Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002705.1

Orthogroup ID

OG0000248

Physical Location & Seq

Genomic Coordinates Forward (+)

8595 .. 9652

Gene Structure 1058 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002705.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 993 bp

atggagagtttcacataccatcaagtcctgacccttctccttttcatcaactttttacaacctaccactgttttaagttcatttggcaatgaaaccgatcacttggctttgctaaaattcaaagattgcatagcctctgatccacatgggctattgaattcatggaatgactccgttcattactgcaaatggcctggaattacttgtggtagacgacatcaaagagtaacagccttgaacctaccacatgctgttttgcacggaaccatatctccttacattggcaacctctcctttcttaggttcatcaaccttcgaaacaacagcttctctggcaacattccgcaacaagttgaacatttattccgactccgccatctcaatctcagtatcaacatgttgcaggggggaattccagtcaacctaaccttctcccaccaattaagcatcataaccattgcatggaaccgccttactgggaaaattccttcagagattggttcactgaagcttgtgtgtcttgatcttcagattaacaatttgacaggaggcataccaccttccttgggaaatctttcatcaatcacttttctttccttacaagagaacaatttggtgggcaacgtaccagaggaaataggtcgattgagaagcttatcatttttttcaattggtcccaataatctctcgggtacgatacctccctccttttttaacatatcatctatgaaccgcttctcactttcagctaataaatttaagggcagtattccacctggtataggcctaaacatgcctaatctccaagtagtgtaccttggtacaaatgaattctctggccaaatcccagcttcattttccaatgcttctcagcttcagatacttgatgttggggaaaataattttgttgggcaagttcctgcaagttttggaaattttcccaatctccagctgctcaacttcgagcaatttgtggctgttttctatgagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0007275 GO:0008150 GO:0009790 GO:0009791 GO:0009793 GO:0009888 GO:0010065 GO:0010067 GO:0010087 GO:0010154 GO:0022414 GO:0032501 GO:0032502 GO:0048316 GO:0048507 GO:0048508 GO:0048608 GO:0048731 GO:0048856 GO:0061458

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05169 map04010 map04064 map04620 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05169

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

330

Amino Acids

36.48

Weight (kDa)

7.78

Isoelectric Point (pI)

