Rmu_sc0013176.1_g000005
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013176.1
OG0000240
Physical Location & Seq
Forward (+)
11711 .. 13721
2011 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013176.1_g000005.1.cds

Sequence Viewer

Length: 954 bp
atgggaaagaagaaatccacttgtactgaaagtgagggatctggaaaacaaaaggccacatggccggatgaggtagtagctatattttgtgacatagctgttaaggaagtggccaaaggaaacagacctggtactcattttgataaaaagggatggtcaaatgttatcaaggcctttaaggagttaacaggaagggattatgataaaaggcaattgaaaaataagtgggattcacttaaaaatgattggaaattgtggagttcactattgcatagggaaactggtattggatgggatccggctaggaagactgtcgatgcacctactgagtggtgggaatccaaaatccagatcaatccagagtatcgcaaatttcgtgacgttggaattagtccggaaatgatggttgtttatgataacatgtttaggggtagcacagccttaggtcactctgtcatggttctctcagctactatagatattgaagaggtggtggaggattctaagcataatgacatttctggagatgatgaggagatggaccagcaaggtaatgaaccaagagggaaaaagagaacaaatgtggagtgccaaactgggcctaataaagaaaaaaaagataaaggagttatgggagggccaaaggggaagaaagaaaaggtgggaggtgcagctaaattgtctaagcaaattgatcgtcttgttgaagtagtggagagtaggagtacaactacatctgtcagtaatactagtacagaacaaggaactagtattcaggaggtgatgcgagttgttgcaactttaccaggagcagaaattggtaccaagctgtggtggtttgcaacagagttgttctgctctcaagagaagcgagagatgttttctattatgacagatgatgatctcaagctccagtttctgattcttaatcagaaaaaaaaaactgaaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

317

Amino Acids

35.81

Weight (kDa)

8.16

Isoelectric Point (pI)

