Rmu_sc0002073.1_g000012

BAHD acyltransferase At5g47980-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002073.1
OG0000200
Physical Location & Seq
Forward (+)
66884 .. 67810
927 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002073.1_g000012.1.cds

Sequence Viewer

Length: 927 bp
atgattaccgaaagatctaagcttctgaaaacttcattatctaaaaccctcagccgcttctatccctttgcaggaaaaatatttagccacaacaacattctttcaatctgttgcaatgacaatggggctgaatttattgaaactcatgtcaattgtcccatatcaaaggttatggaaaagcacaattctgggatactgagtcaattacttccaaatgacgtacaatcaacatttgaaagcacaggctatctcctattagtccaagccaacttctttgaatgtggtggacttgcaattgggattaccatttcacacaagatcgcggacgggtttacactcggaatgttcatccgtagctgggcagcaatgtgccttggctctgatgtagtggctcttccagctacagaatttggtgttccagcatctctttacccacaacaagatttattcatcaactcattgtcaacttccagggaatatgttaatagtgaagcttgcgtcaataagagatttgtgtttgatgcctcaaatattgtacgtctcaagtctaaagccaccggtgctaccgttccaaatccaactcgtgttgaagtagtgacagcacttctctggaaatgtgcaatggaagcatcaagatcaaacttgagttttacaaggccagctgtgctgtttctagcagcaaacttgcggaaagtattgaagcatcccaatttaatgggaaatcttgtaggacatgtctttgcagcaaagacacaagaaggtgatgcaactcttcaaagcttaaatgctataatcaggaaaagcattgaggaatttaaagtgaaatatggtgagggagttagcggggatgctatttgccaaaattttaaagagcatggagatttaatggataataatgatataaataactatatctgcagcagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko00941 ko00945 ko01100 ko01110 map00940 map00941 map00945 map01100 map01110
Pfam Domains
Protein Families
Transferase

Protein Analysis

308

Amino Acids

33.76

Weight (kDa)

8.04

Isoelectric Point (pI)