40.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000248)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g31390 FvH4_5g31630 FvH4_5g31631 FvH4_7g24151 FvH4_7g24160 FvH4_7g24240 FvH4_7g24242 FvH4_7g24243 FvH4_7g24510 FvH4_7g24920 FvH4_7g24920 FvH4_7g24920 FvH4_7g29910
malus_domestica	MD01G1131800.v1.1 MD01G1150000.v1.1 MD01G1151300.v1.1
prunus_persica	Prupe.2G248300_v2.0.a1
pyrus_communis	pycom01g16800
rosa_chinensis	RchiOBHm_Chr1g0339821 RchiOBHm_Chr1g0345151 RchiOBHm_Chr1g0346851 RchiOBHm_Chr1g0351981 RchiOBHm_Chr1g0369731 RchiOBHm_Chr1g0369841 RchiOBHm_Chr1g0369861 RchiOBHm_Chr1g0369931 RchiOBHm_Chr1g0369961 RchiOBHm_Chr1g0370261 RchiOBHm_Chr1g0370281 RchiOBHm_Chr5g0076391 RchiOBHm_Chr6g0248051 RchiOBHm_Chr6g0248071
rosa_laevigata	RLG00000002548 RLG00000013479 RLG00000027042 RLG00000027045 RLG00000027047 RLG00000027060 RLG00000027063 RLG00000027082 RLG00000027084 RLG00000027087 RLG00000027089 RLG00000027090 RLG00000027091 RLG00000027092 RLG00000027094 RLG00000027097 RLG00000027100 RLG00000027101 RLG00000027111 RLG00000028769 RLG00000028851 RLG00000029244 RLG00000030021
rosa_multiflora	Rmu_co7968444.1_g000001 Rmu_co8060564.1_g000001 Rmu_co8098766.1_g000001 Rmu_co8172886.1_g000001 Rmu_co8291893.1_g000001 Rmu_co8327887.1_g000001 Rmu_co8406981.1_g000001 Rmu_co8449189.1_g000001 Rmu_co8470871.1_g000001 Rmu_sc0000756.1_g000006 Rmu_sc0001154.1_g000028 Rmu_sc0001565.1_g000055 Rmu_sc0001657.1_g000002 Rmu_sc0002095.1_g000014 Rmu_sc0002147.1_g000001 Rmu_sc0002705.1_g000004 Rmu_sc0002705.1_g000005 Rmu_sc0004087.1_g000025 Rmu_sc0005500.1_g000022 Rmu_sc0006707.1_g000005 Rmu_sc0006707.1_g000009 Rmu_sc0008140.1_g000012 Rmu_sc0008140.1_g000019 Rmu_sc0016176.1_g000001 Rmu_sc0016906.1_g000006 Rmu_sc0028980.1_g000001 Rmu_sc0041369.1_g000001
rosa_roxburghii	Rroxscaffold_3G00232610 Rroxscaffold_4G00286690 Rroxscaffold_4G00286920 Rroxscaffold_4G00286930 Rroxscaffold_4G00286960 Rroxscaffold_4G00286980 Rroxscaffold_4G00287030 Rroxscaffold_4G00287040 Rroxscaffold_4G00287070 Rroxscaffold_4G00287090 Rroxscaffold_4G00287330 Rroxscaffold_4G00287430 Rroxscaffold_4G00303380 Rroxscaffold_4G00303400 Rroxscaffold_4G00303410 Rroxscaffold_4G00308100 Rroxscaffold_4G00308480 Rroxscaffold_4G00313700 Rroxscaffold_4G00322910 Rroxscaffold_7G00190680 Rroxscaffold_7G00193490
rosa_rugosa	Rorug01G0032200 Rorug01G0139400.1 Rorug01G0139600.1 Rorug01G0139700.1 Rorug01G0184400 Rorug01G0351900 Rorug01G0351900 Rorug01G0352600 Rorug01G0352600 Rorug01G0352800 Rorug01G0355300 Rorug01G0355400 Rorug01G0356700.1 Rorug01G0356800 Rorug06G0090600 Rorug07G0276100
