Rmu_sc0000929.1_g000023

Domain of unknown function (DUF4283)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000929.1
OG0000336
Physical Location & Seq
Forward (+)
84284 .. 84923
640 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000929.1_g000023.1.cds

Sequence Viewer

Length: 474 bp
atggaggctgttgatgagataacagtccacttggctgcatctttagggctggcagaagcccaaaaacctgtggatctccaaccaccacgtggggaaggactgcagatcccagacatacctgttcaagagcatgaggaccggtttccgtctacattttctgatcgaacttaccgtaatcaaatccttcggggaggaccatgggggtttgacaatgccctgatggtactggctccatatgatggggtaggggctatcaaggagatttcactctccactctagcgttttggttcaaagttcgagatcttcctccactttttcatactgatcgctgtctccggcgaattaaggttgagatagacctcatccagccagtgatcttttggcgaagcttcatggtggatgatggggttgatatcgaccttgatcttttcttcaaaaatttatgtggttggtgccgaaatgtggccttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283

Protein Analysis

157

Amino Acids

17.9

Weight (kDa)

4.87

Isoelectric Point (pI)

34.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000336)

Species Orthologous Gene IDs
malus_domestica MD05G1024100.v1.1
rosa_chinensis RchiOBHm_Chr2g0152291 RchiOBHm_Chr4g0387411
rosa_laevigata RLG00000009698 RLG00000009699 RLG00000009700 RLG00000023615 RLG00000024265 RLG00000034445 RLG00000036567
rosa_multiflora Rmu_co8268067.1_g000001 Rmu_co8313555.1_g000001 Rmu_co8324697.1_g000001 Rmu_sc0000318.1_g000023 Rmu_sc0000342.1_g000016 Rmu_sc0000447.1_g000010 Rmu_sc0000528.1_g000009 Rmu_sc0000539.1_g000060 Rmu_sc0000929.1_g000023 Rmu_sc0001493.1_g000081 Rmu_sc0001674.1_g000003 Rmu_sc0001791.1_g000023 Rmu_sc0001822.1_g000005 Rmu_sc0001822.1_g000033 Rmu_sc0002061.1_g000010 Rmu_sc0002286.1_g000012 Rmu_sc0002979.1_g000009 Rmu_sc0003158.1_g000016 Rmu_sc0003221.1_g000001 Rmu_sc0003641.1_g000029 Rmu_sc0003742.1_g000012 Rmu_sc0003814.1_g000004 Rmu_sc0003823.1_g000005 Rmu_sc0004002.1_g000005 Rmu_sc0004564.1_g000005 Rmu_sc0005415.1_g000003 Rmu_sc0006050.1_g000025 Rmu_sc0006555.1_g000002 Rmu_sc0009954.1_g000020 Rmu_sc0010421.1_g000007 Rmu_sc0010607.1_g000002 Rmu_sc0011044.1_g000005 Rmu_sc0011497.1_g000015 Rmu_sc0014532.1_g000004 Rmu_sc0014745.1_g000005 Rmu_sc0014821.1_g000001 Rmu_sc0015038.1_g000002 Rmu_sc0015454.1_g000004 Rmu_sc0019663.1_g000002 Rmu_sc0027475.1_g000003 Rmu_sc0028826.1_g000002 Rmu_ssc0000117.1_g000019 Rmu_ssc0000175.1_g000034
