AT5G35830

protein ubiquitination

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0000157
Physical Location & Seq
Reverse (-)
14000313 .. 14001416
1104 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G35830.1

Sequence Viewer

Length: 849 bp
ATGTCGATTGCACCACCGACCATTGATCGGCTTCCACGAGATCCGCTGTGTAAACTGTTCATTGTGTTGCCCAAAGAGAAACATATTGAAGAAAGTCACGTTTCAACGAAGATGAACAATCTGAACAAATCCAAAGAGCCTCCCAAGGGAGATATAATAGTGGAAGTTGGAGAGACATGTAGGTCATGTCCTAATAAACATCACAGTCCACTACACAATGTTCAAAGAAACTTTTCATGTGATGATAAATTACGAGCCAAAGGTGTCCAACTCTATCAAGCTGCTCTGAAAGGAGATTGGAAGGCAGCCAATGGTATAATCATTGAACAAAAATATATTATCTATCAAAAAATCACCAGTAAATCGGAGACTGTTCTTCACATCGCTGTTGCTGCAAAGCACGAGGGGTTTGTAAGAAATCTACTTGGAAGCTTGGAGTCAAATGACTTGGCCTTGCGAAACGTGGACGGCAACACAGCCTTATGTTTTGCTGCTGCATCGGGAGTCGTTGAGATTGCTAAAATGCTGATCGAGAAGAATAAAGATCTTCCGATGATTCGTGGAGGTGGAAAAACGACTCCAATCCACATGGCAGCCTTATTCGGTCATGGAGAAATGGTTAAATACCTTTACAAGAATACACGCTTTAGAGAATTCAATGATGAAGAGTTTGTAAATCTCTTTCATGCTGTGATATCAGCTGATATCTATGTGAGGTCTATTCACAGATGTAGCTCTGGAGATGTTAGAGAACGAGGGAAGGAAAAAAGTACTAGCCCTTTGGACAAATATAAACAAAGAGACAGCCTTGCACTTGATGGCTCGCAAGCCTTCTGCAGTTGGCCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 DUF4219

Protein Analysis

282

Amino Acids

31.58

Weight (kDa)

9.05

Isoelectric Point (pI)

