Rmu_co8277595.1_g000001

Agglutinin domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8277595.1
OG0000217
Physical Location & Seq
Forward (+)
380 .. 828
449 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8277595.1_g000001.1.cds

Sequence Viewer

Length: 372 bp
atgtcggttctattacctcccaccattgcgatcaaaacaggctggggtactgccaacgtctacatgaactacaacgatgattctaattctcagactaggggcttcctcaaattcaatggagggaatgttttcagcccgctagcgaagttcgaagtggtggccgcaaatactggaataggaatggtacatataagatgctctcacaataagaagttcttgcgagtgagggcccagggcggtgggtacatttctccagacgctgatgaaccagaagaagaccaatcaaaatggtcatgtacgttattccagcccagacctgtagatggcaatccagaccgcgttcgcccagcaggatatcctggaaatcattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Aerolysin Agglutinin ETX_MTX2 Fascin

Protein Analysis

123

Amino Acids

13.5

Weight (kDa)

8.64

Isoelectric Point (pI)

52.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000217)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g17710 FvH4_6g45590 FvH4_6g45591 FvH4_6g45770 FvH4_6g45770 FvH4_6g46030 FvH4_6g46040 FvH4_7g07020 FvH4_7g07071 FvH4_7g07080
malus_domestica MD01G1104300.v1.1 MD02G1240000.v1.1 MD02G1240200.v1.1 MD03G1201400.v1.1 MD03G1201500.v1.1 MD07G1171100.v1.1
prunus_persica Prupe.2G087400_v2.0.a1 Prupe.2G097500_v2.0.a1 Prupe.2G097700_v2.0.a1 Prupe.2G097800_v2.0.a1 Prupe.3G153100_v2.0.a1 Prupe.3G153300_v2.0.a1 Prupe.3G153600_v2.0.a1 Prupe.5G237200_v2.0.a1
pyrus_communis pycom03g15270 pycom06g20700 pycom07g06030 pycom10g01810 pycom10g01820 pycom10g12090 pycom14g20090 pycom14g20100 pycom14g20110 pycom14g20120
rosa_chinensis RchiOBHm_Chr1g0336971 RchiOBHm_Chr1g0337031 RchiOBHm_Chr2g0163571 RchiOBHm_Chr2g0163591 RchiOBHm_Chr2g0163631 RchiOBHm_Chr2g0163661 RchiOBHm_Chr2g0163671 RchiOBHm_Chr2g0163691 RchiOBHm_Chr2g0163741 RchiOBHm_Chr5g0011821 RchiOBHm_Chr5g0011831 RchiOBHm_Chr5g0011841 RchiOBHm_Chr5g0053101 RchiOBHm_Chr5g0072501
rosa_laevigata RLG00000010009 RLG00000021413 RLG00000029310 RLG00000029318 RLG00000036313