rosa_samantha	Rh1AG201900 Rh1AG361300 Rh1AG365100 Rh6AG204000
rosa_wichuraiana	Rw0G015480 Rw1G007000 Rw1G008190 Rw1G012880 Rw1G012990 Rw1G016950 Rw1G031720 Rw1G031800 Rw1G031820 Rw1G032020 Rw1G032180 Rw6G017720 Rw7G035600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	462
AccI	GTMKAC	1 cut(s)	211
AciI	CCGC	4 cut(s)	344, 373, 469, 733
AclWI	GGATC	1 cut(s)	134
AcoI	YGGCCR	1 cut(s)	838
AcsI	RAATTY	7 cut(s)	116, 157, 411, 483, 755, 830, 934
AcuI	CTGAAG	4 cut(s)	474, 512, 527, 860
AfaI	GTAC	4 cut(s)	627, 694, 815, 823
AfiI	CCNNNNNNNGG	5 cut(s)	281, 300, 462, 566, 782
AflIII	ACRYGT	1 cut(s)	396
AgsI	TTSAA	5 cut(s)	121, 157, 238, 356, 669
AjnI	CCWGG	2 cut(s)	193, 775
AloI	GAACNNNNNNTCC	4 cut(s)	256, 288, 348, 380
AluBI	AGCT	7 cut(s)	327, 511, 654, 749, 851, 874, 952
AluI	AGCT	7 cut(s)	327, 511, 654, 749, 851, 874, 952
AlwI	GGATC	1 cut(s)	134
Ama87I	CYCGRG	1 cut(s)	688
AoxI	GGCC	3 cut(s)	191, 784, 838
ApeKI	GCWGC	1 cut(s)	952
ApoI	RAATTY	7 cut(s)	116, 157, 411, 483, 755, 830, 934
Asp700I	GAANNNNTTC	2 cut(s)	574, 734
AspS9I	GGNCC	1 cut(s)	674
AsuII	TTCGAA	1 cut(s)	316
AvaI	CYCGRG	1 cut(s)	688
AvaII	GGWCC	1 cut(s)	674
BalI	TGGCCA	1 cut(s)	840
BbvI	GCAGC	1 cut(s)	939
BccI	CCATC	2 cut(s)	27, 384
BciT130I	CCWGG	2 cut(s)	195, 777
BisI	GCNGC	1 cut(s)	953
BlsI	GCNGC	1 cut(s)	954
Bme1390I	CCNGG	2 cut(s)	195, 777
Bme18I	GGWCC	1 cut(s)	674
BmeT110I	CYCGRG	1 cut(s)	688
BmgT120I	GGNCC	1 cut(s)	674
BmiI	GGNNCC	3 cut(s)	265, 467, 676
BmrFI	CCNGG	2 cut(s)	195, 777
BmrI	ACTGGG	1 cut(s)	486
BmsI	GCATC	1 cut(s)	456
BmuI	ACTGGG	1 cut(s)	486
BpmI	CTGGAG	1 cut(s)	932
Bpu14I	TTCGAA	1 cut(s)	316
BsaJI	CCNNGG	2 cut(s)	564, 817
BsaXI	ACNNNNNCTCC	4 cut(s)	256, 286, 685, 715
Bsc4I	CCNNNNNNNGG	5 cut(s)	281, 300, 462, 566, 782
Bse1I	ACTGG	2 cut(s)	416, 481
Bse3DI	GCAATG	2 cut(s)	94, 456
BseBI	CCWGG	2 cut(s)	195, 777
BseDI	CCNNGG	2 cut(s)	564, 817
BseLI	CCNNNNNNNGG	5 cut(s)	281, 300, 462, 566, 782
BseMI	GCAATG	2 cut(s)	94, 456
BseMII	CTCAG	2 cut(s)	400, 884
BseNI	ACTGG	2 cut(s)	416, 481
BseXI	GCAGC	1 cut(s)	939
BseYI	CCCAGC	1 cut(s)	847
BshFI	GGCC	3 cut(s)	193, 786, 840
BsiHKCI	CYCGRG	1 cut(s)	688
BslFI	GGGAC	1 cut(s)	660
BslI	CCNNNNNNNGG	5 cut(s)	281, 300, 462, 566, 782
BsmFI	GGGAC	1 cut(s)	660
BsnI	GGCC	3 cut(s)	193, 786, 840
BsoBI	CYCGRG	1 cut(s)	688
Bsp119I	TTCGAA	1 cut(s)	316