41.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000200)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G24420 AT1G24420
fragaria_vesca FvH4_3g15900 FvH4_3g15901 FvH4_3g15902 FvH4_3g15903 FvH4_3g15910 FvH4_3g16350 FvH4_3g16950 FvH4_3g17000 FvH4_3g17010 FvH4_3g35170 FvH4_4g17550
malus_domestica MD02G1273000.v1.1 MD03G1110800.v1.1 MD05G1218500.v1.1 MD05G1218600.v1.1 MD05G1218800.v1.1 MD05G1218900.v1.1 MD05G1219000.v1.1 MD09G1267700.v1.1 MD10G1199600.v1.1 MD10G1199700.v1.1 MD10G1200000.v1.1 MD10G1200100.v1.1 MD10G1200300.v1.1 MD10G1201000.v1.1 MD11G1116900.v1.1 MD11G1117000.v1.1 MD11G1275900.v1.1 MD13G1109500.v1.1 MD14G1011700.v1.1 MD14G1015400.v1.1 MD14G1015500.v1.1
prunus_persica Prupe.4G140700_v2.0.a1 Prupe.4G140800_v2.0.a1 Prupe.4G141500_v2.0.a1
pyrus_communis pycom02g23390 pycom05g19930 pycom05g19940 pycom05g19970 pycom05g19980 pycom05g19990 pycom05g20000 pycom05g20020 pycom10g17190 pycom10g17200 pycom10g17210 pycom10g17220 pycom10g24650 pycom11g24430 pycom14g01050 pycom14g01330 pycom16g06450
rosa_chinensis RchiOBHm_Chr4g0391831 RchiOBHm_Chr4g0391841 RchiOBHm_Chr4g0407921 RchiOBHm_Chr4g0408021 RchiOBHm_Chr4g0412981 RchiOBHm_Chr4g0415601 RchiOBHm_Chr4g0415621 RchiOBHm_Chr4g0421461 RchiOBHm_Chr4g0431781 RchiOBHm_Chr5g0026651 RchiOBHm_Chr5g0026721 RchiOBHm_Chr5g0026731 RchiOBHm_Chr5g0026741 RchiOBHm_Chr5g0026751 RchiOBHm_Chr5g0026821 RchiOBHm_Chr5g0028341
rosa_laevigata RLG00000006890 RLG00000007680 RLG00000007682 RLG00000008056 RLG00000008057 RLG00000008058 RLG00000008060 RLG00000008681 RLG00000032943 RLG00000032951 RLG00000032955 RLG00000032956 RLG00000032957 RLG00000032958 RLG00000032961 RLG00000033083 RLG00000033084
rosa_multiflora Rmu_co7991326.1_g000001 Rmu_co8439139.1_g000001 Rmu_co8448401.1_g000001 Rmu_sc0001194.1_g000015 Rmu_sc0001962.1_g000015 Rmu_sc0002073.1_g000012 Rmu_sc0004490.1_g000006 Rmu_sc0004599.1_g000009 Rmu_sc0004805.1_g000044 Rmu_sc0008526.1_g000001 Rmu_ssc0000172.1_g000021 Rmu_ssc0000172.1_g000031 Rmu_ssc0000172.1_g000032
rosa_roxburghii Rroxscaffold_1G00051360 Rroxscaffold_1G00051390 Rroxscaffold_1G00052710 Rroxscaffold_1G00052750 Rroxscaffold_1G00052810 Rroxscaffold_1G00052820 Rroxscaffold_4G00321060 Rroxscaffold_4G00321070 Rroxscaffold_5G00352550 Rroxscaffold_5G00359410
rosa_rugosa Rorug01G0079700 Rorug01G0080700 Rorug04G0083200 Rorug04G0083400 Rorug04G0135400 Rorug04G0135500.1 Rorug04G0135900 Rorug04G0171400 Rorug04G0252300 Rorug05G0095200 Rorug05G0095300 Rorug05G0095400 Rorug05G0402400
rosa_samantha Rh1DG103500 Rh4AG176900 Rh4AG196400 Rh4AG232100 Rh4AG308800 Rh4DG141600 Rh4DG194000 Rh4DG194100 Rh4DG194300 Rh4DG230600 Rh5AG177800 Rh5AG188100 Rh5AG188800 Rh5AG188900 Rh5AG199400 Rh5DG187300 Rh5DG187400 Rh5DG188000 Rh5DG199900
rosa_wichuraiana Rw0G018630 Rw1G007730 Rw4G012100 Rw4G016700 Rw4G020190 Rw5G016100 Rw5G017090 Rw5G017100 Rw5G017110 Rw5G018170 Rw5G018180

