Rmu_sc0006018.1_g000006

Ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006018.1
Physical Location & Seq
Forward (+)
18111 .. 22902
4792 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006018.1_g000006.1.cds

Sequence Viewer

Length: 1947 bp
atgctacatgagagcatagtacgtaaggttgataggaacaattcagaggactcaaaagaaaatacaaagagctaccagtttggctcttttgccccagttactattgccagagctgggaatttcaacatgaagaaggttgactgggacaatttgtcctctacgtggaggttcaatttggaaccaatgtctaccacacaagcacacaattctataccgcctggaattgcattgagagctatgagagatccaatgacatttgcaccttacacgcctggcaatagacagtattaccttgatgtatgtgtgccgctcaataagtatgcactaaaaggcaattgggaagctgttgaactaatcttgaggaaggacccgaggcttttgactgctagcataacaagcggaggtgacacagtccttcacatagcagcaggagcaagacaagttcagtttgtggaggagctggttgaaatgatggaagtatggattggaatggagaaatgttcacaagccttggcaaagcaaggcacgaacggaaacactgccttcagcattgccgctgcagctggaagtattgaaattgcacagattatgatgaagaagaatgagcatttgccaaaaattcgaggtggtgaaggaatgacaccactctatacggctgccttgtcgggacaatctctaatggcagattacttgtactctctaaccaaggacatgttggaggaagccgaccggcagctgttgtttttaacttgtatcgataatggattgtatgatctagctaggaagatgctagaaagtgacagagcattagctaaggttcgtaatataaaagaggaaacagctttgcatatcttggctagaatgcctttagaattcaccagccaaagtccaggaatgtggagtagactcatcacctcatttatcccaggttggaagttctcatacaagagaaacttgaaacaagtcaatgaaggccttcaactagtccaatgcctctggacagaaatcttgagaaatgatcatgtcgatatgatgagattaattgaacatcctacaaaattactgttcgacgctacaaaattaggaaattatgagttcctagcagtgcttattaactcttatcctgatttaatatggcaacttgatgacaaaaatcggagtatattccatgttgctgttttgcatcgtcatgcaagtatctttaatttagtgcatgagataggctccatcaaggatttcatagtgacatttattgatgatgatgagagtaataacattttacatatggctgcaaaattagcacctccaaatcaactcaaccttgtatcaggcgcagctcttcaaatgcagcgagagttggtatggtttgaggaagtaaaaaagattgtacaaccttgctctatagagatgaaaaacaagaaaggacaaacaccacgagaattgttcacaagtgagcataaaggattgttgcaccaaggagaagcatggatgaagcaaactgcaaagtcatgtatgattgttgcggctcttatcgcaactgttgtgttttcagctgcatttagcgtacctggtggtacatctgataatacagggcagccaaactttctaaaagagactgccttccaattctttgccatagcagatggagtagcactcatatcctctttcacttcaatactgatgttcttgctcatcctcacatcgcgttatgctgaaggagatttcctcaaatcattaccgttgaagttgatgataggactcgcatcacttttcatctctatagcatccatgatggtagcttttagcacaaccttctatttagactgtcactatggcttagaatgggtccccaatcttatatttgtatttgtatttgcatttgtaccggttgctttgtttgcttttcagccttttctgcagtttcctctcaggagctctctcgtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

648

Amino Acids

72.9

Weight (kDa)

6.75

Isoelectric Point (pI)

