Rmu_ssc0000371.1_g000008

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000371.1
Physical Location & Seq
Reverse (-)
46227 .. 47024
798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000371.1_g000008.1.cds

Sequence Viewer

Length: 609 bp
atgcaggcactgccttctgggttctactgttctttccatatccgccctgtaactcgcagcttcagctctttcctaggacaatacaaccatgttggtagggaaaggcaagtgaacgaatcagatgtgaagaacctagtctatctccaagccattatcaaggaaaccttgcggctataccctgctacacctctctcagtaccacatgaatccagagaagaatgcagaataggtaactatcatgtcacctcaggcacgcatcttcttatcaacctttcgaagattcatcacaatccaaatgtctggctcgacccttgtctattccaaccagaaaggtttcttacaactcacaagaatgttgatgtcaggggccagagttttgaatttataccatttggaagtggtagacgaatatgtccaggaatatctctagcacttcaagttactcaacttacactggctcacttaattcatgggtttgaaattacagccccatctgatgaaccacttgatatgggtgagagttcaggaataacaaacatgaagataaccccactggaggtctttctcaccccatgcctacatcctaaactttatgaaaatgttgactag

Protein Analysis

202

Amino Acids

22.88

Weight (kDa)

6.59

Isoelectric Point (pI)

43.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000137)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G31940 AT4G31950 AT4G31970
fragaria_vesca FvH4_1g17460 FvH4_2g40550 FvH4_2g40551 FvH4_2g40560 FvH4_2g40570 FvH4_2g40580 FvH4_2g40590 FvH4_7g16520 FvH4_7g16601 FvH4_7g16602 FvH4_7g22620 FvH4_7g22810
malus_domestica MD00G1037400.v1.1 MD00G1037500.v1.1 MD00G1175000.v1.1 MD00G1175100.v1.1 MD00G1175200.v1.1 MD03G1091600.v1.1 MD04G1043800.v1.1 MD04G1043900.v1.1 MD04G1044100.v1.1 MD04G1044200.v1.1 MD04G1044300.v1.1 MD04G1044400.v1.1 MD08G1234700.v1.1 MD14G1047100.v1.1 MD14G1163500.v1.1 MD15G1028200.v1.1 MD15G1028300.v1.1 MD15G1028400.v1.1 MD15G1028500.v1.1 MD15G1028700.v1.1 MD15G1032900.v1.1 MD15G1033100.v1.1 MD15G1033400.v1.1 MD15G1033800.v1.1 MD15G1033900.v1.1 MD15G1378500.v1.1 MD15G1378800.v1.1
prunus_persica Prupe.1G386800_v2.0.a1 Prupe.1G386800_v2.0.a1 Prupe.1G386900_v2.0.a1 Prupe.1G387000_v2.0.a1 Prupe.1G387100_v2.0.a1 Prupe.1G387200_v2.0.a1 Prupe.1G387300_v2.0.a1 Prupe.1G387400_v2.0.a1 Prupe.1G387500_v2.0.a1 Prupe.1G387700_v2.0.a1 Prupe.1G537400_v2.0.a1 Prupe.1G537600_v2.0.a1 Prupe.1G537700_v2.0.a1 Prupe.1G538000_v2.0.a1 Prupe.1G538200_v2.0.a1 Prupe.3G064700_v2.0.a1 Prupe.3G066200_v2.0.a1 Prupe.6G212300_v2.0.a1
pyrus_communis pycom04g03800 pycom04g03820 pycom09g19430 pycom11g16760 pycom14g13610 pycom15g02430 pycom15g02460 pycom15g02470 pycom15g02480 pycom15g02520 pycom15g03050 pycom15g03060 pycom15g03070 pycom15g03090 pycom15g03100 pycom15g03110 pycom15g03120 pycom15g33920