rosa_roxburghii Rroxscaffold_3G00237080 Rroxscaffold_4G00288290 Rroxscaffold_6G00397510
rosa_rugosa Rorug01G0035000 Rorug01G0190900 Rorug01G0208500 Rorug01G0208600 Rorug01G0208600 Rorug01G0344900 Rorug01G0479500 Rorug01G0479600 Rorug02G0230400 Rorug02G0320900 Rorug02G0433300 Rorug03G0147400 Rorug03G0169700.1 Rorug03G0169800 Rorug03G0198300 Rorug04G0022900 Rorug04G0064600 Rorug04G0322100 Rorug04G0388900 Rorug05G0153200 Rorug05G0231600 Rorug05G0231700 Rorug05G0231800 Rorug05G0276200 Rorug05G0292400 Rorug05G0314700 Rorug06G0092000 Rorug06G0260900 Rorug06G0273600 RorugPtG0003200
rosa_samantha Rh1AG264100 Rh1AG292500 Rh1AG423800 Rh2AG098000 Rh2AG232700 Rh2AG361100 Rh2AG372900 Rh2BG099200 Rh2BG246000 Rh2BG260600 Rh2BG378400 Rh3BG142300 Rh3BG252900 Rh3BG267700 Rh3DG302400 Rh5BG059800 Rh5BG320000 Rh5BG530500 Rh6AG089300 Rh6AG089400 Rh6AG127400 Rh6AG376700 Rh7CG488700 Rh7DG265900
rosa_wichuraiana Rw2G040640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 453
AccB7I CCANNNNNTGG 2 cut(s) 89, 239
AccI GTMKAC 1 cut(s) 149
AclWI GGATC 2 cut(s) 81, 100
AcsI RAATTY 1 cut(s) 439
AcvI CACGTG 1 cut(s) 89
AdeI CACNNNGTG 1 cut(s) 89
AfaI GTAC 1 cut(s) 225
AfiI CCNNNNNNNGG 3 cut(s) 89, 239, 463
AgeI ACCGGT 1 cut(s) 138
AgsI TTSAA 3 cut(s) 125, 292, 436
AluBI AGCT 1 cut(s) 390
AluI AGCT 1 cut(s) 390
Alw26I GTCTC 1 cut(s) 338
AlwI GGATC 2 cut(s) 81, 100
AoxI GGCC 1 cut(s) 465
ApeKI GCWGC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 439
AsiGI ACCGGT 1 cut(s) 138
AspS9I GGNCC 2 cut(s) 136, 194
AvaII GGWCC 2 cut(s) 136, 194
BanI GGYRCC 1 cut(s) 453
BbrPI CACGTG 1 cut(s) 89
BbvI GCAGC 1 cut(s) 22
BccI CCATC 3 cut(s) 214, 233, 398
BcoDI GTCTC 1 cut(s) 338
BfaI CTAG 1 cut(s) 278
BfmI CTRYAG 1 cut(s) 101
BglII AGATCT 1 cut(s) 301
BisI GCNGC 1 cut(s) 36
BlsI GCNGC 1 cut(s) 37
Bme18I GGWCC 2 cut(s) 136, 194
BmgT120I GGNCC 2 cut(s) 136, 194
BmiI GGNNCC 2 cut(s) 231, 455
BmsI GCATC 1 cut(s) 47
BsaAI YACGTR 1 cut(s) 89
BsaJI CCNNGG 1 cut(s) 197
BsaWI WCCGGW 1 cut(s) 138
Bsc4I CCNNNNNNNGG 3 cut(s) 89, 239, 463
Bse118I RCCGGY 1 cut(s) 138
Bse1I ACTGG 2 cut(s) 231, 371
BseDI CCNNGG 1 cut(s) 197
BseGI GGATG 2 cut(s) 363, 406
BseLI CCNNNNNNNGG 3 cut(s) 89, 239, 463
BseNI ACTGG 2 cut(s) 231, 371
