGYRCC	1 cut(s)	394
AccIII	TCCGGA	1 cut(s)	314
AcsI	RAATTY	1 cut(s)	212
AcuI	CTGAAG	2 cut(s)	149, 266
AfaI	GTAC	2 cut(s)	396, 504
AfiI	CCNNNNNNNGG	3 cut(s)	69, 112, 404
AgsI	TTSAA	7 cut(s)	212, 227, 242, 300, 364, 532, 538
AjnI	CCWGG	1 cut(s)	381
AloI	GAACNNNNNNTCC	2 cut(s)	356, 388
AluBI	AGCT	1 cut(s)	481
AluI	AGCT	1 cut(s)	481
Alw26I	GTCTC	1 cut(s)	59
Aor13HI	TCCGGA	1 cut(s)	314
ApoI	RAATTY	1 cut(s)	212
Asp718I	GGTACC	1 cut(s)	394
AsuHPI	GGTGA	2 cut(s)	58, 401
AsuII	TTCGAA	1 cut(s)	415
BanI	GGYRCC	1 cut(s)	394
BbsI	GAAGAC	1 cut(s)	272
BccI	CCATC	2 cut(s)	46, 503
BciT130I	CCWGG	1 cut(s)	383
BcoDI	GTCTC	1 cut(s)	59
BfaI	CTAG	1 cut(s)	290
BfmI	CTRYAG	2 cut(s)	335, 476
BfuAI	ACCTGC	1 cut(s)	114
BglII	AGATCT	1 cut(s)	292
Bme1390I	CCNGG	1 cut(s)	383
BmiI	GGNNCC	1 cut(s)	396
BmrFI	CCNGG	1 cut(s)	383
BpiI	GAAGAC	1 cut(s)	272
BpmI	CTGGAG	1 cut(s)	404
Bpu14I	TTCGAA	1 cut(s)	415
BsaI	GGTCTC	1 cut(s)	59
BsaWI	WCCGGW	2 cut(s)	170, 314
Bsc4I	CCNNNNNNNGG	3 cut(s)	69, 112, 404
Bse3DI	GCAATG	1 cut(s)	434
BseAI	TCCGGA	1 cut(s)	314
BseBI	CCWGG	1 cut(s)	383
BseLI	CCNNNNNNNGG	3 cut(s)	69, 112, 404
BseMI	GCAATG	1 cut(s)	434
BseMII	CTCAG	1 cut(s)	194
BshNI	GGYRCC	1 cut(s)	394
BsiSI	CCGG	2 cut(s)	171, 315
BslI	CCNNNNNNNGG	3 cut(s)	69, 112, 404
BsmAI	GTCTC	1 cut(s)	59
Bso31I	GGTCTC	1 cut(s)	59
Bsp119I	TTCGAA	1 cut(s)	415
Bsp13I	TCCGGA	1 cut(s)	314
Bsp143I	GATC	1 cut(s)	292
BspCNI	CTCAG	1 cut(s)	195
BspEI	TCCGGA	1 cut(s)	314
BspLI	GGNNCC	1 cut(s)	396
BspMI	ACCTGC	1 cut(s)	114
BspT104I	TTCGAA	1 cut(s)	415
BspT107I	GGYRCC	1 cut(s)	394
BspTNI	GGTCTC	1 cut(s)	59
BsrDI	GCAATG	1 cut(s)	434
BssMI	GATC	1 cut(s)	292
Bst2UI	CCWGG	1 cut(s)	383
Bst4CI	ACNGT	1 cut(s)	200
Bst6I	CTCTTC	1 cut(s)	64
BstBI	TTCGAA	1 cut(s)	415
BstC8I	GCNNGC	1 cut(s)	490
BstDEI	CTNAG	3 cut(s)	95, 203, 218
BstKTI	GATC	1 cut(s)	295
BstMAI	GTCTC	1 cut(s)	59
BstMBI	GATC	1 cut(s)	292
BstNI	CCWGG	1 cut(s)	383
BstNSI	RCATGY	1 cut(s)	492
BstSCI	CCNGG	1 cut(s)	381
BstSFI	CTRYAG	2 cut(s)	335, 476
BstV2I	GAAGAC	1 cut(s)	272
BstX2I	RGATCY	1 cut(s)	292
BstXI	CCANNNNNNTGG	1 cut(s)	382
BstYI	RGATCY	1 cut(s)	292
BveI	ACCTGC	1 cut(s)	114
Cac8I	GCNNGC	1 cut(s)	490
Csp6I	GTAC	2 cut(s)	395, 503
CspCI	CAANNNNNGTGG	2 cut(s)	439, 474
CviAII	CATG	3 cut(s)	440, 489, 524
CviJI	RGCY	5 cut(s)	73, 207, 222, 266, 481
CviKI_1	RGCY	5 cut(s)	73, 207, 222, 266, 481
