Rmu_sc0010421.1_g000007

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010421.1
OG0000336
Physical Location & Seq
Forward (+)
37239 .. 37763
525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010421.1_g000007.1.cds

Sequence Viewer

Length: 525 bp
atggttgttcgactggcagcttctcttggactagcagacgttcgcaggccggtggatcttcgtcctgctcgtggagagggtttgtgtcgttctcagacatatctgatggggaagttgttgacggttagggcttttaataagagatcgttcatgggcatgttctggtgtgcatggaggctgaatggacgatacactactcaggaacatggaaaccgctttatgttcaccttgacggatccatcagatcgtaacctgatccttcgaggtggtccttggggctttgatagagctccggtcgtcctagcacagtatgatggggtgggggcgatcaaggatgttccgctctctactttagctttctggatcaaggtatgtggcctgccaccaacctttcatattgaccgttgcttgagaaggattggtagtgctttggggaggtatgtgcataaggacacaacagaatttgaagaaggaaggattcggatccgagttgagatggatcttctgcagcctgtgatcttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

174

Amino Acids

19.87

Weight (kDa)

10.1

Isoelectric Point (pI)

45.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000336)

Species Orthologous Gene IDs
malus_domestica MD05G1024100.v1.1
rosa_chinensis RchiOBHm_Chr2g0152291 RchiOBHm_Chr4g0387411
rosa_laevigata RLG00000009698 RLG00000009699 RLG00000009700 RLG00000023615 RLG00000024265 RLG00000034445 RLG00000036567
rosa_multiflora Rmu_co8268067.1_g000001 Rmu_co8313555.1_g000001 Rmu_co8324697.1_g000001 Rmu_sc0000318.1_g000023 Rmu_sc0000342.1_g000016 Rmu_sc0000447.1_g000010 Rmu_sc0000528.1_g000009 Rmu_sc0000539.1_g000060 Rmu_sc0000929.1_g000023 Rmu_sc0001493.1_g000081 Rmu_sc0001674.1_g000003 Rmu_sc0001791.1_g000023 Rmu_sc0001822.1_g000005 Rmu_sc0001822.1_g000033 Rmu_sc0002061.1_g000010 Rmu_sc0002286.1_g000012 Rmu_sc0002979.1_g000009 Rmu_sc0003158.1_g000016 Rmu_sc0003221.1_g000001 Rmu_sc0003641.1_g000029 Rmu_sc0003742.1_g000012 Rmu_sc0003814.1_g000004 Rmu_sc0003823.1_g000005 Rmu_sc0004002.1_g000005 Rmu_sc0004564.1_g000005 Rmu_sc0005415.1_g000003 Rmu_sc0006050.1_g000025 Rmu_sc0006555.1_g000002 Rmu_sc0009954.1_g000020 Rmu_sc0010421.1_g000007 Rmu_sc0010607.1_g000002 Rmu_sc0011044.1_g000005 Rmu_sc0011497.1_g000015 Rmu_sc0014532.1_g000004 Rmu_sc0014745.1_g000005 Rmu_sc0014821.1_g000001 Rmu_sc0015038.1_g000002 Rmu_sc0015454.1_g000004 Rmu_sc0019663.1_g000002 Rmu_sc0027475.1_g000003 Rmu_sc0028826.1_g000002 Rmu_ssc0000117.1_g000019 Rmu_ssc0000175.1_g000034
rosa_roxburghii Rroxscaffold_3G00237080 Rroxscaffold_4G00288290 Rroxscaffold_6G00397510
