Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041369.1

Orthogroup ID

OG0000248

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1074

Gene Structure 1074 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041369.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 997 bp

atggagcttcatatgctcaacttctctgcattttgttcaacctaccttcatgtcatgaccactcttttccttctcaccaaccttttccaacctgccatctttgcaaatgcattgagcaatgaaaccgatcgcttcgctttgctgaaattcaaagattgcatagccaccaatccggatgggctgttgaactcatggaataacaccgtccacttctgcaaatggcaaggagttacttgtggcagacgacgtcaaagagtaacagccttgaacctacaaggctatgatttgcatggaaccatatcacagtacattggcaacctctcctttcttaggttcatcaatcttcaaaacaacagcttctctggcaacattcctcaacaagttgaacatttattccgactgcgacatctcaatctcagtaccaacatgttggaggggggaattccagtgaacctgaccttctgcccggagttaagcatcataaccattggatcgaaccgtcttacaggcaacattccttcagcgattggctcattgatgaagcttgtgtgtcttgctcttgagagaaacaatctgacaggaggcatcccaccttccttgggaaatctttcatcaatcacagtgctgtccttgttttataacaatctggtgggaacaattccagaggagataggccgattgagaagcttatcaaattttggaattggtcccaataatctctctggtatgatccctccctccctttttaacatatcatctatagactccttctcaattacgtataataattttgagggcagtattccgcctgatataggcctaaacaagcctaatctccaacgactgttgcttggtggaaatgaattctctggacaaatcccagcttcattttccaatgcttctcagcttcggtcgcttgatcttggggaaaataattttgttggtcaagtacccgcaagttttggaaattttcctaatctccagtggctcaacttcg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0007275 GO:0008150 GO:0009790 GO:0009791 GO:0009793 GO:0009888 GO:0010065 GO:0010067 GO:0010087 GO:0010154 GO:0022414 GO:0032501 GO:0032502 GO:0048316 GO:0048507 GO:0048508 GO:0048608 GO:0048731 GO:0048856 GO:0061458

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05169 map04010 map04064 map04620 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05169

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

332

Amino Acids

36.59

Weight (kDa)

7.66

Isoelectric Point (pI)