Bsp143I	GATC	3 cut(s)	97, 139, 523
BspACI	CCGC	4 cut(s)	344, 373, 469, 733
BspANI	GGCC	3 cut(s)	193, 786, 840
BspCNI	CTCAG	2 cut(s)	399, 883
BspLI	GGNNCC	3 cut(s)	265, 467, 676
BspPI	GGATC	1 cut(s)	134
BspT104I	TTCGAA	1 cut(s)	316
BsrDI	GCAATG	2 cut(s)	94, 456
BsrI	ACTGG	2 cut(s)	416, 481
BssECI	CCNNGG	2 cut(s)	564, 817
BssMI	GATC	3 cut(s)	97, 139, 523
BssT1I	CCWWGG	2 cut(s)	564, 817
Bst2UI	CCWGG	2 cut(s)	195, 777
Bst4CI	ACNGT	1 cut(s)	70
BstBI	TTCGAA	1 cut(s)	316
BstDEI	CTNAG	3 cut(s)	299, 386, 870
BstENI	CCTNNNNNAGG	2 cut(s)	298, 780
BstKTI	GATC	3 cut(s)	100, 142, 526
BstMBI	GATC	3 cut(s)	97, 139, 523
BstMWI	GCNNNNNNNGC	1 cut(s)	333
BstNI	CCWGG	2 cut(s)	195, 777
BstNSI	RCATGY	3 cut(s)	251, 400, 796
BstSCI	CCNGG	2 cut(s)	193, 775
BstV1I	GCAGC	1 cut(s)	939
BsuRI	GGCC	3 cut(s)	193, 786, 840
BtsIMutI	CAGTG	2 cut(s)	66, 503
Cfr13I	GGNCC	1 cut(s)	674
CsiI	ACCWGGT	1 cut(s)	775
Csp6I	GTAC	4 cut(s)	626, 693, 814, 822
CspCI	CAANNNNNGTGG	2 cut(s)	546, 581
CviAII	CATG	6 cut(s)	146, 162, 248, 397, 462, 793
CviQI	GTAC	4 cut(s)	626, 693, 814, 822
DdeI	CTNAG	3 cut(s)	299, 386, 870
DpnI	GATC	3 cut(s)	99, 141, 525
DpnII	GATC	3 cut(s)	97, 139, 523
EaeI	YGGCCR	1 cut(s)	838
EciI	GGCGGA	1 cut(s)	362
Eco130I	CCWWGG	2 cut(s)	564, 817
Eco147I	AGGCCT	1 cut(s)	786
Eco47I	GGWCC	1 cut(s)	674
Eco57I	CTGAAG	4 cut(s)	474, 512, 527, 860
Eco88I	CYCGRG	1 cut(s)	688
EcoNI	CCTNNNNNAGG	2 cut(s)	298, 780
EcoRI	GAATTC	3 cut(s)	157, 411, 830
EcoRII	CCWGG	2 cut(s)	193, 775
EcoT14I	CCWWGG	2 cut(s)	564, 817
ErhI	CCWWGG	2 cut(s)	564, 817
FaeI	CATG	6 cut(s)	149, 165, 251, 400, 465, 796
FaqI	GGGAC	1 cut(s)	660
FatI	CATG	6 cut(s)	145, 161, 247, 396, 461, 792
FblI	GTMKAC	1 cut(s)	211
Fnu4HI	GCNGC	1 cut(s)	953
Fsp4HI	GCNGC	1 cut(s)	953
GluI	GCNGC	1 cut(s)	953
GsaI	CCCAGC	1 cut(s)	851
GsuI	CTGGAG	1 cut(s)	932
HaeIII	GGCC	3 cut(s)	193, 786, 840
Hin1II	CATG	6 cut(s)	149, 165, 251, 400, 465, 796
HincII	GTYRAC	1 cut(s)	421
HindII	GTYRAC	1 cut(s)	421
HindIII	AAGCTT	2 cut(s)	509, 652
HinfI	GANTC	2 cut(s)	170, 369
Hpy166II	GTNNAC	4 cut(s)	212, 421, 503, 814
Hpy188I	TCNGA	5 cut(s)	139, 368, 493, 531, 879
Hpy188III	TCNNGA	2 cut(s)	28, 521
Hpy8I	GTNNAC	4 cut(s)	212, 421, 503, 814
HpyAV	CCTTC	5 cut(s)	44, 323, 439, 498, 570
HpyCH4III	ACNGT	1 cut(s)	70
HpyCH4IV	ACGT	1 cut(s)	624
HpyCH4V	TGCA	6 cut(s)	129, 186, 259, 403, 461, 923
HpyF10VI	GCNNNNNNNGC	1 cut(s)	333
HpyF3I	CTNAG	3 cut(s)	299, 386, 870
HpySE526I	ACGT	1 cut(s)	624