33.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000240)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G11300
fragaria_vesca FvH4_1g19130 FvH4_1g28413 FvH4_2g11122 FvH4_3g19652 FvH4_3g29921 FvH4_4g07761 FvH4_4g20923 FvH4_5g23913 FvH4_5g23913 FvH4_6g38850 FvH4_6g39920 FvH4_6g53022 FvH4_7g00070 FvH4_7g08972 FvH4_7g12221
malus_domestica MD06G1090800.v1.1 MD15G1314200.v1.1 MD16G1231800.v1.1
prunus_persica Prupe.1G173000_v2.0.a1 Prupe.4G113600_v2.0.a1 Prupe.5G020800_v2.0.a1 Prupe.5G020800_v2.0.a1 Prupe.5G020800_v2.0.a1 Prupe.5G207000_v2.0.a1 Prupe.6G155900_v2.0.a1 Prupe.8G016500_v2.0.a1
pyrus_communis pycom03g16230 pycom04g16130 pycom05g03970 pycom05g10500 pycom08g06480 pycom08g11770 pycom12g11350 pycom12g18510 pycom13g02550 pycom13g13780 pycom13g27450 pycom13g27460 pycom15g26130 pycom15g27470
rosa_chinensis RchiOBHm_Chr2g0103961 RchiOBHm_Chr2g0128681 RchiOBHm_Chr2g0153151 RchiOBHm_Chr3g0459461 RchiOBHm_Chr4g0406011 RchiOBHm_Chr4g0428601 RchiOBHm_Chr5g0029731 RchiOBHm_Chr5g0069971 RchiOBHm_Chr6g0253171 RchiOBHm_Chr6g0254701 RchiOBHm_Chr7g0199281
rosa_laevigata RLG00000002281 RLG00000007586 RLG00000008509 RLG00000008888 RLG00000009501 RLG00000012763
rosa_multiflora Rmu_sc0000008.1_g000009 Rmu_sc0000079.1_g000058 Rmu_sc0000117.1_g000008 Rmu_sc0000151.1_g000009 Rmu_sc0000166.1_g000053 Rmu_sc0000240.1_g000064 Rmu_sc0000435.1_g000013 Rmu_sc0000552.1_g000019 Rmu_sc0000776.1_g000078 Rmu_sc0001597.1_g000012 Rmu_sc0001759.1_g000017 Rmu_sc0002137.1_g000011 Rmu_sc0002933.1_g000006 Rmu_sc0002938.1_g000049 Rmu_sc0003257.1_g000014 Rmu_sc0003465.1_g000054 Rmu_sc0003505.1_g000025 Rmu_sc0003526.1_g000016 Rmu_sc0003829.1_g000021 Rmu_sc0003855.1_g000002 Rmu_sc0005514.1_g000003 Rmu_sc0005514.1_g000004 Rmu_sc0007820.1_g000001 Rmu_sc0008322.1_g000016 Rmu_sc0008636.1_g000003 Rmu_sc0008812.1_g000009 Rmu_sc0010960.1_g000003 Rmu_sc0011753.1_g000001 Rmu_sc0013017.1_g000001 Rmu_sc0013176.1_g000005 Rmu_sc0015928.1_g000001 Rmu_sc0020751.1_g000003 Rmu_sc0038865.1_g000001 Rmu_ssc0000089.1_g000008 Rmu_ssc0000164.1_g000007 Rmu_ssc0000388.1_g000013 Rmu_ssc0000400.1_g000076 Rmu_ssc0000486.1_g000012
rosa_roxburghii Rroxscaffold_1G00005880 Rroxscaffold_1G00051030 Rroxscaffold_2G00107440 Rroxscaffold_2G00115370 Rroxscaffold_2G00115870 Rroxscaffold_2G00146360 Rroxscaffold_3G00228870 Rroxscaffold_3G00230350 Rroxscaffold_3G00246190 Rroxscaffold_6G00423350 Rroxscaffold_7G00157820 Rroxscaffold_7G00184840 Rroxscaffold_7G00186490
rosa_rugosa Rorug02G0248700 Rorug02G0279900 Rorug02G0285600 Rorug02G0285700 Rorug03G0068700 Rorug03G0077100 Rorug03G0247700 Rorug03G0304800 Rorug04G0059600 Rorug05G0104000 Rorug05G0104000 Rorug05G0192000 Rorug05G0247800 Rorug05G0248000 Rorug06G0064100 Rorug06G0244800