rosa_multiflora Rmu_co7975848.1_g000001 Rmu_co8020886.1_g000001 Rmu_co8136580.1_g000001 Rmu_co8177372.1_g000001 Rmu_co8207014.1_g000001 Rmu_co8232187.1_g000001 Rmu_co8277595.1_g000001 Rmu_co8389219.1_g000001 Rmu_co8427877.1_g000001 Rmu_co8467587.1_g000001 Rmu_sc0001475.1_g000015 Rmu_sc0001475.1_g000016 Rmu_sc0001475.1_g000017 Rmu_sc0003462.1_g000002 Rmu_sc0003462.1_g000003 Rmu_sc0003484.1_g000002 Rmu_sc0004918.1_g000004 Rmu_sc0004918.1_g000006 Rmu_sc0004918.1_g000007 Rmu_sc0004918.1_g000009 Rmu_sc0006596.1_g000003 Rmu_sc0006596.1_g000005 Rmu_sc0006596.1_g000010 Rmu_sc0008676.1_g000021 Rmu_sc0014330.1_g000002 Rmu_sc0016133.1_g000002 Rmu_sc0016133.1_g000003 Rmu_sc0016133.1_g000004 Rmu_sc0026453.1_g000003 Rmu_sc0026453.1_g000004 Rmu_sc0030660.1_g000001
rosa_roxburghii Rroxscaffold_1G00008700 Rroxscaffold_1G00064740 Rroxscaffold_2G00086950 Rroxscaffold_2G00087100 Rroxscaffold_2G00087140 Rroxscaffold_4G00302080 Rroxscaffold_4G00315020 Rroxscaffold_4G00315170 Rroxscaffold_5G00358800
rosa_rugosa Rorug01G0129200 Rorug01G0130600 Rorug01G0130700 Rorug02G0503700 Rorug02G0503800 Rorug02G0503900 Rorug02G0504000 Rorug02G0504300 Rorug05G0268200 Rorug05G0418700 Rorug05G0418800
rosa_samantha Rh1AG151100 Rh1AG151300 Rh1BG118400 Rh1BG120600 Rh1CG141500 Rh1CG142500 Rh1DG157300 Rh1DG158500 Rh2AG570600 Rh2AG570800 Rh2AG571200 Rh2AG571300 Rh2AG571500 Rh2AG571900 Rh2AG572000 Rh2AG572200 Rh2CG552600 Rh2CG552800 Rh2CG553000 Rh2CG553300 Rh2CG553400 Rh2CG553700 Rh5CG100400 Rh5CG100500 Rh5CG100600 Rh5CG100700 Rh5CG519100 Rh5DG086600 Rh5DG086700 Rh5DG086800 Rh5DG086900 Rh5DG087000 Rh5DG087100 Rh5DG367600 Rh5DG507300
rosa_wichuraiana Rw1G012130 Rw1G012240 Rw1G012380 Rw2G047240 Rw2G047260 Rw2G047270 Rw2G047290 Rw5G007940 Rw5G044120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 60
AccII CGCG 1 cut(s) 339
AciI CCGC 4 cut(s) 137, 162, 237, 337
AcoI YGGCCR 1 cut(s) 159
AcsI RAATTY 1 cut(s) 110
AfaI GTAC 4 cut(s) 49, 186, 245, 298
AfiI CCNNNNNNNGG 1 cut(s) 323
AgsI TTSAA 1 cut(s) 115
AjnI CCWGG 2 cut(s) 231, 358
AlwNI CAGNNNCTG 1 cut(s) 260
AoxI GGCC 2 cut(s) 159, 228
ApaI GGGCCC 1 cut(s) 232
ApoI RAATTY 1 cut(s) 110
Asp700I GAANNNNTTC 1 cut(s) 128
AspS9I GGNCC 2 cut(s) 228, 229
AsuII TTCGAA 1 cut(s) 150
AsuNHI GCTAGC 1 cut(s) 139
BaeGI GKGCMC 1 cut(s) 232
BanII GRGCYC 1 cut(s) 232
BbsI GAAGAC 1 cut(s) 282
BccI CCATC 1 cut(s) 317
BciT130I CCWGG 2 cut(s) 233, 360
BfaI CTAG 2 cut(s) 96, 140
BfmI CTRYAG 1 cut(s) 318
BisI GCNGC 1 cut(s) 162
BlsI GCNGC 1 cut(s) 163
Bme1390I CCNGG 2 cut(s) 233, 360
BmgT120I GGNCC 2 cut(s) 228, 229