36.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000157)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G54070 AT5G35830
fragaria_vesca FvH4_3g25070 FvH4_3g25080 FvH4_3g25081 FvH4_3g25081
malus_domestica MD03G1027500.v1.1 MD03G1146300.v1.1 MD03G1146800.v1.1 MD03G1146900.v1.1 MD03G1147100.v1.1 MD11G1165600.v1.1
prunus_persica Prupe.2G015800_v2.0.a1 Prupe.2G015900_v2.0.a1 Prupe.2G015900_v2.0.a1 Prupe.2G016300_v2.0.a1 Prupe.2G016500_v2.0.a1 Prupe.6G131100_v2.0.a1 Prupe.6G131400_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131500_v2.0.a1 Prupe.6G131600_v2.0.a1 Prupe.6G131600_v2.0.a1 Prupe.6G131600_v2.0.a1 Prupe.6G131600_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1 Prupe.6G131800_v2.0.a1
pyrus_communis pycom03g10090 pycom03g10110 pycom11g13740 pycom11g13770
rosa_chinensis RchiOBHm_Chr1g0316371 RchiOBHm_Chr1g0316381 RchiOBHm_Chr1g0316401 RchiOBHm_Chr1g0316411 RchiOBHm_Chr1g0316571 RchiOBHm_Chr1g0316601 RchiOBHm_Chr5g0039341 RchiOBHm_Chr5g0041371 RchiOBHm_Chr5g0041401 RchiOBHm_Chr5g0041431 RchiOBHm_Chr5g0041471 RchiOBHm_Chr5g0045281 RchiOBHm_Chr5g0045291 RchiOBHm_Chr5g0045311 RchiOBHm_Chr5g0045371 RchiOBHm_Chr5g0045421 RchiOBHm_Chr5g0045431 RchiOBHm_Chr5g0045501 RchiOBHm_Chr5g0045551 RchiOBHm_Chr5g0045771 RchiOBHm_Chr5g0045811
rosa_laevigata RLG00000034057 RLG00000034058
rosa_multiflora Rmu_co8352751.1_g000001 Rmu_co8397575.1_g000001 Rmu_sc0000415.1_g000006 Rmu_sc0000493.1_g000057 Rmu_sc0000504.1_g000003 Rmu_sc0000594.1_g000019 Rmu_sc0000594.1_g000032 Rmu_sc0000594.1_g000066 Rmu_sc0001047.1_g000003 Rmu_sc0001047.1_g000011 Rmu_sc0001556.1_g000023 Rmu_sc0002584.1_g000003 Rmu_sc0002584.1_g000039 Rmu_sc0002584.1_g000070 Rmu_sc0002667.1_g000015 Rmu_sc0003677.1_g000003 Rmu_sc0003743.1_g000017 Rmu_sc0004520.1_g000004 Rmu_sc0004520.1_g000013 Rmu_sc0004520.1_g000027 Rmu_sc0005539.1_g000014 Rmu_sc0005539.1_g000032 Rmu_sc0006018.1_g000006 Rmu_sc0006737.1_g000020 Rmu_sc0007485.1_g000002 Rmu_sc0008729.1_g000002 Rmu_sc0008729.1_g000003 Rmu_sc0038822.1_g000001 Rmu_ssc0000398.1_g000025
rosa_roxburghii Rroxscaffold_1G00035090 Rroxscaffold_1G00035630 Rroxscaffold_1G00035640 Rroxscaffold_1G00035660 Rroxscaffold_1G00035680 Rroxscaffold_1G00035730 Rroxscaffold_1G00035750 Rroxscaffold_1G00035770 Rroxscaffold_1G00039150 Rroxscaffold_1G00039190 Rroxscaffold_1G00039220 Rroxscaffold_1G00039260 Rroxscaffold_4G00328910 Rroxscaffold_4G00328950 Rroxscaffold_4G00328960 Rroxscaffold_4G00330890