34.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000248)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g31390 FvH4_5g31630 FvH4_5g31631 FvH4_7g24151 FvH4_7g24160 FvH4_7g24240 FvH4_7g24242 FvH4_7g24243 FvH4_7g24510 FvH4_7g24920 FvH4_7g24920 FvH4_7g24920 FvH4_7g29910
malus_domestica	MD01G1131800.v1.1 MD01G1150000.v1.1 MD01G1151300.v1.1
prunus_persica	Prupe.2G248300_v2.0.a1
pyrus_communis	pycom01g16800
rosa_chinensis	RchiOBHm_Chr1g0339821 RchiOBHm_Chr1g0345151 RchiOBHm_Chr1g0346851 RchiOBHm_Chr1g0351981 RchiOBHm_Chr1g0369731 RchiOBHm_Chr1g0369841 RchiOBHm_Chr1g0369861 RchiOBHm_Chr1g0369931 RchiOBHm_Chr1g0369961 RchiOBHm_Chr1g0370261 RchiOBHm_Chr1g0370281 RchiOBHm_Chr5g0076391 RchiOBHm_Chr6g0248051 RchiOBHm_Chr6g0248071
rosa_laevigata	RLG00000002548 RLG00000013479 RLG00000027042 RLG00000027045 RLG00000027047 RLG00000027060 RLG00000027063 RLG00000027082 RLG00000027084 RLG00000027087 RLG00000027089 RLG00000027090 RLG00000027091 RLG00000027092 RLG00000027094 RLG00000027097 RLG00000027100 RLG00000027101 RLG00000027111 RLG00000028769 RLG00000028851 RLG00000029244 RLG00000030021
rosa_multiflora	Rmu_co7968444.1_g000001 Rmu_co8060564.1_g000001 Rmu_co8098766.1_g000001 Rmu_co8172886.1_g000001 Rmu_co8291893.1_g000001 Rmu_co8327887.1_g000001 Rmu_co8406981.1_g000001 Rmu_co8449189.1_g000001 Rmu_co8470871.1_g000001 Rmu_sc0000756.1_g000006 Rmu_sc0001154.1_g000028 Rmu_sc0001565.1_g000055 Rmu_sc0001657.1_g000002 Rmu_sc0002095.1_g000014 Rmu_sc0002147.1_g000001 Rmu_sc0002705.1_g000004 Rmu_sc0002705.1_g000005 Rmu_sc0004087.1_g000025 Rmu_sc0005500.1_g000022 Rmu_sc0006707.1_g000005 Rmu_sc0006707.1_g000009 Rmu_sc0008140.1_g000012 Rmu_sc0008140.1_g000019 Rmu_sc0016176.1_g000001 Rmu_sc0016906.1_g000006 Rmu_sc0028980.1_g000001 Rmu_sc0041369.1_g000001
rosa_roxburghii	Rroxscaffold_3G00232610 Rroxscaffold_4G00286690 Rroxscaffold_4G00286920 Rroxscaffold_4G00286930 Rroxscaffold_4G00286960 Rroxscaffold_4G00286980 Rroxscaffold_4G00287030 Rroxscaffold_4G00287040 Rroxscaffold_4G00287070 Rroxscaffold_4G00287090 Rroxscaffold_4G00287330 Rroxscaffold_4G00287430 Rroxscaffold_4G00303380 Rroxscaffold_4G00303400 Rroxscaffold_4G00303410 Rroxscaffold_4G00308100 Rroxscaffold_4G00308480 Rroxscaffold_4G00313700 Rroxscaffold_4G00322910 Rroxscaffold_7G00190680 Rroxscaffold_7G00193490
rosa_rugosa	Rorug01G0032200 Rorug01G0139400.1 Rorug01G0139600.1 Rorug01G0139700.1 Rorug01G0184400 Rorug01G0351900 Rorug01G0351900 Rorug01G0352600 Rorug01G0352600 Rorug01G0352800 Rorug01G0355300 Rorug01G0355400 Rorug01G0356700.1 Rorug01G0356800 Rorug06G0090600 Rorug07G0276100