rosa_chinensis RchiOBHm_Chr1g0359661 RchiOBHm_Chr1g0359671 RchiOBHm_Chr1g0359711 RchiOBHm_Chr1g0359751 RchiOBHm_Chr1g0359791 RchiOBHm_Chr2g0107671 RchiOBHm_Chr2g0107681 RchiOBHm_Chr2g0107691 RchiOBHm_Chr5g0058861 RchiOBHm_Chr5g0058871 RchiOBHm_Chr5g0058891 RchiOBHm_Chr5g0058901 RchiOBHm_Chr5g0058921 RchiOBHm_Chr5g0058931 RchiOBHm_Chr5g0058941 RchiOBHm_Chr5g0058971 RchiOBHm_Chr5g0058991 RchiOBHm_Chr5g0059001 RchiOBHm_Chr5g0060081 RchiOBHm_Chr6g0300111 RchiOBHm_Chr6g0300121 RchiOBHm_Chr6g0300131 RchiOBHm_Chr6g0300141 RchiOBHm_Chr6g0300151 RchiOBHm_Chr6g0300161 RchiOBHm_Chr7g0223401 RchiOBHm_Chr7g0223411 RchiOBHm_Chr7g0233631
rosa_laevigata RLG00000001247 RLG00000011362 RLG00000011363 RLG00000011364 RLG00000011365 RLG00000011367 RLG00000017599 RLG00000017600 RLG00000027854 RLG00000027856 RLG00000027857 RLG00000035257 RLG00000035258 RLG00000035263 RLG00000035267 RLG00000035268 RLG00000035270 RLG00000035272 RLG00000035273 RLG00000035275 RLG00000035276 RLG00000035343
rosa_multiflora Rmu_co8382255.1_g000001 Rmu_sc0000441.1_g000120 Rmu_sc0000441.1_g000122 Rmu_sc0000493.1_g000037 Rmu_sc0000493.1_g000038 Rmu_sc0001670.1_g000042 Rmu_sc0001670.1_g000043 Rmu_sc0001670.1_g000044 Rmu_sc0002983.1_g000067 Rmu_sc0002983.1_g000074 Rmu_sc0003366.1_g000019 Rmu_sc0003494.1_g000002 Rmu_sc0003712.1_g000014 Rmu_sc0005703.1_g000003 Rmu_sc0005703.1_g000004 Rmu_sc0006429.1_g000014 Rmu_sc0006429.1_g000018 Rmu_sc0006429.1_g000019 Rmu_sc0008701.1_g000007 Rmu_sc0009050.1_g000002 Rmu_sc0009050.1_g000008 Rmu_sc0014587.1_g000001 Rmu_sc0034954.1_g000001 Rmu_ssc0000371.1_g000008 Rmu_ssc0000371.1_g000009 Rmu_ssc0000371.1_g000012 Rmu_ssc0000371.1_g000025 Rmu_ssc0000371.1_g000028
rosa_roxburghii Rroxscaffold_1G00021390 Rroxscaffold_1G00021450 Rroxscaffold_1G00021460 Rroxscaffold_1G00021470 Rroxscaffold_1G00021480 Rroxscaffold_1G00021500 Rroxscaffold_2G00136030 Rroxscaffold_2G00136040 Rroxscaffold_2G00136070 Rroxscaffold_3G00227100 Rroxscaffold_4G00296830 Rroxscaffold_4G00296860 Rroxscaffold_4G00296870 Rroxscaffold_7G00168050 Rroxscaffold_7G00168060 Rroxscaffold_7G00168080 Rroxscaffold_7G00168090
rosa_rugosa Rorug01G0272400 Rorug01G0272500 Rorug01G0272600 Rorug01G0272700 Rorug02G0146800.1 Rorug03G0204200 Rorug03G0204300 Rorug05G0319800 Rorug05G0319900 Rorug06G0293800 Rorug06G0293800 Rorug06G0293800 Rorug06G0293800 Rorug07G0281800
rosa_samantha Rh5DG412300 Rh5DG412400 Rh6CG421000 Rh7DG427300
rosa_wichuraiana Rw1G025420 Rw1G025430 Rw1G025440 Rw2G015520 Rw5G036240 Rw5G036250 Rw5G036260 Rw5G036270 Rw5G036950 Rw6G035500 Rw6G035510 Rw6G035520 Rw7G036140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 411
AccI GTMKAC 1 cut(s) 403
AciI CCGC 2 cut(s) 43, 169
AcsI RAATTY 1 cut(s) 380
AcuI CTGAAG 1 cut(s) 46
AfaI GTAC 1 cut(s) 198
AfiI CCNNNNNNNGG 1 cut(s) 556
AgsI TTSAA 3 cut(s) 380, 437, 479
AjnI CCWGG 1 cut(s) 415
AluBI AGCT 2 cut(s) 60, 66