BmiI GGNNCC 1 cut(s) 230
BmrFI CCNGG 2 cut(s) 233, 360
BmsI GCATC 1 cut(s) 185
BmtI GCTAGC 1 cut(s) 143
BpiI GAAGAC 1 cut(s) 282
BpmI CTGGAG 1 cut(s) 237
Bpu14I TTCGAA 1 cut(s) 150
BsaBI GATNNNNATC 1 cut(s) 327
BsaJI CCNNGG 2 cut(s) 231, 232
BsaXI ACNNNNNCTCC 2 cut(s) 111, 141
Bsc4I CCNNNNNNNGG 1 cut(s) 323
Bse1I ACTGG 1 cut(s) 175
Bse3DI GCAATG 1 cut(s) 24
Bse8I GATNNNNATC 1 cut(s) 327
BseBI CCWGG 2 cut(s) 233, 360
BseDI CCNNGG 2 cut(s) 231, 232
BseJI GATNNNNATC 1 cut(s) 327
BseLI CCNNNNNNNGG 1 cut(s) 323
BseMI GCAATG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 104
BseNI ACTGG 1 cut(s) 175
BseSI GKGCMC 1 cut(s) 232
BseYI CCCAGC 2 cut(s) 42, 346
Bsh1236I CGCG 1 cut(s) 339
BshFI GGCC 2 cut(s) 161, 230
BslI CCNNNNNNNGG 1 cut(s) 323
BsnI GGCC 2 cut(s) 161, 230
Bsp119I TTCGAA 1 cut(s) 150
Bsp120I GGGCCC 1 cut(s) 228
Bsp1286I GDGCHC 1 cut(s) 232
Bsp143I GATC 1 cut(s) 30
BspACI CCGC 4 cut(s) 137, 162, 237, 337
BspANI GGCC 2 cut(s) 161, 230
BspCNI CTCAG 1 cut(s) 103
BspFNI CGCG 1 cut(s) 339
BspLI GGNNCC 1 cut(s) 230
BspOI GCTAGC 1 cut(s) 143
BspT104I TTCGAA 1 cut(s) 150
BsrDI GCAATG 1 cut(s) 24
BsrI ACTGG 1 cut(s) 175
BssECI CCNNGG 2 cut(s) 231, 232
BssMI GATC 1 cut(s) 30
Bst2UI CCWGG 2 cut(s) 233, 360
BstBI TTCGAA 1 cut(s) 150
BstC8I GCNNGC 2 cut(s) 137, 141
BstDEI CTNAG 1 cut(s) 90
BstFNI CGCG 1 cut(s) 339
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstNI CCWGG 2 cut(s) 233, 360
BstSCI CCNGG 2 cut(s) 231, 358
BstSFI CTRYAG 1 cut(s) 318
BstSLI GKGCMC 1 cut(s) 232
BstUI CGCG 1 cut(s) 339
BstV2I GAAGAC 1 cut(s) 282
BstXI CCANNNNNNTGG 1 cut(s) 239
BsuRI GGCC 2 cut(s) 161, 230
Cac8I GCNNGC 2 cut(s) 137, 141
CaiI CAGNNNCTG 1 cut(s) 260
Cfr13I GGNCC 2 cut(s) 228, 229
CseI GACGC 1 cut(s) 266
Csp6I GTAC 4 cut(s) 48, 185, 244, 297
CviAII CATG 2 cut(s) 64, 294
CviJI RGCY 6 cut(s) 42, 102, 135, 161, 230, 310
CviKI_1 RGCY 6 cut(s) 42, 102, 135, 161, 230, 310
CviQI GTAC 4 cut(s) 48, 185, 244, 297
DdeI CTNAG 1 cut(s) 90
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
EaeI YGGCCR 1 cut(s) 159
Eco24I GRGCYC 1 cut(s) 232
Eco32I GATATC 1 cut(s) 356
EcoO109I RGGNCCY 1 cut(s) 228
EcoRII CCWGG 2 cut(s) 231, 358
EcoRV GATATC 1 cut(s) 356
EcoT38I GRGCYC 1 cut(s) 232
FaeI CATG 2 cut(s) 67, 297
FaiI YATR 4 cut(s) 65, 189, 191, 295