43.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ank_2 PF12796 92 - 182 8.9e-09 Ankyrin repeats (3 copies)
Ank_2 PF12796 126 - 213 1.4e-13 Ankyrin repeats (3 copies)
Ank_4 PF13637 161 - 210 1.6e-08 Ankyrin repeats (many copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000157)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G54070 AT5G35830
fragaria_vesca FvH4_3g25070 FvH4_3g25080 FvH4_3g25081 FvH4_3g25081
malus_domestica MD03G1027500.v1.1 MD03G1146300.v1.1 MD03G1146800.v1.1 MD03G1146900.v1.1 MD03G1147100.v1.1 MD11G1165600.v1.1
prunus_persica Prupe.2G015800_v2.0.a1 Prupe.2G015900_v2.0.a1 Prupe.2G015900_v2.0.a1 Prupe.2G016300_v2.0.a1 Prupe.2G016500_v2.0.a1 Prupe.6G131100_v2.0.a1 Prupe.6G131400_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131600_v2.0.a1 Prupe.6G131600_v2.0.a1 Prupe.6G131600_v2.0.a1 Prupe.6G131600_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1
pyrus_communis pycom03g10090 pycom03g10110 pycom11g13740 pycom11g13770
rosa_chinensis RchiOBHm_Chr1g0316371 RchiOBHm_Chr1g0316381 RchiOBHm_Chr1g0316401 RchiOBHm_Chr1g0316411 RchiOBHm_Chr1g0316571 RchiOBHm_Chr1g0316601 RchiOBHm_Chr5g0039341 RchiOBHm_Chr5g0041371 RchiOBHm_Chr5g0041401 RchiOBHm_Chr5g0041431 RchiOBHm_Chr5g0041471 RchiOBHm_Chr5g0045281 RchiOBHm_Chr5g0045291 RchiOBHm_Chr5g0045311 RchiOBHm_Chr5g0045371 RchiOBHm_Chr5g0045421 RchiOBHm_Chr5g0045431 RchiOBHm_Chr5g0045501 RchiOBHm_Chr5g0045551 RchiOBHm_Chr5g0045771 RchiOBHm_Chr5g0045811
rosa_laevigata RLG00000034057 RLG00000034058
rosa_multiflora Rmu_co8352751.1_g000001 Rmu_co8397575.1_g000001 Rmu_sc0000415.1_g000006 Rmu_sc0000493.1_g000057 Rmu_sc0000504.1_g000003 Rmu_sc0000594.1_g000019 Rmu_sc0000594.1_g000032 Rmu_sc0000594.1_g000066 Rmu_sc0001047.1_g000003 Rmu_sc0001047.1_g000011 Rmu_sc0001556.1_g000023 Rmu_sc0002584.1_g000003 Rmu_sc0002584.1_g000039 Rmu_sc0002584.1_g000070 Rmu_sc0002667.1_g000015 Rmu_sc0003677.1_g000003 Rmu_sc0003743.1_g000017 Rmu_sc0004520.1_g000004 Rmu_sc0004520.1_g000013 Rmu_sc0004520.1_g000027 Rmu_sc0005539.1_g000014 Rmu_sc0005539.1_g000032 Rmu_sc0006018.1_g000006 Rmu_sc0006737.1_g000020 Rmu_sc0007485.1_g000002 Rmu_sc0008729.1_g000002 Rmu_sc0008729.1_g000003 Rmu_sc0038822.1_g000001 Rmu_ssc0000398.1_g000025
rosa_roxburghii Rroxscaffold_1G00035090 Rroxscaffold_1G00035630 Rroxscaffold_1G00035640 Rroxscaffold_1G00035660 Rroxscaffold_1G00035680 Rroxscaffold_1G00035730 Rroxscaffold_1G00035750 Rroxscaffold_1G00035770 Rroxscaffold_1G00039150 Rroxscaffold_1G00039190 Rroxscaffold_1G00039220 Rroxscaffold_1G00039260 Rroxscaffold_4G00328910 Rroxscaffold_4G00328950 Rroxscaffold_4G00328960 Rroxscaffold_4G00330890
rosa_rugosa Rorug01G0009800 Rorug01G0010000.1 Rorug01G0010200 Rorug01G0012100 Rorug01G0023500 Rorug01G0023600 Rorug01G0023700 Rorug01G0024700 Rorug05G0192000 Rorug05G0192200 Rorug05G0222400 Rorug05G0222500 Rorug05G0222600.1 Rorug05G0222700.1 Rorug05G0222800.1 Rorug05G0222900.1 Rorug05G0223000.1 Rorug05G0223100.1 Rorug05G0223200 Rorug05G0223600 Rorug05G0226800 Rorug05G0226900