rosa_rugosa Rorug01G0009800 Rorug01G0010000.1 Rorug01G0010200 Rorug01G0012100 Rorug01G0023500 Rorug01G0023600 Rorug01G0023700 Rorug01G0024700 Rorug05G0192000 Rorug05G0192200 Rorug05G0222400 Rorug05G0222500 Rorug05G0222600.1 Rorug05G0222700.1 Rorug05G0222800.1 Rorug05G0222900.1 Rorug05G0223000.1 Rorug05G0223100.1 Rorug05G0223200 Rorug05G0223600 Rorug05G0226800 Rorug05G0226900
rosa_samantha Rh1CG019600 Rh1DG015000 Rh1DG015300 Rh1DG016900 Rh5CG315200 Rh5CG338700 Rh5DG277100 Rh5DG291500 Rh5DG292100 Rh5DG292200 Rh5DG292400 Rh5DG292600 Rh5DG322100 Rh5DG322200 Rh5DG323100 Rh5DG323300 Rh5DG326700 Rh5DG326900 Rh5DG327000
rosa_wichuraiana Rw0G021580 Rw1G001320 Rw1G001420 Rw1G002820 Rw1G002840 Rw1G002870 Rw5G024800 Rw5G026160 Rw5G026170 Rw5G026180 Rw5G026210 Rw5G026230 Rw5G028170 Rw5G028190 Rw5G028210 Rw5G028230 Rw5G028240 Rw5G028260 Rw5G028280 Rw5G028370 Rw5G028380 Rw5G028840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 310
AccI GTMKAC 2 cut(s) 188, 904
AccII CGCG 1 cut(s) 1705
AciI CCGC 5 cut(s) 215, 308, 399, 555, 1523
AclWI GGATC 1 cut(s) 239
AcsI RAATTY 3 cut(s) 118, 618, 872
AcuI CTGAAG 2 cut(s) 529, 1734
AfaI GTAC 6 cut(s) 21, 695, 1389, 1566, 1576, 1884
AfiI CCNNNNNNNGG 2 cut(s) 114, 162
AflIII ACRYGT 1 cut(s) 711
AgeI ACCGGT 1 cut(s) 1885
AhdI GACNNNNNGTC 1 cut(s) 151
AhlI ACTAGT 1 cut(s) 982
AjnI CCWGG 5 cut(s) 217, 271, 889, 925, 1567
AjuI GAANNNNNNNTTGG 2 cut(s) 468, 500
Alw21I GWGCWC 1 cut(s) 1937
Alw26I GTCTC 1 cut(s) 1607
AlwI GGATC 1 cut(s) 239
Ama87I CYCGRG 1 cut(s) 370
AoxI GGCC 1 cut(s) 973
ApoI RAATTY 3 cut(s) 118, 618, 872
AseI ATTAAT 1 cut(s) 1040
AsiGI ACCGGT 1 cut(s) 1885
Asp700I GAANNNNTTC 1 cut(s) 975
AspLEI GCGC 1 cut(s) 1334
AspS9I GGNCC 2 cut(s) 367, 1846
AsuHPI GGTGA 4 cut(s) 416, 641, 868, 904
AsuNHI GCTAGC 1 cut(s) 386
AvaI CYCGRG 1 cut(s) 370
AvaII GGWCC 2 cut(s) 367, 1846
BanII GRGCYC 1 cut(s) 1937
BarI GAAGNNNNNNTAC 2 cut(s) 926, 958
BauI CACGAG 1 cut(s) 1434
Bbv12I GWGCWC 1 cut(s) 1937
BccI CCATC 4 cut(s) 466, 1235, 1637, 1786
BceAI ACGGC 1 cut(s) 669
BciT130I CCWGG 5 cut(s) 219, 273, 891, 927, 1569
BclI TGATCA 1 cut(s) 1018
BcoDI GTCTC 1 cut(s) 1607
BcuI ACTAGT 1 cut(s) 982
BfaI CTAG 7 cut(s) 387, 776, 780, 791, 858, 983, 1100
BfmI CTRYAG 4 cut(s) 558, 1401, 1779, 1916
Bme1390I CCNGG 5 cut(s) 219, 273, 891, 927, 1569
Bme18I GGWCC 2 cut(s) 367, 1846
