Rmu_sc0004490.1_g000006

BAHD acyltransferase At5g47980-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004490.1
Physical Location & Seq
Forward (+)
32601 .. 32858
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004490.1_g000006.1.cds

Sequence Viewer

Length: 258 bp
atggaatcaacacaagaaagcacaggagggtatcttctactagtccaggccaacttctttgaatgcggaggagttgcgattggggtcagcatttcacacaaggctgcagatgcctctacactcggcacgttcatcagtagctgggctgcagtggcccttggtgcagaggtagaggcacttccagctgcagaatttggtgttgcagcttctaattacccagctaaatttcttcaacaagacatcacttccagctgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

8.68

Weight (kDa)

4.16

Isoelectric Point (pI)

44.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000200)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G24420 AT1G24420
fragaria_vesca FvH4_3g15900 FvH4_3g15901 FvH4_3g15902 FvH4_3g15903 FvH4_3g15910 FvH4_3g16350 FvH4_3g16950 FvH4_3g17000 FvH4_3g17010 FvH4_3g35170 FvH4_4g17550
malus_domestica MD02G1273000.v1.1 MD03G1110800.v1.1 MD05G1218500.v1.1 MD05G1218600.v1.1 MD05G1218800.v1.1 MD05G1218900.v1.1 MD05G1219000.v1.1 MD09G1267700.v1.1 MD10G1199600.v1.1 MD10G1199700.v1.1 MD10G1200000.v1.1 MD10G1200100.v1.1 MD10G1200300.v1.1 MD10G1201000.v1.1 MD11G1116900.v1.1 MD11G1117000.v1.1 MD11G1275900.v1.1 MD13G1109500.v1.1 MD14G1011700.v1.1 MD14G1015400.v1.1 MD14G1015500.v1.1
prunus_persica Prupe.4G140700_v2.0.a1 Prupe.4G140800_v2.0.a1 Prupe.4G141500_v2.0.a1
pyrus_communis pycom02g23390 pycom05g19930 pycom05g19940 pycom05g19970 pycom05g19980 pycom05g19990 pycom05g20000 pycom05g20020 pycom10g17190 pycom10g17200 pycom10g17210 pycom10g17220 pycom10g24650 pycom11g24430 pycom14g01050 pycom14g01330 pycom16g06450
rosa_chinensis RchiOBHm_Chr4g0391831 RchiOBHm_Chr4g0391841 RchiOBHm_Chr4g0407921 RchiOBHm_Chr4g0408021 RchiOBHm_Chr4g0412981 RchiOBHm_Chr4g0415601 RchiOBHm_Chr4g0415621 RchiOBHm_Chr4g0421461 RchiOBHm_Chr4g0431781 RchiOBHm_Chr5g0026651 RchiOBHm_Chr5g0026721 RchiOBHm_Chr5g0026731 RchiOBHm_Chr5g0026741 RchiOBHm_Chr5g0026751 RchiOBHm_Chr5g0026821 RchiOBHm_Chr5g0028341
rosa_laevigata RLG00000006890 RLG00000007680 RLG00000007682 RLG00000008056 RLG00000008057 RLG00000008058 RLG00000008060 RLG00000008681 RLG00000032943 RLG00000032951 RLG00000032955 RLG00000032956 RLG00000032957 RLG00000032958 RLG00000032961 RLG00000033083 RLG00000033084
rosa_multiflora Rmu_co7991326.1_g000001 Rmu_co8439139.1_g000001 Rmu_co8448401.1_g000001 Rmu_sc0001194.1_g000015 Rmu_sc0001962.1_g000015 Rmu_sc0002073.1_g000012 Rmu_sc0004490.1_g000006 Rmu_sc0004599.1_g000009 Rmu_sc0004805.1_g000044 Rmu_sc0008526.1_g000001 Rmu_ssc0000172.1_g000021 Rmu_ssc0000172.1_g000031 Rmu_ssc0000172.1_g000032
rosa_roxburghii Rroxscaffold_1G00051360 Rroxscaffold_1G00051390 Rroxscaffold_1G00052710 Rroxscaffold_1G00052750 Rroxscaffold_1G00052810 Rroxscaffold_1G00052820 Rroxscaffold_4G00321060 Rroxscaffold_4G00321070 Rroxscaffold_5G00352550 Rroxscaffold_5G00359410
rosa_rugosa Rorug01G0079700 Rorug01G0080700 Rorug04G0083200 Rorug04G0083400 Rorug04G0135400 Rorug04G0135500.1 Rorug04G0135900 Rorug04G0171400 Rorug04G0252300 Rorug05G0095200 Rorug05G0095300 Rorug05G0095400 Rorug05G0402400
rosa_samantha Rh1DG103500 Rh4AG176900 Rh4AG196400 Rh4AG232100 Rh4AG308800 Rh4DG141600 Rh4DG194000 Rh4DG194100 Rh4DG194300 Rh4DG230600 Rh5AG177800 Rh5AG188100 Rh5AG188800 Rh5AG188900 Rh5AG199400 Rh5DG187300 Rh5DG187400 Rh5DG188000 Rh5DG199900
rosa_wichuraiana Rw0G018630 Rw1G007730 Rw4G012100 Rw4G016700 Rw4G020190 Rw5G016100 Rw5G017090 Rw5G017100 Rw5G017110 Rw5G018170 Rw5G018180