rosa_samantha Rh4BG200400 Rh4CG094600 Rh4CG114400 Rh5BG465300 Rh6AG057500
rosa_wichuraiana Rw1G014470 Rw2G026930 Rw5G042730 Rw6G021090 Rw6G022960 Rw6G025470 Rw6G034450 Rw7G034300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 821
AccB1I GGYRCC 1 cut(s) 821
AccB7I CCANNNNNTGG 1 cut(s) 831
AccIII TCCGGA 1 cut(s) 394
AclWI GGATC 3 cut(s) 46, 290, 303
AcoI YGGCCR 2 cut(s) 62, 111
AcsI RAATTY 1 cut(s) 371
AfaI GTAC 5 cut(s) 25, 133, 727, 754, 823
AfiI CCNNNNNNNGG 1 cut(s) 831
AflIII ACRYGT 1 cut(s) 420
AgsI TTSAA 3 cut(s) 217, 485, 707
AhlI ACTAGT 2 cut(s) 749, 767
AjnI CCWGG 2 cut(s) 127, 805
AjuI GAANNNNNNNTTGG 2 cut(s) 270, 302
AluBI AGCT 6 cut(s) 80, 98, 470, 674, 829, 910
AluI AGCT 6 cut(s) 80, 98, 470, 674, 829, 910
AlwI GGATC 3 cut(s) 46, 290, 303
AlwNI CAGNNNCTG 1 cut(s) 919
Aor13HI TCCGGA 1 cut(s) 394
AoxI GGCC 6 cut(s) 54, 62, 111, 171, 599, 638
ApeKI GCWGC 1 cut(s) 671
ApoI RAATTY 1 cut(s) 371
ArsI GACNNNNNNTTYG 2 cut(s) 682, 714
Asp718I GGTACC 1 cut(s) 821
AspS9I GGNCC 3 cut(s) 541, 599, 638
AsuHPI GGTGA 1 cut(s) 793
AvaII GGWCC 1 cut(s) 541
AxyI CCTNAGG 1 cut(s) 442
BalI TGGCCA 1 cut(s) 113
BamHI GGATCC 1 cut(s) 295
BanI GGYRCC 1 cut(s) 821
BbsI GAAGAC 1 cut(s) 314
BbvI GCAGC 1 cut(s) 683
BccI CCATC 4 cut(s) 147, 285, 397, 532
BcgI CGANNNNNNTGC 2 cut(s) 677, 711
BciT130I CCWGG 2 cut(s) 129, 807
BcuI ACTAGT 2 cut(s) 749, 767
BfaI CTAG 3 cut(s) 303, 750, 768
BfmI CTRYAG 1 cut(s) 474
BisI GCNGC 1 cut(s) 672
BlsI GCNGC 1 cut(s) 673
Bme1390I CCNGG 2 cut(s) 129, 807
Bme18I GGWCC 1 cut(s) 541
BmgT120I GGNCC 3 cut(s) 541, 599, 638
BmiI GGNNCC 2 cut(s) 297, 823
BmrFI CCNGG 2 cut(s) 129, 807
BmrI ACTGGG 1 cut(s) 606
BmsI GCATC 2 cut(s) 307, 774
BmuI ACTGGG 1 cut(s) 606
BpiI GAAGAC 1 cut(s) 314
BpmI CTGGAG 2 cut(s) 543, 896
BpuEI CTTGAG 2 cut(s) 846, 890
BsaBI GATNNNNATC 1 cut(s) 900
BsaWI WCCGGW 1 cut(s) 394
Bsc4I CCNNNNNNNGG 1 cut(s) 831
Bse1I ACTGG 3 cut(s) 286, 601, 913
Bse21I CCTNAGG 1 cut(s) 442
Bse8I GATNNNNATC 1 cut(s) 900
BseAI TCCGGA 1 cut(s) 394
BseBI CCWGG 2 cut(s) 129, 807
BseGI GGATG 3 cut(s) 73, 158, 296
BseJI GATNNNNATC 1 cut(s) 900
BseLI CCNNNNNNNGG 1 cut(s) 831
BseMII CTCAG 2 cut(s) 318, 480
BseNI ACTGG 3 cut(s) 286, 601, 913
BseRI GAGGAG 1 cut(s) 548
BseXI GCAGC 1 cut(s) 683
BsgI GTGCAG 1 cut(s) 690
BshFI GGCC 6 cut(s) 56, 64, 113, 173, 601, 640
BshNI GGYRCC 1 cut(s) 821
BsiSI CCGG 3 cut(s) 65, 299, 395
BslI CCNNNNNNNGG 1 cut(s) 831
BsnI GGCC 6 cut(s) 56, 64, 113, 173, 601, 640
Bsp13I TCCGGA 1 cut(s) 394