BmeRI GACNNNNNGTC 1 cut(s) 151
BmeT110I CYCGRG 1 cut(s) 370
BmgT120I GGNCC 2 cut(s) 367, 1846
BmiI GGNNCC 5 cut(s) 180, 369, 1225, 1847, 1848
BmrFI CCNGG 5 cut(s) 219, 273, 891, 927, 1569
BmrI ACTGGG 2 cut(s) 89, 151
BmsI GCATC 4 cut(s) 777, 1192, 1772, 1793
BmtI GCTAGC 1 cut(s) 390
BmuI ACTGGG 2 cut(s) 89, 151
BplI GAGNNNNNCTC 6 cut(s) 1208, 1240, 1638, 1670, 1710, 1742
Bpu10I CCTNAGC 1 cut(s) 813
BpuEI CTTGAG 2 cut(s) 379, 1030
Bsa29I ATCGAT 1 cut(s) 756
BsaAI YACGTR 2 cut(s) 23, 162
BsaJI CCNNGG 5 cut(s) 371, 510, 705, 925, 1474
BsaWI WCCGGW 1 cut(s) 1885
Bsc4I CCNNNNNNNGG 2 cut(s) 114, 162
Bse118I RCCGGY 2 cut(s) 729, 1885
Bse1I ACTGG 3 cut(s) 76, 95, 146
Bse3DI GCAATG 1 cut(s) 549
BseBI CCWGG 5 cut(s) 219, 273, 891, 927, 1569
BseCI ATCGAT 1 cut(s) 756
BseDI CCNNGG 5 cut(s) 371, 510, 705, 925, 1474
BseGI GGATG 4 cut(s) 1048, 1494, 1692, 1784
BseLI CCNNNNNNNGG 2 cut(s) 114, 162
BseMI GCAATG 1 cut(s) 549
BseMII CTCAG 1 cut(s) 1942
BseNI ACTGG 3 cut(s) 76, 95, 146
BseRI GAGGAG 1 cut(s) 470
BseYI CCCAGC 1 cut(s) 113
Bsh1236I CGCG 1 cut(s) 1705
Bsh1285I CGRYCG 1 cut(s) 730
BshFI GGCC 1 cut(s) 975
BshTI ACCGGT 1 cut(s) 1885
BshVI ATCGAT 1 cut(s) 756
BsiEI CGRYCG 1 cut(s) 730
BsiHKAI GWGCWC 1 cut(s) 1937
BsiHKCI CYCGRG 1 cut(s) 370
BsiSI CCGG 2 cut(s) 730, 1886
BslFI GGGAC 3 cut(s) 158, 681, 1832
BslI CCNNNNNNNGG 2 cut(s) 114, 162
BsmAI GTCTC 1 cut(s) 1607
BsmFI GGGAC 3 cut(s) 158, 681, 1832
BsmI GAATGC 1 cut(s) 867
BsnI GGCC 1 cut(s) 975
BsoBI CYCGRG 1 cut(s) 370
Bsp1286I GDGCHC 1 cut(s) 1937
Bsp1407I TGTACA 1 cut(s) 1387
Bsp143I GATC 3 cut(s) 244, 772, 1018
BspACI CCGC 5 cut(s) 215, 308, 399, 555, 1523
BspANI GGCC 1 cut(s) 975
BspCNI CTCAG 1 cut(s) 1941
BspDI ATCGAT 1 cut(s) 756
BspFNI CGCG 1 cut(s) 1705
BspLI GGNNCC 5 cut(s) 180, 369, 1225, 1847, 1848
BspMAI CTGCAG 2 cut(s) 562, 1920
BspOI GCTAGC 1 cut(s) 390
BspPI GGATC 1 cut(s) 239
BspQI GCTCTTC 1 cut(s) 1344
BsrBI CCGCTC 1 cut(s) 310
BsrDI GCAATG 1 cut(s) 549
BsrFI RCCGGY 2 cut(s) 729, 1885
BsrGI TGTACA 1 cut(s) 1387
BsrI ACTGG 3 cut(s) 76, 95, 146
BssAI RCCGGY 2 cut(s) 729, 1885
BssECI CCNNGG 5 cut(s) 371, 510, 705, 925, 1474
BssMI GATC 3 cut(s) 244, 772, 1018
BssSI CACGAG 1 cut(s) 1434
BssT1I CCWWGG 3 cut(s) 510, 705, 1474
Bst2BI CACGAG 1 cut(s) 1434
Bst2UI CCWGG 5 cut(s) 219, 273, 891, 927, 1569
Bst4CI ACNGT 6 cut(s) 285, 412, 1065, 1540, 1740, 1826