rosa_samantha	Rh1AG201900 Rh1AG361300 Rh1AG365100 Rh6AG204000
rosa_wichuraiana	Rw0G015480 Rw1G007000 Rw1G008190 Rw1G012880 Rw1G012990 Rw1G016950 Rw1G031720 Rw1G031800 Rw1G031820 Rw1G032020 Rw1G032180 Rw6G017720 Rw7G035600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	639
AatII	GACGTC	1 cut(s)	250
Acc36I	ACCTGC	1 cut(s)	100
AccIII	TCCGGA	1 cut(s)	172
AciI	CCGC	2 cut(s)	806, 954
AclWI	GGATC	2 cut(s)	499, 724
AcsI	RAATTY	5 cut(s)	146, 441, 694, 863, 967
AcuI	CTGAAG	1 cut(s)	504
AcyI	GRCGYC	1 cut(s)	247
AfaI	GTAC	3 cut(s)	308, 421, 951
AfiI	CCNNNNNNNGG	3 cut(s)	330, 599, 815
AflIII	ACRYGT	1 cut(s)	426
AgsI	TTSAA	6 cut(s)	39, 151, 187, 268, 347, 386
AloI	GAACNNNNNNTCC	2 cut(s)	378, 410
AluBI	AGCT	6 cut(s)	7, 357, 544, 687, 884, 907
AluI	AGCT	6 cut(s)	7, 357, 544, 687, 884, 907
AlwI	GGATC	2 cut(s)	499, 724
Aor13HI	TCCGGA	1 cut(s)	172
AoxI	GGCC	2 cut(s)	673, 817
ApoI	RAATTY	5 cut(s)	146, 441, 694, 863, 967
Asp700I	GAANNNNTTC	1 cut(s)	607
AspS9I	GGNCC	1 cut(s)	707
AsuC2I	CCSGG	1 cut(s)	467
AsuHPI	GGTGA	1 cut(s)	67
AvaII	GGWCC	1 cut(s)	707
BccI	CCATC	2 cut(s)	104, 170
BcnI	CCSGG	1 cut(s)	467
BfmI	CTRYAG	1 cut(s)	759
BfuAI	ACCTGC	1 cut(s)	100
Bme1390I	CCNGG	1 cut(s)	467
Bme18I	GGWCC	1 cut(s)	707
BmgT120I	GGNCC	1 cut(s)	707
BmiI	GGNNCC	2 cut(s)	295, 709
BmrFI	CCNGG	1 cut(s)	467
BmsI	GCATC	2 cut(s)	486, 594
BpmI	CTGGAG	1 cut(s)	965
BpuEI	CTTGAG	1 cut(s)	581
BpuMI	CCSGG	1 cut(s)	467
BsaAI	YACGTR	1 cut(s)	780
BsaHI	GRCGYC	1 cut(s)	247
BsaJI	CCNNGG	1 cut(s)	597
BsaWI	WCCGGW	1 cut(s)	172
Bsc4I	CCNNNNNNNGG	3 cut(s)	330, 599, 815
Bse1I	ACTGG	2 cut(s)	446, 982
Bse3DI	GCAATG	1 cut(s)	124
BseAI	TCCGGA	1 cut(s)	172
BseDI	CCNNGG	1 cut(s)	597
BseGI	GGATG	2 cut(s)	181, 585
BseLI	CCNNNNNNNGG	3 cut(s)	330, 599, 815
BseMI	GCAATG	1 cut(s)	124
BseMII	CTCAG	2 cut(s)	430, 917
BseNI	ACTGG	2 cut(s)	446, 982
BseRI	GAGGAG	1 cut(s)	680
BseYI	CCCAGC	1 cut(s)	880
Bsh1285I	CGRYCG	2 cut(s)	130, 914
BshFI	GGCC	2 cut(s)	675, 819
BsiEI	CGRYCG	2 cut(s)	130, 914
BsiSI	CCGG	2 cut(s)	173, 467
BslFI	GGGAC	1 cut(s)	693
BslI	CCNNNNNNNGG	3 cut(s)	330, 599, 815
BsmFI	GGGAC	1 cut(s)	693
BsnI	GGCC	2 cut(s)	675, 819
Bsp13I	TCCGGA	1 cut(s)	172
Bsp143I	GATC	4 cut(s)	127, 491, 729, 919
BspACI	CCGC	2 cut(s)	806, 954
BspANI	GGCC	2 cut(s)	675, 819
BspCNI	CTCAG	2 cut(s)	429, 916
BspEI	TCCGGA	1 cut(s)	172
BspHI	TCATGA	1 cut(s)	54