Bsp143I GATC 5 cut(s) 38, 295, 351, 694, 901
BspANI GGCC 6 cut(s) 56, 64, 113, 173, 601, 640
BspCNI CTCAG 2 cut(s) 319, 479
BspEI TCCGGA 1 cut(s) 394
BspLI GGNNCC 2 cut(s) 297, 823
BspPI GGATC 3 cut(s) 46, 290, 303
BspT107I GGYRCC 1 cut(s) 821
BsrI ACTGG 3 cut(s) 286, 601, 913
BssMI GATC 5 cut(s) 38, 295, 351, 694, 901
Bst2UI CCWGG 2 cut(s) 129, 807
Bst4CI ACNGT 1 cut(s) 313
Bst6I CTCTTC 1 cut(s) 480
BstDEI CTNAG 5 cut(s) 327, 442, 466, 504, 684
BstF5I GGATG 3 cut(s) 73, 158, 296
BstKTI GATC 5 cut(s) 41, 298, 354, 697, 904
BstMBI GATC 5 cut(s) 38, 295, 351, 694, 901
BstNI CCWGG 2 cut(s) 129, 807
BstNSI RCATGY 1 cut(s) 424
BstSCI CCNGG 2 cut(s) 127, 805
BstSFI CTRYAG 1 cut(s) 474
BstV1I GCAGC 1 cut(s) 683
BstV2I GAAGAC 1 cut(s) 314
BstX2I RGATCY 2 cut(s) 38, 295
BstYI RGATCY 2 cut(s) 38, 295
Bsu36I CCTNAGG 1 cut(s) 442
BsuRI GGCC 6 cut(s) 56, 64, 113, 173, 601, 640
BtsCI GGATG 3 cut(s) 73, 158, 296
CaiI CAGNNNCTG 1 cut(s) 919
Cfr13I GGNCC 3 cut(s) 541, 599, 638
CsiI ACCWGGT 1 cut(s) 127
Csp6I GTAC 5 cut(s) 24, 132, 726, 753, 822
CviAII CATG 3 cut(s) 60, 421, 457
CviQI GTAC 5 cut(s) 24, 132, 726, 753, 822
DdeI CTNAG 5 cut(s) 327, 442, 466, 504, 684
DpnI GATC 5 cut(s) 40, 297, 353, 696, 903
DpnII GATC 5 cut(s) 38, 295, 351, 694, 901
EaeI YGGCCR 2 cut(s) 62, 111
Eam1104I CTCTTC 1 cut(s) 480
EarI CTCTTC 1 cut(s) 480
Eco147I AGGCCT 1 cut(s) 173
Eco47I GGWCC 1 cut(s) 541
Eco81I CCTNAGG 1 cut(s) 442
EcoRII CCWGG 2 cut(s) 127, 805
FaeI CATG 3 cut(s) 63, 424, 460
FatI CATG 3 cut(s) 59, 420, 456
Fnu4HI GCNGC 1 cut(s) 672
FokI GGATG 3 cut(s) 80, 165, 303
Fsp4HI GCNGC 1 cut(s) 672
FspBI CTAG 3 cut(s) 303, 750, 768
GluI GCNGC 1 cut(s) 672
GsuI CTGGAG 2 cut(s) 543, 896
HaeIII GGCC 6 cut(s) 56, 64, 113, 173, 601, 640
HapII CCGG 3 cut(s) 65, 299, 395
Hin1II CATG 3 cut(s) 63, 424, 460
HincII GTYRAC 1 cut(s) 186
HindII GTYRAC 1 cut(s) 186
HinfI GANTC 4 cut(s) 230, 338, 500, 922
HpaI GTTAAC 1 cut(s) 186
HpaII CCGG 3 cut(s) 65, 299, 395
HphI GGTGA 1 cut(s) 793
Hpy166II GTNNAC 2 cut(s) 186, 263
Hpy188I TCNGA 2 cut(s) 921, 933
Hpy188III TCNNGA 8 cut(s) 42, 349, 359, 377, 395, 522, 776, 863
Hpy8I GTNNAC 2 cut(s) 186, 263
HpyAV CCTTC 1 cut(s) 186
HpyCH4III ACNGT 1 cut(s) 313
HpyCH4IV ACGT 1 cut(s) 381
HpyCH4V TGCA 5 cut(s) 271, 320, 671, 797, 842
HpyF3I CTNAG 5 cut(s) 327, 442, 466, 504, 684
HpySE526I ACGT 1 cut(s) 381
Hsp92II CATG 3 cut(s) 63, 424, 460
Kpn2I TCCGGA 1 cut(s) 394
KpnI GGTACC 1 cut(s) 825
KspAI GTTAAC 1 cut(s) 186
Kzo9I GATC 5 cut(s) 38, 295, 351, 694, 901
LmnI GCTCC 2 cut(s) 809, 915
Lsp1109I GCAGC 1 cut(s) 683
LweI GCATC 2 cut(s) 307, 774