Bst6I CTCTTC 1 cut(s) 1344
BstAUI TGTACA 1 cut(s) 1387
BstBAI YACGTR 2 cut(s) 23, 162
BstC8I GCNNGC 1 cut(s) 388
BstDEI CTNAG 3 cut(s) 813, 1837, 1928
BstF5I GGATG 4 cut(s) 1048, 1494, 1692, 1784
BstFNI CGCG 1 cut(s) 1705
BstHHI GCGC 1 cut(s) 1334
BstKTI GATC 3 cut(s) 247, 775, 1021
BstMAI GTCTC 1 cut(s) 1607
BstMBI GATC 3 cut(s) 244, 772, 1018
BstMCI CGRYCG 1 cut(s) 730
BstMWI GCNNNNNNNGC 8 cut(s) 233, 396, 431, 560, 1298, 1532, 1898, 1915
BstNI CCWGG 5 cut(s) 219, 273, 891, 927, 1569
BstNSI RCATGY 1 cut(s) 715
BstSCI CCNGG 5 cut(s) 217, 271, 889, 925, 1567
BstSFI CTRYAG 4 cut(s) 558, 1401, 1779, 1916
BstSNI TACGTA 1 cut(s) 23
BstUI CGCG 1 cut(s) 1705
BstX2I RGATCY 1 cut(s) 244
BstXI CCANNNNNNTGG 1 cut(s) 897
BstYI RGATCY 1 cut(s) 244
Bsu15I ATCGAT 1 cut(s) 756
BsuRI GGCC 1 cut(s) 975
BsuTUI ATCGAT 1 cut(s) 756
BtgZI GCGATG 1 cut(s) 1686
BtsCI GGATG 4 cut(s) 1048, 1494, 1692, 1784
BtsI GCAGTG 2 cut(s) 537, 1110
BtsIMutI CAGTG 2 cut(s) 537, 1110
Cac8I GCNNGC 1 cut(s) 388
CfoI GCGC 1 cut(s) 1334
Cfr10I RCCGGY 2 cut(s) 729, 1885
Cfr13I GGNCC 2 cut(s) 367, 1846
ClaI ATCGAT 1 cut(s) 756
CseI GACGC 1 cut(s) 1079
CsiI ACCWGGT 1 cut(s) 1567
Csp6I GTAC 6 cut(s) 20, 694, 1388, 1565, 1575, 1883
CspAI ACCGGT 1 cut(s) 1885
CspCI CAANNNNNGTGG 2 cut(s) 1422, 1457
CviQI GTAC 6 cut(s) 20, 694, 1388, 1565, 1575, 1883
DdeI CTNAG 3 cut(s) 813, 1837, 1928
DpnI GATC 3 cut(s) 246, 774, 1020
DpnII GATC 3 cut(s) 244, 772, 1018
DriI GACNNNNNGTC 1 cut(s) 151
Eam1104I CTCTTC 1 cut(s) 1344
Eam1105I GACNNNNNGTC 1 cut(s) 151
EarI CTCTTC 1 cut(s) 1344
Ecl136II GAGCTC 1 cut(s) 1935
Eco105I TACGTA 1 cut(s) 23
Eco130I CCWWGG 3 cut(s) 510, 705, 1474
Eco147I AGGCCT 1 cut(s) 975
Eco24I GRGCYC 1 cut(s) 1937
Eco47I GGWCC 2 cut(s) 367, 1846
Eco53kI GAGCTC 1 cut(s) 1935
Eco57I CTGAAG 2 cut(s) 529, 1734
Eco88I CYCGRG 1 cut(s) 370
EcoICRI GAGCTC 1 cut(s) 1935
EcoO109I RGGNCCY 2 cut(s) 367, 1846
EcoRI GAATTC 1 cut(s) 872
EcoRII CCWGG 5 cut(s) 217, 271, 889, 925, 1567
EcoT14I CCWWGG 3 cut(s) 510, 705, 1474
EcoT38I GRGCYC 1 cut(s) 1937
ErhI CCWWGG 3 cut(s) 510, 705, 1474
FalI AAGNNNNNCTT 2 cut(s) 938, 970
FaqI GGGAC 3 cut(s) 158, 681, 1832
FauNDI CATATG 1 cut(s) 1284
FbaI TGATCA 1 cut(s) 1018
FblI GTMKAC 2 cut(s) 188, 904
FokI GGATG 4 cut(s) 1035, 1501, 1679, 1771
FriOI GRGCYC 1 cut(s) 1937
FspBI CTAG 7 cut(s) 387, 776, 780, 791, 858, 983, 1100
GlaI GCGC 1 cut(s) 1333