rosa_samantha Rh1CG019600 Rh1DG015000 Rh1DG015300 Rh1DG016900 Rh5CG315200 Rh5CG338700 Rh5DG277100 Rh5DG291500 Rh5DG292100 Rh5DG292200 Rh5DG292400 Rh5DG292600 Rh5DG322100 Rh5DG322200 Rh5DG323100 Rh5DG323300 Rh5DG326700 Rh5DG326900 Rh5DG327000
rosa_wichuraiana Rw0G021580 Rw1G001320 Rw1G001420 Rw1G002820 Rw1G002840 Rw1G002870 Rw5G024800 Rw5G026160 Rw5G026170 Rw5G026180 Rw5G026210 Rw5G026230 Rw5G028170 Rw5G028190 Rw5G028210 Rw5G028230 Rw5G028240 Rw5G028260 Rw5G028280 Rw5G028370 Rw5G028380 Rw5G028840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 181
AciI CCGC 1 cut(s) 44
AclWI GGATC 1 cut(s) 35
AcoI YGGCCR 1 cut(s) 842
AcsI RAATTY 1 cut(s) 653
AfaI GTAC 1 cut(s) 772
AfiI CCNNNNNNNGG 2 cut(s) 27, 146
AflIII ACRYGT 1 cut(s) 176
AgsI TTSAA 5 cut(s) 89, 105, 224, 326, 658
AluBI AGCT 4 cut(s) 281, 432, 701, 735
AluI AGCT 4 cut(s) 281, 432, 701, 735
Alw26I GTCTC 3 cut(s) 167, 362, 795
AlwI GGATC 1 cut(s) 35
AoxI GGCC 2 cut(s) 450, 842
ApeKI GCWGC 6 cut(s) 281, 305, 392, 491, 494, 593
ApoI RAATTY 1 cut(s) 653
Asp700I GAANNNNTTC 1 cut(s) 232
AsuHPI GGTGA 1 cut(s) 346
BauI CACGAG 2 cut(s) 36, 401
BbvI GCAGC 6 cut(s) 268, 317, 379, 478, 481, 605
BccI CCATC 1 cut(s) 812
BceAI ACGGC 2 cut(s) 484, 829
BcoDI GTCTC 3 cut(s) 167, 362, 795
BfaI CTAG 1 cut(s) 774
BfmI CTRYAG 1 cut(s) 835
BglII AGATCT 1 cut(s) 544
BisI GCNGC 6 cut(s) 282, 306, 393, 492, 495, 594
BlsI GCNGC 6 cut(s) 283, 307, 394, 493, 496, 595
BmcAI AGTACT 1 cut(s) 772
BmsI GCATC 1 cut(s) 506
BpmI CTGGAG 1 cut(s) 759
BsaJI CCNNGG 1 cut(s) 144
BsaXI ACNNNNNCTCC 2 cut(s) 603, 633
Bsc4I CCNNNNNNNGG 2 cut(s) 27, 146
Bse1I ACTGG 1 cut(s) 357
BseDI CCNNGG 1 cut(s) 144
BseLI CCNNNNNNNGG 2 cut(s) 27, 146
BseNI ACTGG 1 cut(s) 357
BseXI GCAGC 6 cut(s) 268, 317, 379, 478, 481, 605
BshFI GGCC 2 cut(s) 452, 844
BslI CCNNNNNNNGG 2 cut(s) 27, 146
BsmAI GTCTC 3 cut(s) 167, 362, 795
BsnI GGCC 2 cut(s) 452, 844
Bsp143I GATC 4 cut(s) 25, 40, 528, 544
BspACI CCGC 1 cut(s) 44
BspANI GGCC 2 cut(s) 452, 844
BspMAI CTGCAG 1 cut(s) 839
BspPI GGATC 1 cut(s) 35
BsrI ACTGG 1 cut(s) 357
BssECI CCNNGG 1 cut(s) 144
BssMI GATC 4 cut(s) 25, 40, 528, 544
BssSI CACGAG 2 cut(s) 36, 401
BssT1I CCWWGG 1 cut(s) 144
Bst2BI CACGAG 2 cut(s) 36, 401
Bst4CI ACNGT 3 cut(s) 57, 206, 373
Bst6I CTCTTC 1 cut(s) 660
BstC8I GCNNGC 2 cut(s) 824, 828
BstKTI GATC 4 cut(s) 28, 43, 531, 547
BstMAI GTCTC 3 cut(s) 167, 362, 795
BstMBI GATC 4 cut(s) 25, 40, 528, 544
BstMWI GCNNNNNNNGC 1 cut(s) 392
BstNSI RCATGY 1 cut(s) 180
BstSFI CTRYAG 1 cut(s) 835
BstV1I GCAGC 6 cut(s) 268, 317, 379, 478, 481, 605
BstX2I RGATCY 2 cut(s) 40, 544
BstYI RGATCY 2 cut(s) 40, 544
BsuRI GGCC 2 cut(s) 452, 844
BtgZI GCGATG 1 cut(s) 367
Cac8I GCNNGC 2 cut(s) 824, 828
Csp6I GTAC 1 cut(s) 771
CviAII CATG 6 cut(s) 177, 186, 237, 589, 608, 686
CviQI GTAC 1 cut(s) 771
DpnI GATC 4 cut(s) 27, 42, 530, 546
DpnII GATC 4 cut(s) 25, 40, 528, 544
DrdI GACNNNNNNGTC 1 cut(s) 181
DseDI GACNNNNNNGTC 1 cut(s) 181
EaeI YGGCCR 1 cut(s) 842
Eam1104I CTCTTC 1 cut(s) 660
EarI CTCTTC 1 cut(s) 660
Eco130I CCWWGG 1 cut(s) 144
Eco32I GATATC 2 cut(s) 696, 706