BspLI	GGNNCC	2 cut(s)	295, 709
BspMI	ACCTGC	1 cut(s)	100
BspPI	GGATC	2 cut(s)	499, 724
BsrDI	GCAATG	1 cut(s)	124
BsrI	ACTGG	2 cut(s)	446, 982
BssECI	CCNNGG	1 cut(s)	597
BssMI	GATC	4 cut(s)	127, 491, 729, 919
BssNI	GRCGYC	1 cut(s)	247
BssT1I	CCWWGG	1 cut(s)	597
Bst4CI	ACNGT	5 cut(s)	205, 306, 500, 622, 846
BstACI	GRCGYC	1 cut(s)	247
BstBAI	YACGTR	1 cut(s)	780
BstDEI	CTNAG	3 cut(s)	329, 416, 903
BstENI	CCTNNNNNAGG	2 cut(s)	328, 813
BstF5I	GGATG	2 cut(s)	181, 585
BstKTI	GATC	4 cut(s)	130, 494, 732, 922
BstMBI	GATC	4 cut(s)	127, 491, 729, 919
BstMCI	CGRYCG	2 cut(s)	130, 914
BstMWI	GCNNNNNNNGC	4 cut(s)	13, 101, 363, 913
BstNSI	RCATGY	1 cut(s)	430
BstSCI	CCNGG	1 cut(s)	465
BstSFI	CTRYAG	1 cut(s)	759
BstSNI	TACGTA	1 cut(s)	780
BstXI	CCANNNNNNTGG	1 cut(s)	430
BsuRI	GGCC	2 cut(s)	675, 819
BtsCI	GGATG	2 cut(s)	181, 585
BtsIMutI	CAGTG	3 cut(s)	453, 627, 989
BveI	ACCTGC	1 cut(s)	100
CciI	TCATGA	1 cut(s)	54
Cfr13I	GGNCC	1 cut(s)	707
Csp6I	GTAC	3 cut(s)	307, 420, 950
CspCI	CAANNNNNGTGG	2 cut(s)	579, 614
CviAII	CATG	5 cut(s)	50, 55, 192, 290, 427
CviQI	GTAC	3 cut(s)	307, 420, 950
DdeI	CTNAG	3 cut(s)	329, 416, 903
DpnI	GATC	4 cut(s)	129, 493, 731, 921
DpnII	GATC	4 cut(s)	127, 491, 729, 919
EciI	GGCGGA	1 cut(s)	795
Eco105I	TACGTA	1 cut(s)	780
Eco130I	CCWWGG	1 cut(s)	597
Eco147I	AGGCCT	1 cut(s)	819
Eco47I	GGWCC	1 cut(s)	707
Eco57I	CTGAAG	1 cut(s)	504
EcoNI	CCTNNNNNAGG	2 cut(s)	328, 813
EcoRI	GAATTC	2 cut(s)	441, 863
EcoT14I	CCWWGG	1 cut(s)	597
EcoT22I	ATGCAT	1 cut(s)	112
ErhI	CCWWGG	1 cut(s)	597
FaeI	CATG	5 cut(s)	53, 58, 195, 293, 430
FaqI	GGGAC	1 cut(s)	693
FatI	CATG	5 cut(s)	49, 54, 191, 289, 426
FauI	CCCGC	1 cut(s)	961
FauNDI	CATATG	1 cut(s)	12
FokI	GGATG	2 cut(s)	188, 572
GsaI	CCCAGC	1 cut(s)	884
GsuI	CTGGAG	1 cut(s)	965
HaeIII	GGCC	2 cut(s)	675, 819
HapII	CCGG	2 cut(s)	173, 467
Hin1I	GRCGYC	1 cut(s)	247
Hin1II	CATG	5 cut(s)	53, 58, 195, 293, 430
HindIII	AAGCTT	2 cut(s)	542, 685
HinfI	GANTC	1 cut(s)	764
HpaII	CCGG	2 cut(s)	173, 467
HphI	GGTGA	1 cut(s)	67
Hpy166II	GTNNAC	2 cut(s)	208, 451
Hpy188I	TCNGA	2 cut(s)	398, 576
Hpy188III	TCNNGA	5 cut(s)	55, 173, 560, 662, 870
Hpy8I	GTNNAC	2 cut(s)	208, 451
Hpy99I	CGWCG	1 cut(s)	249
HpyAV	CCTTC	6 cut(s)	56, 80, 469, 528, 603, 778
HpyCH4III	ACNGT	5 cut(s)	205, 306, 500, 622, 846
HpyCH4IV	ACGT	2 cut(s)	247, 779
HpyCH4V	TGCA	6 cut(s)	29, 104, 110, 159, 216, 289
HpyF10VI	GCNNNNNNNGC	4 cut(s)	13, 101, 363, 913
HpyF3I	CTNAG	3 cut(s)	329, 416, 903
HpySE526I	ACGT	2 cut(s)	247, 779