BseXI GCAGC 1 cut(s) 22
BshFI GGCC 1 cut(s) 467
BshNI GGYRCC 1 cut(s) 453
BshTI ACCGGT 1 cut(s) 138
BsiSI CCGG 2 cut(s) 139, 337
BslI CCNNNNNNNGG 3 cut(s) 89, 239, 463
BsmAI GTCTC 1 cut(s) 338
BsnI GGCC 1 cut(s) 467
Bsp143I GATC 7 cut(s) 73, 105, 160, 301, 325, 375, 424
Bsp19I CCATGG 1 cut(s) 197
BspANI GGCC 1 cut(s) 467
BspLI GGNNCC 2 cut(s) 231, 455
BspMAI CTGCAG 1 cut(s) 105
BspPI GGATC 2 cut(s) 81, 100
BspT107I GGYRCC 1 cut(s) 453
BsrFI RCCGGY 1 cut(s) 138
BsrI ACTGG 2 cut(s) 231, 371
BssAI RCCGGY 1 cut(s) 138
BssECI CCNNGG 1 cut(s) 197
BssMI GATC 7 cut(s) 73, 105, 160, 301, 325, 375, 424
BssT1I CCWWGG 1 cut(s) 197
Bst4CI ACNGT 2 cut(s) 25, 173
BstBAI YACGTR 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 51
BstDSI CCRYGG 1 cut(s) 197
BstF5I GGATG 2 cut(s) 363, 406
BstKTI GATC 7 cut(s) 76, 108, 163, 304, 328, 378, 427
BstMAI GTCTC 1 cut(s) 338
BstMBI GATC 7 cut(s) 73, 105, 160, 301, 325, 375, 424
BstSFI CTRYAG 1 cut(s) 101
BstV1I GCAGC 1 cut(s) 22
BstX2I RGATCY 3 cut(s) 73, 105, 301
BstYI RGATCY 3 cut(s) 73, 105, 301
BsuRI GGCC 1 cut(s) 467
BtgI CCRYGG 1 cut(s) 197
BtsCI GGATG 2 cut(s) 363, 406
BtsIMutI CAGTG 1 cut(s) 378
Cac8I GCNNGC 1 cut(s) 51
Cfr10I RCCGGY 1 cut(s) 138
Cfr13I GGNCC 2 cut(s) 136, 194
Csp6I GTAC 1 cut(s) 224
CspAI ACCGGT 1 cut(s) 138
CviAII CATG 3 cut(s) 131, 198, 394
CviJI RGCY 9 cut(s) 8, 35, 49, 59, 230, 251, 370, 390, 467
CviKI_1 RGCY 9 cut(s) 8, 35, 49, 59, 230, 251, 370, 390, 467
CviQI GTAC 1 cut(s) 224
DpnI GATC 7 cut(s) 75, 107, 162, 303, 327, 377, 426
DpnII GATC 7 cut(s) 73, 105, 160, 301, 325, 375, 424
DraIII CACNNNGTG 1 cut(s) 89
Eco130I CCWWGG 1 cut(s) 197
Eco32I GATATC 1 cut(s) 415
Eco47I GGWCC 2 cut(s) 136, 194
Eco72I CACGTG 1 cut(s) 89
EcoRV GATATC 1 cut(s) 415
EcoT14I CCWWGG 1 cut(s) 197
ErhI CCWWGG 1 cut(s) 197
FaeI CATG 3 cut(s) 134, 201, 397
FaiI YATR 8 cut(s) 116, 132, 199, 235, 237, 321, 395, 445
FatI CATG 3 cut(s) 130, 197, 393
FauNDI CATATG 1 cut(s) 235
FblI GTMKAC 1 cut(s) 149
Fnu4HI GCNGC 1 cut(s) 36
FokI GGATG 2 cut(s) 350, 413
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 1 cut(s) 278
GluI GCNGC 1 cut(s) 36
HaeIII GGCC 1 cut(s) 467
HapII CCGG 2 cut(s) 139, 337
Hin1II CATG 3 cut(s) 134, 201, 397
HindIII AAGCTT 1 cut(s) 388