MabI ACCWGGT 1 cut(s) 127
MaeI CTAG 3 cut(s) 303, 750, 768
MaeII ACGT 1 cut(s) 381
MaeIII GTNAC 3 cut(s) 89, 377, 446
MalI GATC 5 cut(s) 40, 297, 353, 696, 903
MboI GATC 5 cut(s) 38, 295, 351, 694, 901
MboII GAAGA 4 cut(s) 22, 319, 497, 661
MfeI CAATTG 1 cut(s) 212
MflI RGATCY 2 cut(s) 38, 295
MlsI TGGCCA 1 cut(s) 113
MluCI AATT 8 cut(s) 212, 251, 371, 387, 677, 690, 816, 949
MluNI TGGCCA 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 364
MnlI CCTC 9 cut(s) 28, 64, 481, 490, 526, 557, 629, 659, 772
Mox20I TGGCCA 1 cut(s) 113
MroI TCCGGA 1 cut(s) 394
MscI TGGCCA 1 cut(s) 113
MseI TTAA 6 cut(s) 102, 177, 185, 237, 927, 952
Msp20I TGGCCA 1 cut(s) 113
MspI CCGG 3 cut(s) 65, 299, 395
MspR9I CCNGG 2 cut(s) 129, 807
MunI CAATTG 1 cut(s) 212
MvaI CCWGG 2 cut(s) 129, 807
NdeII GATC 5 cut(s) 38, 295, 351, 694, 901
NlaIII CATG 3 cut(s) 63, 424, 460
NlaIV GGNNCC 2 cut(s) 297, 823
NmuCI GTSAC 3 cut(s) 89, 377, 446
NspI RCATGY 1 cut(s) 424
PceI AGGCCT 1 cut(s) 173
PciI ACATGT 1 cut(s) 420
PcsI WCGNNNNNNNCGW 1 cut(s) 373
PfeI GAWTC 4 cut(s) 230, 338, 500, 922
PflMI CCANNNNNTGG 1 cut(s) 831
PkrI GCNGC 1 cut(s) 673
PscI ACATGT 1 cut(s) 420
Psp6I CCWGG 2 cut(s) 127, 805
PspGI CCWGG 2 cut(s) 127, 805
PspN4I GGNNCC 2 cut(s) 297, 823
PspPI GGNCC 3 cut(s) 541, 599, 638
PstNI CAGNNNCTG 1 cut(s) 919
PsuI RGATCY 2 cut(s) 38, 295
RsaI GTAC 5 cut(s) 25, 133, 727, 754, 823
RsaNI GTAC 5 cut(s) 24, 132, 726, 753, 822
SaqAI TTAA 6 cut(s) 102, 177, 185, 237, 927, 952
SatI GCNGC 1 cut(s) 672
Sau3AI GATC 5 cut(s) 38, 295, 351, 694, 901
Sau96I GGNCC 3 cut(s) 541, 599, 638
ScrFI CCNGG 2 cut(s) 129, 807
SexAI ACCWGGT 1 cut(s) 127
SfaNI GCATC 2 cut(s) 307, 774
SfcI CTRYAG 1 cut(s) 474
SinI GGWCC 1 cut(s) 541
SmlI CTYRAG 2 cut(s) 861, 905
SmoI CTYRAG 2 cut(s) 861, 905
SpeI ACTAGT 2 cut(s) 749, 767
Sse9I AATT 8 cut(s) 212, 251, 371, 387, 677, 690, 816, 949
SseBI AGGCCT 1 cut(s) 173
SspMI CTAG 3 cut(s) 303, 750, 768
StuI AGGCCT 1 cut(s) 173
StyD4I CCNGG 2 cut(s) 127, 805
TaaI ACNGT 1 cut(s) 313
TaiI ACGT 1 cut(s) 384
TaqI TCGA 1 cut(s) 315
TasI AATT 8 cut(s) 212, 251, 371, 387, 677, 690, 816, 949
TatI WGTACW 3 cut(s) 23, 725, 752
TfiI GAWTC 4 cut(s) 230, 338, 500, 922
Tru1I TTAA 6 cut(s) 102, 177, 185, 237, 927, 952
Tru9I TTAA 6 cut(s) 102, 177, 185, 237, 927, 952
TseFI GTSAC 3 cut(s) 89, 377, 446
TseI GCWGC 1 cut(s) 671
Tsp45I GTSAC 3 cut(s) 89, 377, 446
TspDTI ATGAA 1 cut(s) 570
Van91I CCANNNNNTGG 1 cut(s) 831
VpaK11BI GGWCC 1 cut(s) 541
XapI RAATTY 1 cut(s) 371
XceI RCATGY 1 cut(s) 424
XspI CTAG 3 cut(s) 303, 750, 768
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.