Hsp92I	GRCGYC	1 cut(s)	247
Hsp92II	CATG	5 cut(s)	53, 58, 195, 293, 430
Kpn2I	TCCGGA	1 cut(s)	172
Kzo9I	GATC	4 cut(s)	127, 491, 729, 919
LmnI	GCTCC	1 cut(s)	4
LweI	GCATC	2 cut(s)	486, 594
MaeII	ACGT	2 cut(s)	247, 779
MaeIII	GTNAC	2 cut(s)	229, 256
MalI	GATC	4 cut(s)	129, 493, 731, 921
MboI	GATC	4 cut(s)	127, 491, 729, 919
MboII	GAAGA	1 cut(s)	335
MlyI	GAGTC	1 cut(s)	758
MmeI	TCCRAC	4 cut(s)	112, 411, 421, 862
MnlI	CCTC	8 cut(s)	329, 384, 427, 575, 658, 744, 748, 787
Mph1103I	ATGCAT	1 cut(s)	112
MroI	TCCGGA	1 cut(s)	172
MroXI	GAANNNNTTC	1 cut(s)	607
MseI	TTAA	2 cut(s)	473, 747
MspI	CCGG	2 cut(s)	173, 467
MspR9I	CCNGG	1 cut(s)	467
MwoI	GCNNNNNNNGC	4 cut(s)	13, 101, 363, 913
NciI	CCSGG	1 cut(s)	467
NdeI	CATATG	1 cut(s)	12
NdeII	GATC	4 cut(s)	127, 491, 729, 919
NlaIII	CATG	5 cut(s)	53, 58, 195, 293, 430
NlaIV	GGNNCC	2 cut(s)	295, 709
NsiI	ATGCAT	1 cut(s)	112
NspI	RCATGY	1 cut(s)	430
PagI	TCATGA	1 cut(s)	54
PceI	AGGCCT	1 cut(s)	819
PciI	ACATGT	1 cut(s)	426
PdmI	GAANNNNTTC	1 cut(s)	607
PflFI	GACNNNGTC	1 cut(s)	246
Ple19I	CGATCG	1 cut(s)	130
PleI	GAGTC	1 cut(s)	758
PpsI	GAGTC	1 cut(s)	758
Ppu21I	YACGTR	1 cut(s)	780
PscI	ACATGT	1 cut(s)	426
PsiI	TTATAA	1 cut(s)	639
PspFI	CCCAGC	1 cut(s)	880
PspN4I	GGNNCC	2 cut(s)	295, 709
PspPI	GGNCC	1 cut(s)	707
PsyI	GACNNNGTC	1 cut(s)	246
PvuI	CGATCG	1 cut(s)	130
RsaI	GTAC	3 cut(s)	308, 421, 951
RsaNI	GTAC	3 cut(s)	307, 420, 950
SaqAI	TTAA	2 cut(s)	473, 747
Sau3AI	GATC	4 cut(s)	127, 491, 729, 919
Sau96I	GGNCC	1 cut(s)	707
SchI	GAGTC	1 cut(s)	758
ScrFI	CCNGG	1 cut(s)	467
SfaNI	GCATC	2 cut(s)	486, 594
SfcI	CTRYAG	1 cut(s)	759
SinI	GGWCC	1 cut(s)	707
SmlI	CTYRAG	1 cut(s)	560
SmoI	CTYRAG	1 cut(s)	560
SnaBI	TACGTA	1 cut(s)	780
SseBI	AGGCCT	1 cut(s)	819
SsiI	CCGC	2 cut(s)	806, 954
StuI	AGGCCT	1 cut(s)	819
StyD4I	CCNGG	1 cut(s)	465
StyI	CCWWGG	1 cut(s)	597
TaaI	ACNGT	5 cut(s)	205, 306, 500, 622, 846
TaiI	ACGT	2 cut(s)	250, 782
TaqI	TCGA	1 cut(s)	494
TaqII	GACCGA	1 cut(s)	900
TatI	WGTACW	1 cut(s)	306
Tru1I	TTAA	2 cut(s)	473, 747
Tru9I	TTAA	2 cut(s)	473, 747
TscAI	CASTG	3 cut(s)	453, 627, 989
TspDTI	ATGAA	7 cut(s)	38, 135, 325, 554, 600, 876, 876
TspRI	CASTG	3 cut(s)	453, 627, 989
Tth111I	GACNNNGTC	1 cut(s)	246
VpaK11BI	GGWCC	1 cut(s)	707
XagI	CCTNNNNNAGG	2 cut(s)	328, 813
XapI	RAATTY	5 cut(s)	146, 441, 694, 863, 967
XceI	RCATGY	1 cut(s)	430
XmnI	GAANNNNTTC	1 cut(s)	607
ZraI	GACGTC	1 cut(s)	248
Zsp2I	ATGCAT	1 cut(s)	112

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.