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 66
AcsI RAATTY 2 cut(s) 191, 224
AgsI TTSAA 2 cut(s) 62, 233
AhlI ACTAGT 1 cut(s) 40
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 5 cut(s) 141, 185, 206, 221, 252
AluI AGCT 5 cut(s) 141, 185, 206, 221, 252
AlwNI CAGNNNCTG 2 cut(s) 141, 255
AoxI GGCC 2 cut(s) 48, 153
ApeKI GCWGC 5 cut(s) 104, 146, 185, 203, 252
ApoI RAATTY 2 cut(s) 191, 224
AspS9I GGNCC 1 cut(s) 154
BarI GAAGNNNNNNTAC 2 cut(s) 162, 194
BbvI GCAGC 5 cut(s) 91, 133, 172, 215, 239
BciT130I CCWGG 1 cut(s) 47
BcuI ACTAGT 1 cut(s) 40
BfaI CTAG 1 cut(s) 41
BfmI CTRYAG 3 cut(s) 105, 147, 186
BisI GCNGC 5 cut(s) 105, 147, 186, 204, 253
BlsI GCNGC 5 cut(s) 106, 148, 187, 205, 254
Bme1390I CCNGG 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 154
BmrFI CCNGG 1 cut(s) 47
BmsI GCATC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 157
BseBI CCWGG 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 157
BseRI GAGGAG 1 cut(s) 84
BseXI GCAGC 5 cut(s) 91, 133, 172, 215, 239
BseYI CCCAGC 2 cut(s) 141, 217
BsgI GTGCAG 1 cut(s) 183
BshFI GGCC 2 cut(s) 50, 155
BsmI GAATGC 1 cut(s) 68
BsnI GGCC 2 cut(s) 50, 155
BspACI CCGC 1 cut(s) 66
BspANI GGCC 2 cut(s) 50, 155
BspMAI CTGCAG 3 cut(s) 109, 151, 190
BssECI CCNNGG 1 cut(s) 157
BssT1I CCWWGG 1 cut(s) 157
Bst2UI CCWGG 1 cut(s) 47
BstMWI GCNNNNNNNGC 4 cut(s) 110, 152, 161, 182
BstNI CCWGG 1 cut(s) 47
BstSCI CCNGG 1 cut(s) 45
BstSFI CTRYAG 3 cut(s) 105, 147, 186
BstV1I GCAGC 5 cut(s) 91, 133, 172, 215, 239
BsuRI GGCC 2 cut(s) 50, 155
BtsI GCAGTG 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 156
CaiI CAGNNNCTG 2 cut(s) 141, 255
Cfr13I GGNCC 1 cut(s) 154
CviJI RGCY 9 cut(s) 50, 104, 141, 146, 155, 185, 206, 221, 252
CviKI_1 RGCY 9 cut(s) 50, 104, 141, 146, 155, 185, 206, 221, 252
Eco130I CCWWGG 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 157
ErhI CCWWGG 1 cut(s) 157
Fnu4HI GCNGC 5 cut(s) 105, 147, 186, 204, 253
Fsp4HI GCNGC 5 cut(s) 105, 147, 186, 204, 253
FspBI CTAG 1 cut(s) 41
GluI GCNGC 5 cut(s) 105, 147, 186, 204, 253
GsaI CCCAGC 2 cut(s) 145, 221
HaeIII GGCC 2 cut(s) 50, 155
HinfI GANTC 1 cut(s) 5
HpyCH4IV ACGT 1 cut(s) 128
HpyCH4V TGCA 5 cut(s) 107, 149, 164, 188, 203
HpyF10VI GCNNNNNNNGC 4 cut(s) 110, 152, 161, 182
HpySE526I ACGT 1 cut(s) 128
LpnPI CCDG 6 cut(s) 9, 32, 59, 127, 195, 231
Lsp1109I GCAGC 5 cut(s) 91, 133, 172, 215, 239
LweI GCATC 1 cut(s) 100
MaeI CTAG 1 cut(s) 41
MaeII ACGT 1 cut(s) 128
MboII GAAGA 2 cut(s) 26, 221
MluCI AATT 3 cut(s) 191, 211, 224
MnlI CCTC 5 cut(s) 20, 62, 124, 160, 166
MspA1I CMGCKG 2 cut(s) 185, 252
MspR9I CCNGG 1 cut(s) 47
Mva1269I GAATGC 1 cut(s) 68
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 4 cut(s) 110, 152, 161, 182
NmeAIII GCCGAG 1 cut(s) 102
PctI GAATGC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 5 cut(s) 106, 148, 187, 205, 254
Psp6I CCWGG 1 cut(s) 45
PspFI CCCAGC 2 cut(s) 141, 217
PspGI CCWGG 1 cut(s) 45
PspPI GGNCC 1 cut(s) 154
PstI CTGCAG 3 cut(s) 109, 151, 190
PstNI CAGNNNCTG 2 cut(s) 141, 255
PvuII CAGCTG 2 cut(s) 185, 252
SatI GCNGC 5 cut(s) 105, 147, 186, 204, 253
Sau96I GGNCC 1 cut(s) 154
ScrFI CCNGG 1 cut(s) 47
SetI ASST 7 cut(s) 131, 143, 171, 187, 208, 223, 254
SfaNI GCATC 1 cut(s) 100
SfcI CTRYAG 3 cut(s) 105, 147, 186
SpeI ACTAGT 1 cut(s) 40
Sse9I AATT 3 cut(s) 191, 211, 224
SsiI CCGC 1 cut(s) 66
SspMI CTAG 1 cut(s) 41
StyD4I CCNGG 1 cut(s) 45
StyI CCWWGG 1 cut(s) 157
TaiI ACGT 1 cut(s) 131
TasI AATT 3 cut(s) 191, 211, 224
TfiI GAWTC 1 cut(s) 5
TscAI CASTG 1 cut(s) 156
TseI GCWGC 5 cut(s) 104, 146, 185, 203, 252
TspDTI ATGAA 1 cut(s) 121
TspRI CASTG 1 cut(s) 156
XapI RAATTY 2 cut(s) 191, 224
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.