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 323
AciI CCGC 4 cut(s) 55, 323, 688, 843
AcsI RAATTY 4 cut(s) 131, 407, 812, 862
AfaI GTAC 2 cut(s) 222, 537
AfiI CCNNNNNNNGG 2 cut(s) 71, 358
AflIII ACRYGT 1 cut(s) 733
AgeI ACCGGT 1 cut(s) 557
AgsI TTSAA 7 cut(s) 105, 140, 236, 278, 590, 700, 776
AjnI CCWGG 1 cut(s) 470
AluBI AGCT 6 cut(s) 22, 357, 401, 494, 662, 780
AluI AGCT 6 cut(s) 22, 357, 401, 494, 662, 780
Alw26I GTCTC 1 cut(s) 545
AoxI GGCC 1 cut(s) 656
ApeKI GCWGC 4 cut(s) 362, 677, 743, 918
ApoI RAATTY 4 cut(s) 131, 407, 812, 862
AsiGI ACCGGT 1 cut(s) 557
AsuHPI GGTGA 2 cut(s) 773, 842
BarI GAAGNNNNNNTAC 2 cut(s) 378, 410
BauI CACGAG 1 cut(s) 582
BbvCI CCTCAGC 1 cut(s) 50
BbvI GCAGC 3 cut(s) 374, 689, 755
BciT130I CCWGG 1 cut(s) 472
BciVI GTATCC 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 545
BfaI CTAG 1 cut(s) 674
BfmI CTRYAG 2 cut(s) 402, 916
BfuI GTATCC 1 cut(s) 186
BglII AGATCT 1 cut(s) 14
BisI GCNGC 5 cut(s) 55, 363, 678, 744, 919
BlsI GCNGC 5 cut(s) 56, 364, 679, 745, 920
Bme1390I CCNGG 1 cut(s) 472
BmrFI CCNGG 1 cut(s) 472
BmsI GCATC 6 cut(s) 431, 511, 638, 712, 754, 838
Bpu10I CCTNAGC 1 cut(s) 50
BpuEI CTTGAG 2 cut(s) 527, 664
BsaJI CCNNGG 2 cut(s) 373, 471
BsaWI WCCGGW 1 cut(s) 557
Bsc4I CCNNNNNNNGG 2 cut(s) 71, 358
Bse118I RCCGGY 1 cut(s) 557
Bse3DI GCAATG 3 cut(s) 121, 372, 627
BseBI CCWGG 1 cut(s) 472
BseDI CCNNGG 2 cut(s) 373, 471
BseGI GGATG 3 cut(s) 348, 703, 853
BseLI CCNNNNNNNGG 2 cut(s) 71, 358
BseMI GCAATG 3 cut(s) 121, 372, 627
BseMII CTCAG 2 cut(s) 64, 188
BseXI GCAGC 3 cut(s) 374, 689, 755
BseYI CCCAGC 1 cut(s) 357
Bsh1236I CGCG 1 cut(s) 323
BshFI GGCC 1 cut(s) 658
BshTI ACCGGT 1 cut(s) 557
BsiSI CCGG 1 cut(s) 558
BslFI GGGAC 1 cut(s) 141
BslI CCNNNNNNNGG 2 cut(s) 71, 358
BsmAI GTCTC 1 cut(s) 545
BsmBI CGTCTC 1 cut(s) 545
BsmFI GGGAC 1 cut(s) 141
BsnI GGCC 1 cut(s) 658
Bsp143I GATC 3 cut(s) 14, 318, 635
BspACI CCGC 4 cut(s) 55, 323, 688, 843
BspANI GGCC 1 cut(s) 658
BspCNI CTCAG 2 cut(s) 63, 189
BspFNI CGCG 1 cut(s) 323
BspMAI CTGCAG 1 cut(s) 920
BspQI GCTCTTC 1 cut(s) 399
BsrDI GCAATG 3 cut(s) 121, 372, 627
BsrFI RCCGGY 1 cut(s) 557
BssAI RCCGGY 1 cut(s) 557
BssECI CCNNGG 2 cut(s) 373, 471
BssMI GATC 3 cut(s) 14, 318, 635
BssSI CACGAG 1 cut(s) 582
BssT1I CCWWGG 1 cut(s) 373
Bst2BI CACGAG 1 cut(s) 582
Bst2UI CCWGG 1 cut(s) 472