HpaII CCGG 2 cut(s) 139, 337
Hpy166II GTNNAC 2 cut(s) 28, 150
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 125, 299
Hpy8I GTNNAC 2 cut(s) 28, 150
HpyAV CCTTC 2 cut(s) 89, 194
HpyCH4III ACNGT 2 cut(s) 25, 173
HpyCH4IV ACGT 1 cut(s) 88
HpyCH4V TGCA 2 cut(s) 38, 103
HpySE526I ACGT 1 cut(s) 88
Hsp92II CATG 3 cut(s) 134, 201, 397
Kzo9I GATC 7 cut(s) 73, 105, 160, 301, 325, 375, 424
LmnI GCTCC 1 cut(s) 235
Lsp1109I GCAGC 1 cut(s) 22
LweI GCATC 1 cut(s) 47
MaeI CTAG 1 cut(s) 278
MaeII ACGT 1 cut(s) 88
MalI GATC 7 cut(s) 75, 107, 162, 303, 327, 377, 426
MboI GATC 7 cut(s) 73, 105, 160, 301, 325, 375, 424
MboII GAAGA 2 cut(s) 296, 424
MflI RGATCY 3 cut(s) 73, 105, 301
MluCI AATT 2 cut(s) 342, 439
MmeI TCCRAC 1 cut(s) 103
MnlI CCTC 4 cut(s) 127, 185, 318, 371
MseI TTAA 1 cut(s) 345
MspI CCGG 2 cut(s) 139, 337
NcoI CCATGG 1 cut(s) 197
NdeI CATATG 1 cut(s) 235
NdeII GATC 7 cut(s) 73, 105, 160, 301, 325, 375, 424
NlaIII CATG 3 cut(s) 134, 201, 397
NlaIV GGNNCC 2 cut(s) 231, 455
PcsI WCGNNNNNNNCGW 1 cut(s) 169
PflMI CCANNNNNTGG 2 cut(s) 89, 239
PinAI ACCGGT 1 cut(s) 138
PkrI GCNGC 1 cut(s) 37
PmaCI CACGTG 1 cut(s) 89
PmlI CACGTG 1 cut(s) 89
Ppu21I YACGTR 1 cut(s) 89
PspCI CACGTG 1 cut(s) 89
PspN4I GGNNCC 2 cut(s) 231, 455
PspPI GGNCC 2 cut(s) 136, 194
PstI CTGCAG 1 cut(s) 105
PsuI RGATCY 3 cut(s) 73, 105, 301
RsaI GTAC 1 cut(s) 225
RsaNI GTAC 1 cut(s) 224
SaqAI TTAA 1 cut(s) 345
SatI GCNGC 1 cut(s) 36
Sau3AI GATC 7 cut(s) 73, 105, 160, 301, 325, 375, 424
Sau96I GGNCC 2 cut(s) 136, 194
SetI ASST 7 cut(s) 70, 91, 121, 351, 363, 392, 423
SfaNI GCATC 1 cut(s) 47
SfcI CTRYAG 1 cut(s) 101
SinI GGWCC 2 cut(s) 136, 194
Sse9I AATT 2 cut(s) 342, 439
SspMI CTAG 1 cut(s) 278
StyI CCWWGG 1 cut(s) 197
TaaI ACNGT 2 cut(s) 25, 173
TaiI ACGT 1 cut(s) 91
TaqI TCGA 3 cut(s) 163, 298, 417
TasI AATT 2 cut(s) 342, 439
Tru1I TTAA 1 cut(s) 345
Tru9I TTAA 1 cut(s) 345
TscAI CASTG 1 cut(s) 378
TseI GCWGC 1 cut(s) 35
TspDTI ATGAA 2 cut(s) 308, 382
TspGWI ACGGA 1 cut(s) 135
TspRI CASTG 1 cut(s) 378
Van91I CCANNNNNTGG 2 cut(s) 89, 239
VpaK11BI GGWCC 2 cut(s) 136, 194
XapI RAATTY 1 cut(s) 439
XcmI CCANNNNNNNNNTGG 2 cut(s) 86, 378
XmiI GTMKAC 1 cut(s) 149
XspI CTAG 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.