AluI AGCT 2 cut(s) 60, 66
AlwNI CAGNNNCTG 1 cut(s) 10
AoxI GGCC 1 cut(s) 367
ApeKI GCWGC 1 cut(s) 57
ApoI RAATTY 1 cut(s) 380
Asp700I GAANNNNTTC 1 cut(s) 333
AspA2I CCTAGG 1 cut(s) 73
AspS9I GGNCC 1 cut(s) 367
AsuHPI GGTGA 3 cut(s) 235, 527, 559
AsuII TTCGAA 1 cut(s) 275
AvrII CCTAGG 1 cut(s) 73
AxyI CCTNAGG 1 cut(s) 247
BbvI GCAGC 1 cut(s) 69
BccI CCATC 1 cut(s) 499
BciT130I CCWGG 1 cut(s) 417
BfaI CTAG 4 cut(s) 74, 134, 428, 607
BisI GCNGC 2 cut(s) 58, 170
BlnI CCTAGG 1 cut(s) 73
BlsI GCNGC 2 cut(s) 59, 171
Bme1390I CCNGG 1 cut(s) 417
BmgT120I GGNCC 1 cut(s) 367
BmiI GGNNCC 1 cut(s) 368
BmrFI CCNGG 1 cut(s) 417
BmsI GCATC 1 cut(s) 265
BoxI GACNNNNGTC 1 cut(s) 312
BpmI CTGGAG 1 cut(s) 575
Bpu14I TTCGAA 1 cut(s) 275
BsaJI CCNNGG 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 556
Bse1I ACTGG 2 cut(s) 459, 558
Bse21I CCTNAGG 1 cut(s) 247
BseBI CCWGG 1 cut(s) 417
BseDI CCNNGG 1 cut(s) 73
BseGI GGATG 1 cut(s) 580
BseLI CCNNNNNNNGG 1 cut(s) 556
BseMII CTCAG 2 cut(s) 207, 261
BseNI ACTGG 2 cut(s) 459, 558
BseXI GCAGC 1 cut(s) 69
BshFI GGCC 1 cut(s) 369
BslI CCNNNNNNNGG 1 cut(s) 556
BsmI GAATGC 1 cut(s) 224
BsnI GGCC 1 cut(s) 369
Bsp119I TTCGAA 1 cut(s) 275
BspACI CCGC 2 cut(s) 43, 169
BspANI GGCC 1 cut(s) 369
BspCNI CTCAG 2 cut(s) 206, 260
BspLI GGNNCC 1 cut(s) 368
BspT104I TTCGAA 1 cut(s) 275
BsrI ACTGG 2 cut(s) 459, 558
BssECI CCNNGG 1 cut(s) 73
BssT1I CCWWGG 1 cut(s) 73
Bst2UI CCWGG 1 cut(s) 417
Bst4CI ACNGT 1 cut(s) 29
BstAPI GCANNNNNTGC 1 cut(s) 10
BstBI TTCGAA 1 cut(s) 275
BstC8I GCNNGC 2 cut(s) 6, 254
BstDEI CTNAG 2 cut(s) 193, 247
BstF5I GGATG 1 cut(s) 580
BstMWI GCNNNNNNNGC 2 cut(s) 10, 63
BstNI CCWGG 1 cut(s) 417
BstPAI GACNNNNGTC 1 cut(s) 312
BstSCI CCNGG 1 cut(s) 415
BstV1I GCAGC 1 cut(s) 69
BstXI CCANNNNNNTGG 1 cut(s) 300
Bsu36I CCTNAGG 1 cut(s) 247
BsuRI GGCC 1 cut(s) 369
BtsCI GGATG 1 cut(s) 580
BtsI GCAGTG 1 cut(s) 8
BtsIMutI CAGTG 3 cut(s) 8, 452, 551
Cac8I GCNNGC 2 cut(s) 6, 254
CaiI CAGNNNCTG 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 367
Csp6I GTAC 1 cut(s) 197
CviAII CATG 6 cut(s) 89, 203, 239, 470, 538, 573
CviJI RGCY 8 cut(s) 60, 66, 149, 172, 304, 369, 458, 488
CviKI_1 RGCY 8 cut(s) 60, 66, 149, 172, 304, 369, 458, 488
CviQI GTAC 1 cut(s) 197
DdeI CTNAG 2 cut(s) 193, 247
DrdI GACNNNNNNGTC 1 cut(s) 411
DseDI GACNNNNNNGTC 1 cut(s) 411
EciI GGCGGA 1 cut(s) 32
Eco130I CCWWGG 1 cut(s) 73
Eco57I CTGAAG 1 cut(s) 46
Eco81I CCTNAGG 1 cut(s) 247
EcoRII CCWGG 1 cut(s) 415
EcoT14I CCWWGG 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 73
FaeI CATG 6 cut(s) 92, 206, 242, 473, 541, 576
FalI AAGNNNNNCTT 2 cut(s) 149, 181
FatI CATG 6 cut(s) 88, 202, 238, 469, 537, 572