Bst4CI ACNGT 1 cut(s) 568
Bst6I CTCTTC 2 cut(s) 399, 777
BstC8I GCNNGC 2 cut(s) 496, 660
BstDEI CTNAG 3 cut(s) 18, 50, 197
BstF5I GGATG 3 cut(s) 348, 703, 853
BstFNI CGCG 1 cut(s) 323
BstKTI GATC 3 cut(s) 17, 321, 638
BstMAI GTCTC 1 cut(s) 545
BstMBI GATC 3 cut(s) 14, 318, 635
BstMWI GCNNNNNNNGC 4 cut(s) 398, 560, 626, 664
BstNI CCWGG 1 cut(s) 472
BstNSI RCATGY 1 cut(s) 737
BstSCI CCNGG 1 cut(s) 470
BstSFI CTRYAG 2 cut(s) 402, 916
BstUI CGCG 1 cut(s) 323
BstV1I GCAGC 3 cut(s) 374, 689, 755
BstX2I RGATCY 1 cut(s) 14
BstXI CCANNNNNNTGG 1 cut(s) 715
BstYI RGATCY 1 cut(s) 14
BsuI GTATCC 1 cut(s) 186
BsuRI GGCC 1 cut(s) 658
BtsCI GGATG 3 cut(s) 348, 703, 853
Cac8I GCNNGC 2 cut(s) 496, 660
Cfr10I RCCGGY 1 cut(s) 557
CseI GACGC 1 cut(s) 487
Csp6I GTAC 2 cut(s) 221, 536
CspAI ACCGGT 1 cut(s) 557
CviAII CATG 3 cut(s) 146, 734, 875
CviQI GTAC 2 cut(s) 221, 536
DdeI CTNAG 3 cut(s) 18, 50, 197
DpnI GATC 3 cut(s) 16, 320, 637
DpnII GATC 3 cut(s) 14, 318, 635
DraI TTTAAA 2 cut(s) 817, 868
Eam1104I CTCTTC 2 cut(s) 399, 777
EarI CTCTTC 2 cut(s) 399, 777
Eco130I CCWWGG 1 cut(s) 373
EcoRII CCWGG 1 cut(s) 470
EcoT14I CCWWGG 1 cut(s) 373
ErhI CCWWGG 1 cut(s) 373
Esp3I CGTCTC 1 cut(s) 545
FaeI CATG 3 cut(s) 149, 737, 878
FaqI GGGAC 1 cut(s) 141
FatI CATG 3 cut(s) 145, 733, 874
FauI CCCGC 1 cut(s) 836
Fnu4HI GCNGC 5 cut(s) 55, 363, 678, 744, 919
FokI GGATG 3 cut(s) 335, 690, 860
Fsp4HI GCNGC 5 cut(s) 55, 363, 678, 744, 919
FspBI CTAG 1 cut(s) 674
GluI GCNGC 5 cut(s) 55, 363, 678, 744, 919
GsaI CCCAGC 1 cut(s) 361
HaeIII GGCC 1 cut(s) 658
HapII CCGG 1 cut(s) 558
HgaI GACGC 1 cut(s) 487
Hin1II CATG 3 cut(s) 149, 737, 878
HincII GTYRAC 1 cut(s) 465
HindII GTYRAC 1 cut(s) 465
HindIII AAGCTT 3 cut(s) 20, 492, 778
HinfI GANTC 1 cut(s) 199
HpaII CCGG 1 cut(s) 558
HphI GGTGA 2 cut(s) 773, 842
Hpy166II GTNNAC 3 cut(s) 287, 333, 465
Hpy188I TCNGA 3 cut(s) 27, 341, 382
Hpy188III TCNNGA 3 cut(s) 610, 633, 796
Hpy8I GTNNAC 3 cut(s) 287, 333, 465
HpyAV CCTTC 1 cut(s) 752
HpyCH4III ACNGT 1 cut(s) 568
HpyCH4IV ACGT 2 cut(s) 219, 538
HpyCH4V TGCA 7 cut(s) 71, 114, 293, 620, 743, 767, 918
HpyF10VI GCNNNNNNNGC 4 cut(s) 398, 560, 626, 664
HpyF3I CTNAG 3 cut(s) 18, 50, 197
HpySE526I ACGT 2 cut(s) 219, 538
Hsp92II CATG 3 cut(s) 149, 737, 878
Kzo9I GATC 3 cut(s) 14, 318, 635
LguI GCTCTTC 1 cut(s) 399
Lsp1109I GCAGC 3 cut(s) 374, 689, 755