GsaI CCCAGC 1 cut(s) 117
HaeIII GGCC 1 cut(s) 975
HapII CCGG 2 cut(s) 730, 1886
HgaI GACGC 1 cut(s) 1079
HhaI GCGC 1 cut(s) 1334
Hin6I GCGC 1 cut(s) 1332
HinP1I GCGC 1 cut(s) 1332
HincII GTYRAC 1 cut(s) 139
HindII GTYRAC 1 cut(s) 139
HinfI GANTC 3 cut(s) 50, 906, 1758
HpaII CCGG 2 cut(s) 730, 1886
HphI GGTGA 4 cut(s) 416, 641, 868, 904
Hpy166II GTNNAC 5 cut(s) 139, 189, 503, 905, 1446
Hpy188I TCNGA 4 cut(s) 46, 1158, 1582, 1946
Hpy188III TCNNGA 6 cut(s) 358, 666, 997, 1009, 1124, 1930
Hpy8I GTNNAC 5 cut(s) 139, 189, 503, 905, 1446
Hpy99I CGWCG 1 cut(s) 1073
HpyCH4III ACNGT 6 cut(s) 285, 412, 1065, 1540, 1740, 1826
HpyCH4IV ACGT 2 cut(s) 22, 161
HpyF10VI GCNNNNNNNGC 8 cut(s) 233, 396, 431, 560, 1298, 1532, 1898, 1915
HpyF3I CTNAG 3 cut(s) 813, 1837, 1928
HpySE526I ACGT 2 cut(s) 22, 161
HspAI GCGC 1 cut(s) 1332
KflI GGGWCCC 1 cut(s) 1846
Ksp22I TGATCA 1 cut(s) 1018
Kzo9I GATC 3 cut(s) 244, 772, 1018
LguI GCTCTTC 1 cut(s) 1344
LmnI GCTCC 4 cut(s) 431, 457, 1229, 1932
LweI GCATC 4 cut(s) 777, 1192, 1772, 1793
MabI ACCWGGT 1 cut(s) 1567
MaeI CTAG 7 cut(s) 387, 776, 780, 791, 858, 983, 1100
MaeII ACGT 2 cut(s) 22, 161
MaeIII GTNAC 5 cut(s) 97, 404, 797, 1243, 1826
MalI GATC 3 cut(s) 246, 774, 1020
MbiI CCGCTC 1 cut(s) 310
MboI GATC 3 cut(s) 244, 772, 1018
MboII GAAGA 5 cut(s) 142, 607, 610, 796, 1331
MfeI CAATTG 1 cut(s) 334
MflI RGATCY 1 cut(s) 244
MhlI GDGCHC 1 cut(s) 1937
MlyI GAGTC 3 cut(s) 44, 900, 1752
MmeI TCCRAC 2 cut(s) 696, 911
MroXI GAANNNNTTC 1 cut(s) 975
MseI TTAA 5 cut(s) 746, 1040, 1113, 1130, 1203
MslI CAYNNNNRTG 1 cut(s) 1188
MspA1I CMGCKG 4 cut(s) 557, 563, 736, 1553
MspI CCGG 2 cut(s) 730, 1886
MspR9I CCNGG 5 cut(s) 219, 273, 891, 927, 1569
MunI CAATTG 1 cut(s) 334
Mva1269I GAATGC 1 cut(s) 867
MvaI CCWGG 5 cut(s) 219, 273, 891, 927, 1569
MvnI CGCG 1 cut(s) 1705
MwoI GCNNNNNNNGC 8 cut(s) 233, 396, 431, 560, 1298, 1532, 1898, 1915
NdeI CATATG 1 cut(s) 1284
NdeII GATC 3 cut(s) 244, 772, 1018
NheI GCTAGC 1 cut(s) 386
NlaIV GGNNCC 5 cut(s) 180, 369, 1225, 1847, 1848
NmuCI GTSAC 4 cut(s) 404, 797, 1243, 1826
NspI RCATGY 1 cut(s) 715
PceI AGGCCT 1 cut(s) 975
PciI ACATGT 1 cut(s) 711
PciSI GCTCTTC 1 cut(s) 1344
PctI GAATGC 1 cut(s) 867
PdmI GAANNNNTTC 1 cut(s) 975
PflFI GACNNNGTC 1 cut(s) 410
PfoI TCCNGGA 1 cut(s) 889
PinAI ACCGGT 1 cut(s) 1885
PleI GAGTC 3 cut(s) 44, 900, 1752
PpsI GAGTC 3 cut(s) 44, 900, 1752