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FatI CATG 2 cut(s) 63, 293
FauI CCCGC 1 cut(s) 144
FblI GTMKAC 1 cut(s) 60
Fnu4HI GCNGC 1 cut(s) 162
FriOI GRGCYC 1 cut(s) 232
Fsp4HI GCNGC 1 cut(s) 162
FspBI CTAG 2 cut(s) 96, 140
GluI GCNGC 1 cut(s) 162
GsaI CCCAGC 2 cut(s) 46, 350
GsuI CTGGAG 1 cut(s) 237
HaeIII GGCC 2 cut(s) 161, 230
HgaI GACGC 1 cut(s) 266
Hin1II CATG 2 cut(s) 67, 297
HinfI GANTC 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 2 cut(s) 254, 332
Hpy8I GTNNAC 1 cut(s) 61
HpyCH4IV ACGT 2 cut(s) 57, 299
HpyF3I CTNAG 1 cut(s) 90
HpySE526I ACGT 2 cut(s) 57, 299
Hsp92II CATG 2 cut(s) 67, 297
Kzo9I GATC 1 cut(s) 30
LweI GCATC 1 cut(s) 185
MaeI CTAG 2 cut(s) 96, 140
MaeII ACGT 2 cut(s) 57, 299
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MboII GAAGA 2 cut(s) 284, 287
MhlI GDGCHC 1 cut(s) 232
MluCI AATT 2 cut(s) 85, 110
MnlI CCTC 4 cut(s) 27, 113, 116, 219
MroXI GAANNNNTTC 1 cut(s) 128
MspR9I CCNGG 2 cut(s) 233, 360
MvaI CCWGG 2 cut(s) 233, 360
MvnI CGCG 1 cut(s) 339
NdeII GATC 1 cut(s) 30
NheI GCTAGC 1 cut(s) 139
NlaIII CATG 2 cut(s) 67, 297
NlaIV GGNNCC 1 cut(s) 230
NspV TTCGAA 1 cut(s) 150
PasI CCCWGGG 1 cut(s) 232
PdmI GAANNNNTTC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 80
PfoI TCCNGGA 1 cut(s) 358
PkrI GCNGC 1 cut(s) 163
Psp6I CCWGG 2 cut(s) 231, 358
PspFI CCCAGC 2 cut(s) 42, 346
PspGI CCWGG 2 cut(s) 231, 358
PspN4I GGNNCC 1 cut(s) 230
PspOMI GGGCCC 1 cut(s) 228
PspPI GGNCC 2 cut(s) 228, 229
PstNI CAGNNNCTG 1 cut(s) 260
RsaI GTAC 4 cut(s) 49, 186, 245, 298
RsaNI GTAC 4 cut(s) 48, 185, 244, 297
SatI GCNGC 1 cut(s) 162
Sau3AI GATC 1 cut(s) 30
Sau96I GGNCC 2 cut(s) 228, 229
ScrFI CCNGG 2 cut(s) 233, 360
SduI GDGCHC 1 cut(s) 232
SetI ASST 4 cut(s) 19, 60, 302, 319
SfaNI GCATC 1 cut(s) 185
SfcI CTRYAG 1 cut(s) 318
SfuI TTCGAA 1 cut(s) 150
Sse9I AATT 2 cut(s) 85, 110
SsiI CCGC 4 cut(s) 137, 162, 237, 337
SspMI CTAG 2 cut(s) 96, 140
StyD4I CCNGG 2 cut(s) 231, 358
TaiI ACGT 2 cut(s) 60, 302
TaqI TCGA 1 cut(s) 150
TasI AATT 2 cut(s) 85, 110
TauI GCSGC 1 cut(s) 164
TfiI GAWTC 1 cut(s) 80
TspDTI ATGAA 2 cut(s) 80, 279
XapI RAATTY 1 cut(s) 110
XmiI GTMKAC 1 cut(s) 60
XmnI GAANNNNTTC 1 cut(s) 128
XspI CTAG 2 cut(s) 96, 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.