LweI GCATC 6 cut(s) 431, 511, 638, 712, 754, 838
MaeI CTAG 1 cut(s) 674
MaeII ACGT 2 cut(s) 219, 538
MaeIII GTNAC 1 cut(s) 595
MalI GATC 3 cut(s) 16, 320, 637
MboI GATC 3 cut(s) 14, 318, 635
MboII GAAGA 2 cut(s) 386, 764
MfeI CAATTG 2 cut(s) 151, 294
MflI RGATCY 1 cut(s) 14
MluCI AATT 9 cut(s) 131, 151, 184, 203, 294, 407, 709, 812, 862
MlyI GAGTC 1 cut(s) 208
MmeI TCCRAC 1 cut(s) 602
MnlI CCTC 4 cut(s) 59, 535, 802, 826
MseI TTAA 6 cut(s) 483, 713, 782, 816, 867, 884
MspA1I CMGCKG 1 cut(s) 662
MspI CCGG 1 cut(s) 558
MspR9I CCNGG 1 cut(s) 472
MunI CAATTG 2 cut(s) 151, 294
MvaI CCWGG 1 cut(s) 472
MvnI CGCG 1 cut(s) 323
MwoI GCNNNNNNNGC 4 cut(s) 398, 560, 626, 664
NdeII GATC 3 cut(s) 14, 318, 635
NlaIII CATG 3 cut(s) 149, 737, 878
NmuCI GTSAC 1 cut(s) 595
NspI RCATGY 1 cut(s) 737
PciI ACATGT 1 cut(s) 733
PciSI GCTCTTC 1 cut(s) 399
PinAI ACCGGT 1 cut(s) 557
PkrI GCNGC 5 cut(s) 56, 364, 679, 745, 920
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
PscI ACATGT 1 cut(s) 733
Psp6I CCWGG 1 cut(s) 470
PspFI CCCAGC 1 cut(s) 357
PspGI CCWGG 1 cut(s) 470
PstI CTGCAG 1 cut(s) 920
PsuI RGATCY 1 cut(s) 14
PvuII CAGCTG 1 cut(s) 662
RsaI GTAC 2 cut(s) 222, 537
RsaNI GTAC 2 cut(s) 221, 536
SapI GCTCTTC 1 cut(s) 399
SaqAI TTAA 6 cut(s) 483, 713, 782, 816, 867, 884
SatI GCNGC 5 cut(s) 55, 363, 678, 744, 919
Sau3AI GATC 3 cut(s) 14, 318, 635
SchI GAGTC 1 cut(s) 208
ScrFI CCNGG 1 cut(s) 472
SfaNI GCATC 6 cut(s) 431, 511, 638, 712, 754, 838
SfcI CTRYAG 2 cut(s) 402, 916
SgrAI CRCCGGYG 1 cut(s) 557
SmlI CTYRAG 2 cut(s) 542, 643
SmoI CTYRAG 2 cut(s) 542, 643
Sse9I AATT 9 cut(s) 131, 151, 184, 203, 294, 407, 709, 812, 862
SsiI CCGC 4 cut(s) 55, 323, 688, 843
SspI AATATT 2 cut(s) 81, 532
SspMI CTAG 1 cut(s) 674
StyD4I CCNGG 1 cut(s) 470
StyI CCWWGG 1 cut(s) 373
TaaI ACNGT 1 cut(s) 568
TaiI ACGT 2 cut(s) 222, 541
TasI AATT 9 cut(s) 131, 151, 184, 203, 294, 407, 709, 812, 862
TauI GCSGC 1 cut(s) 57
Tru1I TTAA 6 cut(s) 483, 713, 782, 816, 867, 884
Tru9I TTAA 6 cut(s) 483, 713, 782, 816, 867, 884
TseFI GTSAC 1 cut(s) 595
TseI GCWGC 4 cut(s) 362, 677, 743, 918
Tsp45I GTSAC 1 cut(s) 595
TspDTI ATGAA 3 cut(s) 24, 337, 439
TspGWI ACGGA 1 cut(s) 341
XapI RAATTY 4 cut(s) 131, 407, 812, 862
XceI RCATGY 1 cut(s) 737
XspI CTAG 1 cut(s) 674
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.