Ppu21I YACGTR 2 cut(s) 23, 162
PpuMI RGGWCCY 2 cut(s) 367, 1846
PscI ACATGT 1 cut(s) 711
PshBI ATTAAT 1 cut(s) 1040
Psp124BI GAGCTC 1 cut(s) 1937
Psp5II RGGWCCY 2 cut(s) 367, 1846
Psp6I CCWGG 5 cut(s) 217, 271, 889, 925, 1567
PspFI CCCAGC 1 cut(s) 113
PspGI CCWGG 5 cut(s) 217, 271, 889, 925, 1567
PspN4I GGNNCC 5 cut(s) 180, 369, 1225, 1847, 1848
PspPI GGNCC 2 cut(s) 367, 1846
PspPPI RGGWCCY 2 cut(s) 367, 1846
PstI CTGCAG 2 cut(s) 562, 1920
PsuI RGATCY 1 cut(s) 244
PsyI GACNNNGTC 1 cut(s) 410
PvuII CAGCTG 3 cut(s) 563, 736, 1553
RsaI GTAC 6 cut(s) 21, 695, 1389, 1566, 1576, 1884
RsaNI GTAC 6 cut(s) 20, 694, 1388, 1565, 1575, 1883
RseI CAYNNNNRTG 1 cut(s) 1188
SacI GAGCTC 1 cut(s) 1937
SapI GCTCTTC 1 cut(s) 1344
SaqAI TTAA 5 cut(s) 746, 1040, 1113, 1130, 1203
Sau3AI GATC 3 cut(s) 244, 772, 1018
Sau96I GGNCC 2 cut(s) 367, 1846
SchI GAGTC 3 cut(s) 44, 900, 1752
ScrFI CCNGG 5 cut(s) 219, 273, 891, 927, 1569
SduI GDGCHC 1 cut(s) 1937
SexAI ACCWGGT 1 cut(s) 1567
SfaNI GCATC 4 cut(s) 777, 1192, 1772, 1793
SfcI CTRYAG 4 cut(s) 558, 1401, 1779, 1916
SinI GGWCC 2 cut(s) 367, 1846
SmiMI CAYNNNNRTG 1 cut(s) 1188
SmlI CTYRAG 2 cut(s) 358, 1009
SmoI CTYRAG 2 cut(s) 358, 1009
SnaBI TACGTA 1 cut(s) 23
SpeI ACTAGT 1 cut(s) 982
SseBI AGGCCT 1 cut(s) 975
SsiI CCGC 5 cut(s) 215, 308, 399, 555, 1523
SspMI CTAG 7 cut(s) 387, 776, 780, 791, 858, 983, 1100
SstI GAGCTC 1 cut(s) 1937
StuI AGGCCT 1 cut(s) 975
StyD4I CCNGG 5 cut(s) 217, 271, 889, 925, 1567
StyI CCWWGG 3 cut(s) 510, 705, 1474
TaaI ACNGT 6 cut(s) 285, 412, 1065, 1540, 1740, 1826
TaiI ACGT 2 cut(s) 25, 164
TaqI TCGA 4 cut(s) 622, 756, 1026, 1068
TatI WGTACW 2 cut(s) 693, 1387
TauI GCSGC 3 cut(s) 310, 557, 1526
Tru1I TTAA 5 cut(s) 746, 1040, 1113, 1130, 1203
Tru9I TTAA 5 cut(s) 746, 1040, 1113, 1130, 1203
TscAI CASTG 2 cut(s) 544, 1110
TseFI GTSAC 4 cut(s) 404, 797, 1243, 1826
Tsp45I GTSAC 4 cut(s) 404, 797, 1243, 1826
TspDTI ATGAA 7 cut(s) 143, 608, 984, 1228, 1424, 1505, 1762
TspGWI ACGGA 1 cut(s) 546
TspRI CASTG 2 cut(s) 544, 1110
Tth111I GACNNNGTC 1 cut(s) 410
VpaK11BI GGWCC 2 cut(s) 367, 1846
VspI ATTAAT 1 cut(s) 1040
XapI RAATTY 3 cut(s) 118, 618, 872
XceI RCATGY 1 cut(s) 715
XcmI CCANNNNNNNNNTGG 1 cut(s) 712
XmiI GTMKAC 2 cut(s) 188, 904
XmnI GAANNNNTTC 1 cut(s) 975
XspI CTAG 7 cut(s) 387, 776, 780, 791, 858, 983, 1100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.