FblI GTMKAC 1 cut(s) 403
Fnu4HI GCNGC 2 cut(s) 58, 170
FokI GGATG 1 cut(s) 567
Fsp4HI GCNGC 2 cut(s) 58, 170
FspBI CTAG 4 cut(s) 74, 134, 428, 607
GluI GCNGC 2 cut(s) 58, 170
GsuI CTGGAG 1 cut(s) 575
HaeIII GGCC 1 cut(s) 369
Hin1II CATG 6 cut(s) 92, 206, 242, 473, 541, 576
HincII GTYRAC 1 cut(s) 604
HindII GTYRAC 1 cut(s) 604
HinfI GANTC 3 cut(s) 116, 206, 280
HphI GGTGA 3 cut(s) 235, 527, 559
Hpy166II GTNNAC 3 cut(s) 112, 404, 604
Hpy188I TCNGA 2 cut(s) 121, 496
Hpy188III TCNNGA 2 cut(s) 210, 525
Hpy8I GTNNAC 3 cut(s) 112, 404, 604
HpyAV CCTTC 1 cut(s) 24
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4V TGCA 2 cut(s) 4, 222
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 63
HpyF3I CTNAG 2 cut(s) 193, 247
Hsp92II CATG 6 cut(s) 92, 206, 242, 473, 541, 576
Lsp1109I GCAGC 1 cut(s) 69
LweI GCATC 1 cut(s) 265
MaeI CTAG 4 cut(s) 74, 134, 428, 607
MaeIII GTNAC 4 cut(s) 49, 230, 241, 439
MboII GAAGA 5 cut(s) 139, 227, 251, 289, 553
MluCI AATT 3 cut(s) 380, 465, 480
MmeI TCCRAC 1 cut(s) 346
MnlI CCTC 3 cut(s) 198, 256, 550
MroXI GAANNNNTTC 1 cut(s) 333
MseI TTAA 1 cut(s) 464
MslI CAYNNNNRTG 1 cut(s) 351
MspR9I CCNGG 1 cut(s) 417
Mva1269I GAATGC 1 cut(s) 224
MvaI CCWGG 1 cut(s) 417
MwoI GCNNNNNNNGC 2 cut(s) 10, 63
NlaIII CATG 6 cut(s) 92, 206, 242, 473, 541, 576
NlaIV GGNNCC 1 cut(s) 368
NmuCI GTSAC 1 cut(s) 241
NspV TTCGAA 1 cut(s) 275
PctI GAATGC 1 cut(s) 224
PdmI GAANNNNTTC 1 cut(s) 333
PfeI GAWTC 3 cut(s) 116, 206, 280
PfoI TCCNGGA 1 cut(s) 415
PkrI GCNGC 2 cut(s) 59, 171
PshAI GACNNNNGTC 1 cut(s) 312
Psp6I CCWGG 1 cut(s) 415
PspGI CCWGG 1 cut(s) 415
PspN4I GGNNCC 1 cut(s) 368
PspPI GGNCC 1 cut(s) 367
PstNI CAGNNNCTG 1 cut(s) 10
RsaI GTAC 1 cut(s) 198
RsaNI GTAC 1 cut(s) 197
RseI CAYNNNNRTG 1 cut(s) 351
SaqAI TTAA 1 cut(s) 464
SatI GCNGC 2 cut(s) 58, 170
Sau96I GGNCC 1 cut(s) 367
ScrFI CCNGG 1 cut(s) 417
SfaNI GCATC 1 cut(s) 265
SfuI TTCGAA 1 cut(s) 275
SmiMI CAYNNNNRTG 1 cut(s) 351
Sse9I AATT 3 cut(s) 380, 465, 480
SsiI CCGC 2 cut(s) 43, 169
SspMI CTAG 4 cut(s) 74, 134, 428, 607
StyD4I CCNGG 1 cut(s) 415
StyI CCWWGG 1 cut(s) 73
TaaI ACNGT 1 cut(s) 29
TaqI TCGA 2 cut(s) 275, 306
TasI AATT 3 cut(s) 380, 465, 480
TauI GCSGC 1 cut(s) 172
TfiI GAWTC 3 cut(s) 116, 206, 280
Tru1I TTAA 1 cut(s) 464
Tru9I TTAA 1 cut(s) 464
TscAI CASTG 3 cut(s) 15, 459, 558
TseFI GTSAC 1 cut(s) 241
TseI GCWGC 1 cut(s) 57
Tsp45I GTSAC 1 cut(s) 241
TspDTI ATGAA 6 cut(s) 219, 272, 458, 513, 554, 609
TspRI CASTG 3 cut(s) 15, 459, 558
XapI RAATTY 1 cut(s) 380
XmaJI CCTAGG 1 cut(s) 73
XmiI GTMKAC 1 cut(s) 403
XmnI GAANNNNTTC 1 cut(s) 333
XspI CTAG 4 cut(s) 74, 134, 428, 607
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.