CviQI	GTAC	2 cut(s)	395, 503
DdeI	CTNAG	3 cut(s)	95, 203, 218
DpnI	GATC	1 cut(s)	294
DpnII	GATC	1 cut(s)	292
Eam1104I	CTCTTC	1 cut(s)	64
EarI	CTCTTC	1 cut(s)	64
Eco31I	GGTCTC	1 cut(s)	59
Eco57I	CTGAAG	2 cut(s)	149, 266
EcoRII	CCWGG	1 cut(s)	381
FaeI	CATG	3 cut(s)	443, 492, 527
FaiI	YATR	9 cut(s)	8, 15, 35, 141, 251, 321, 441, 490, 525
FatI	CATG	3 cut(s)	439, 488, 523
FspBI	CTAG	1 cut(s)	290
GsuI	CTGGAG	1 cut(s)	404
HapII	CCGG	2 cut(s)	171, 315
Hin1II	CATG	3 cut(s)	443, 492, 527
HinfI	GANTC	2 cut(s)	232, 246
HpaII	CCGG	2 cut(s)	171, 315
HphI	GGTGA	2 cut(s)	58, 401
Hpy166II	GTNNAC	2 cut(s)	125, 543
Hpy188I	TCNGA	3 cut(s)	157, 204, 472
Hpy188III	TCNNGA	4 cut(s)	290, 300, 315, 352
Hpy8I	GTNNAC	2 cut(s)	125, 543
HpyAV	CCTTC	3 cut(s)	233, 264, 398
HpyCH4III	ACNGT	1 cut(s)	200
HpyCH4V	TGCA	3 cut(s)	428, 439, 523
HpyF3I	CTNAG	3 cut(s)	95, 203, 218
Hsp92II	CATG	3 cut(s)	443, 492, 527
Kpn2I	TCCGGA	1 cut(s)	314
KpnI	GGTACC	1 cut(s)	398
Kzo9I	GATC	1 cut(s)	292
MaeI	CTAG	1 cut(s)	290
MalI	GATC	1 cut(s)	294
MboI	GATC	1 cut(s)	292
MboII	GAAGA	4 cut(s)	51, 142, 249, 272
MflI	RGATCY	1 cut(s)	292
MluCI	AATT	4 cut(s)	163, 212, 533, 546
MnlI	CCTC	3 cut(s)	269, 379, 385
MroI	TCCGGA	1 cut(s)	314
MseI	TTAA	1 cut(s)	147
MspI	CCGG	2 cut(s)	171, 315
MspR9I	CCNGG	1 cut(s)	383
MvaI	CCWGG	1 cut(s)	383
NdeII	GATC	1 cut(s)	292
NlaIII	CATG	3 cut(s)	443, 492, 527
NlaIV	GGNNCC	1 cut(s)	396
NspI	RCATGY	1 cut(s)	492
NspV	TTCGAA	1 cut(s)	415
PaeI	GCATGC	1 cut(s)	492
PfeI	GAWTC	2 cut(s)	232, 246
Psp6I	CCWGG	1 cut(s)	381
PspGI	CCWGG	1 cut(s)	381
PspN4I	GGNNCC	1 cut(s)	396
PsrI	GAACNNNNNNTAC	2 cut(s)	465, 497
PsuI	RGATCY	1 cut(s)	292
RsaI	GTAC	2 cut(s)	396, 504
RsaNI	GTAC	2 cut(s)	395, 503
SaqAI	TTAA	1 cut(s)	147
Sau3AI	GATC	1 cut(s)	292
ScrFI	CCNGG	1 cut(s)	383
SetI	ASST	9 cut(s)	48, 108, 256, 280, 336, 369, 384, 396, 483
SfcI	CTRYAG	2 cut(s)	335, 476
SfuI	TTCGAA	1 cut(s)	415
SphI	GCATGC	1 cut(s)	492
Sse9I	AATT	4 cut(s)	163, 212, 533, 546
SspI	AATATT	1 cut(s)	136
SspMI	CTAG	1 cut(s)	290
StyD4I	CCNGG	1 cut(s)	381
TaaI	ACNGT	1 cut(s)	200
TaqI	TCGA	2 cut(s)	75, 415
TasI	AATT	4 cut(s)	163, 212, 533, 546
TfiI	GAWTC	2 cut(s)	232, 246
Tru1I	TTAA	1 cut(s)	147
Tru9I	TTAA	1 cut(s)	147
XapI	RAATTY	1 cut(s)	212
XbaI	TCTAGA	1 cut(s)	289
XceI	RCATGY	1 cut(s)	492
XspI	CTAG	1 cut(s)	290

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.