EcoRI GAATTC 1 cut(s) 653
EcoRV GATATC 2 cut(s) 696, 706
EcoT14I CCWWGG 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 144
FaeI CATG 6 cut(s) 180, 189, 240, 592, 611, 689
FatI CATG 6 cut(s) 176, 185, 236, 588, 607, 685
Fnu4HI GCNGC 6 cut(s) 282, 306, 393, 492, 495, 594
Fsp4HI GCNGC 6 cut(s) 282, 306, 393, 492, 495, 594
FspBI CTAG 1 cut(s) 774
GluI GCNGC 6 cut(s) 282, 306, 393, 492, 495, 594
GsuI CTGGAG 1 cut(s) 759
HaeIII GGCC 2 cut(s) 452, 844
Hin1II CATG 6 cut(s) 180, 189, 240, 592, 611, 689
HindIII AAGCTT 1 cut(s) 430
HinfI GANTC 4 cut(s) 437, 504, 556, 577
HphI GGTGA 1 cut(s) 346
Hpy166II GTNNAC 3 cut(s) 53, 209, 466
Hpy188I TCNGA 4 cut(s) 123, 288, 367, 552
Hpy188III TCNNGA 3 cut(s) 501, 532, 738
Hpy8I GTNNAC 3 cut(s) 53, 209, 466
HpyAV CCTTC 3 cut(s) 295, 754, 841
HpyCH4III ACNGT 3 cut(s) 57, 206, 373
HpyCH4IV ACGT 2 cut(s) 99, 462
HpyCH4V TGCA 5 cut(s) 11, 395, 497, 812, 837
HpyF10VI GCNNNNNNNGC 1 cut(s) 392
HpySE526I ACGT 2 cut(s) 99, 462
Hsp92II CATG 6 cut(s) 180, 189, 240, 592, 611, 689
Kzo9I GATC 4 cut(s) 25, 40, 528, 544
LpnPI CCDG 2 cut(s) 370, 723
Lsp1109I GCAGC 6 cut(s) 268, 317, 379, 478, 481, 605
LweI GCATC 1 cut(s) 506
MaeI CTAG 1 cut(s) 774
MaeII ACGT 2 cut(s) 99, 462
MaeIII GTNAC 1 cut(s) 95
MalI GATC 4 cut(s) 27, 42, 530, 546
MboI GATC 4 cut(s) 25, 40, 528, 544
MboII GAAGA 6 cut(s) 101, 121, 368, 539, 547, 677
MflI RGATCY 2 cut(s) 40, 544
MluCI AATT 2 cut(s) 248, 653
MlyI GAGTC 3 cut(s) 446, 513, 571
MmeI TCCRAC 2 cut(s) 148, 292
MnlI CCTC 5 cut(s) 150, 397, 557, 708, 749
MroXI GAANNNNTTC 1 cut(s) 232
MseI TTAA 1 cut(s) 621
MspA1I CMGCKG 2 cut(s) 46, 701
MwoI GCNNNNNNNGC 1 cut(s) 392
NdeII GATC 4 cut(s) 25, 40, 528, 544
NlaIII CATG 6 cut(s) 180, 189, 240, 592, 611, 689
NmuCI GTSAC 1 cut(s) 95
NspI RCATGY 1 cut(s) 180
PciI ACATGT 1 cut(s) 176
PcsI WCGNNNNNNNCGW 1 cut(s) 34
PdmI GAANNNNTTC 1 cut(s) 232
PfeI GAWTC 1 cut(s) 556
PkrI GCNGC 6 cut(s) 283, 307, 394, 493, 496, 595
PleI GAGTC 3 cut(s) 445, 512, 571
PpsI GAGTC 3 cut(s) 445, 512, 571
PscI ACATGT 1 cut(s) 176
PstI CTGCAG 1 cut(s) 839
PsuI RGATCY 2 cut(s) 40, 544
PvuII CAGCTG 1 cut(s) 701
RsaI GTAC 1 cut(s) 772
RsaNI GTAC 1 cut(s) 771
SaqAI TTAA 1 cut(s) 621
SatI GCNGC 6 cut(s) 282, 306, 393, 492, 495, 594
Sau3AI GATC 4 cut(s) 25, 40, 528, 544
ScaI AGTACT 1 cut(s) 772
SchI GAGTC 3 cut(s) 446, 513, 571
SfaNI GCATC 1 cut(s) 506
SfcI CTRYAG 1 cut(s) 835
Sse9I AATT 2 cut(s) 248, 653
SsiI CCGC 1 cut(s) 44
SspMI CTAG 1 cut(s) 774
StyI CCWWGG 1 cut(s) 144
TaaI ACNGT 3 cut(s) 57, 206, 373
TaiI ACGT 2 cut(s) 102, 465
TaqI TCGA 2 cut(s) 5, 531
TaqII GACCGA 1 cut(s) 593
TasI AATT 2 cut(s) 248, 653
TatI WGTACW 1 cut(s) 770
TfiI GAWTC 1 cut(s) 556
Tru1I TTAA 1 cut(s) 621
Tru9I TTAA 1 cut(s) 621
TseFI GTSAC 1 cut(s) 95
TseI GCWGC 6 cut(s) 281, 305, 392, 491, 494, 593
Tsp45I GTSAC 1 cut(s) 95
TspDTI ATGAA 5 cut(s) 49, 128, 225, 674, 678
XapI RAATTY 1 cut(s) 653
XceI RCATGY 1 cut(s) 180
XmnI GAANNNNTTC 1 cut(s) 232
XspI CTAG 1 cut(s) 774
ZrmI AGTACT 1 cut(s) 772
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.