Hsp92II	CATG	6 cut(s)	149, 165, 251, 400, 465, 796
Kzo9I	GATC	3 cut(s)	97, 139, 523
Lsp1109I	GCAGC	1 cut(s)	939
LweI	GCATC	1 cut(s)	456
MabI	ACCWGGT	1 cut(s)	775
MaeII	ACGT	1 cut(s)	624
MaeIII	GTNAC	1 cut(s)	226
MalI	GATC	3 cut(s)	99, 141, 525
MboI	GATC	3 cut(s)	97, 139, 523
MboII	GAAGA	1 cut(s)	518
MfeI	CAATTG	1 cut(s)	669
MlsI	TGGCCA	1 cut(s)	840
MluNI	TGGCCA	1 cut(s)	840
MlyI	GAGTC	2 cut(s)	164, 363
MmeI	TCCRAC	1 cut(s)	391
MnlI	CCTC	6 cut(s)	145, 299, 542, 625, 711, 715
Mox20I	TGGCCA	1 cut(s)	840
MroXI	GAANNNNTTC	2 cut(s)	574, 734
MscI	TGGCCA	1 cut(s)	840
MseI	TTAA	5 cut(s)	74, 443, 534, 714, 759
Msp20I	TGGCCA	1 cut(s)	840
MspA1I	CMGCKG	1 cut(s)	952
MspR9I	CCNGG	2 cut(s)	195, 777
MunI	CAATTG	1 cut(s)	669
MvaI	CCWGG	2 cut(s)	195, 777
MwoI	GCNNNNNNNGC	1 cut(s)	333
NdeII	GATC	3 cut(s)	97, 139, 523
NlaIII	CATG	6 cut(s)	149, 165, 251, 400, 465, 796
NlaIV	GGNNCC	3 cut(s)	265, 467, 676
NspI	RCATGY	3 cut(s)	251, 400, 796
NspV	TTCGAA	1 cut(s)	316
PceI	AGGCCT	1 cut(s)	786
PciI	ACATGT	1 cut(s)	396
PdmI	GAANNNNTTC	2 cut(s)	574, 734
PflMI	CCANNNNNTGG	1 cut(s)	462
PkrI	GCNGC	1 cut(s)	954
PleI	GAGTC	2 cut(s)	164, 363
PpsI	GAGTC	2 cut(s)	164, 363
PscI	ACATGT	1 cut(s)	396
Psp6I	CCWGG	2 cut(s)	193, 775
PspFI	CCCAGC	1 cut(s)	847
PspGI	CCWGG	2 cut(s)	193, 775
PspN4I	GGNNCC	3 cut(s)	265, 467, 676
PspPI	GGNCC	1 cut(s)	674
PvuII	CAGCTG	1 cut(s)	952
RsaI	GTAC	4 cut(s)	627, 694, 815, 823
RsaNI	GTAC	4 cut(s)	626, 693, 814, 822
SaqAI	TTAA	5 cut(s)	74, 443, 534, 714, 759
SatI	GCNGC	1 cut(s)	953
Sau3AI	GATC	3 cut(s)	97, 139, 523
Sau96I	GGNCC	1 cut(s)	674
SchI	GAGTC	2 cut(s)	164, 363
ScrFI	CCNGG	2 cut(s)	195, 777
SexAI	ACCWGGT	1 cut(s)	775
SfaNI	GCATC	1 cut(s)	456
SfuI	TTCGAA	1 cut(s)	316
SinI	GGWCC	1 cut(s)	674
SseBI	AGGCCT	1 cut(s)	786
SsiI	CCGC	4 cut(s)	344, 373, 469, 733
StuI	AGGCCT	1 cut(s)	786
StyD4I	CCNGG	2 cut(s)	193, 775
StyI	CCWWGG	2 cut(s)	564, 817
TaaI	ACNGT	1 cut(s)	70
TaiI	ACGT	1 cut(s)	627
TaqI	TCGA	3 cut(s)	316, 643, 963
Tru1I	TTAA	5 cut(s)	74, 443, 534, 714, 759
Tru9I	TTAA	5 cut(s)	74, 443, 534, 714, 759
TscAI	CASTG	2 cut(s)	73, 510
TseI	GCWGC	1 cut(s)	952
TspGWI	ACGGA	2 cut(s)	163, 276
TspRI	CASTG	2 cut(s)	73, 510
Van91I	CCANNNNNTGG	1 cut(s)	462
VpaK11BI	GGWCC	1 cut(s)	674
XagI	CCTNNNNNAGG	2 cut(s)	298, 780
XapI	RAATTY	7 cut(s)	116, 157, 411, 483, 755, 830, 934
XceI	RCATGY	3 cut(s)	251, 400, 796
XmiI	GTMKAC	1 cut(s)	211
XmnI	GAANNNNTTC	2 cut(s)	574, 734

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.