rosa_rugosa Rorug01G0035000 Rorug01G0190900 Rorug01G0208500 Rorug01G0208600 Rorug01G0208600 Rorug01G0344900 Rorug01G0479500 Rorug01G0479600 Rorug02G0230400 Rorug02G0320900 Rorug02G0433300 Rorug03G0147400 Rorug03G0169700.1 Rorug03G0169800 Rorug03G0198300 Rorug04G0022900 Rorug04G0064600 Rorug04G0322100 Rorug04G0388900 Rorug05G0153200 Rorug05G0231600 Rorug05G0231700 Rorug05G0231800 Rorug05G0276200 Rorug05G0292400 Rorug05G0314700 Rorug06G0092000 Rorug06G0260900 Rorug06G0273600 RorugPtG0003200
rosa_samantha Rh1AG264100 Rh1AG292500 Rh1AG423800 Rh2AG098000 Rh2AG232700 Rh2AG361100 Rh2AG372900 Rh2BG099200 Rh2BG246000 Rh2BG260600 Rh2BG378400 Rh3BG142300 Rh3BG252900 Rh3BG267700 Rh3DG302400 Rh5BG059800 Rh5BG320000 Rh5BG530500 Rh6AG089300 Rh6AG089400 Rh6AG127400 Rh6AG376700 Rh7CG488700 Rh7DG265900
rosa_wichuraiana Rw2G040640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 343
AciI CCGC 2 cut(s) 214, 341
AclWI GGATC 8 cut(s) 63, 230, 243, 250, 371, 478, 491, 507
AcsI RAATTY 1 cut(s) 461
AfiI CCNNNNNNNGG 1 cut(s) 71
AgsI TTSAA 1 cut(s) 467
AluBI AGCT 3 cut(s) 20, 290, 356
AluI AGCT 3 cut(s) 20, 290, 356
Alw21I GWGCWC 1 cut(s) 292
AlwI GGATC 8 cut(s) 63, 230, 243, 250, 371, 478, 491, 507
AoxI GGCC 2 cut(s) 47, 376
ApeKI GCWGC 2 cut(s) 17, 508
ApoI RAATTY 1 cut(s) 461
AspS9I GGNCC 1 cut(s) 269
AsuHPI GGTGA 1 cut(s) 217
AvaII GGWCC 1 cut(s) 269
BamHI GGATCC 2 cut(s) 235, 483
BanII GRGCYC 1 cut(s) 292
BauI CACGAG 1 cut(s) 69
Bbv12I GWGCWC 1 cut(s) 292
BbvI GCAGC 2 cut(s) 29, 520
BccI CCATC 4 cut(s) 100, 247, 308, 490
BfaI CTAG 2 cut(s) 32, 302
BfmI CTRYAG 1 cut(s) 506
BisI GCNGC 2 cut(s) 18, 509
BlsI GCNGC 2 cut(s) 19, 510
Bme18I GGWCC 1 cut(s) 269
BmgT120I GGNCC 1 cut(s) 269
BmiI GGNNCC 2 cut(s) 237, 485
BpuEI CTTGAG 1 cut(s) 430
BsaBI GATNNNNATC 1 cut(s) 482
BsaJI CCNNGG 1 cut(s) 272
BsaWI WCCGGW 1 cut(s) 292
Bsc4I CCNNNNNNNGG 1 cut(s) 71
Bse118I RCCGGY 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 18
Bse8I GATNNNNATC 1 cut(s) 482
BseDI CCNNGG 1 cut(s) 272
BseGI GGATG 1 cut(s) 340
BseJI GATNNNNATC 1 cut(s) 482
BseLI CCNNNNNNNGG 1 cut(s) 71
BseMII CTCAG 2 cut(s) 107, 212
BseNI ACTGG 1 cut(s) 18
BseXI GCAGC 2 cut(s) 29, 520
Bsh1285I CGRYCG 1 cut(s) 297
BshFI GGCC 2 cut(s) 49, 378
BsiEI CGRYCG 1 cut(s) 297
BsiHKAI GWGCWC 1 cut(s) 292
BsiSI CCGG 2 cut(s) 50, 293
BslI CCNNNNNNNGG 1 cut(s) 71
BsnI GGCC 2 cut(s) 49, 378
Bsp1286I GDGCHC 1 cut(s) 292
BspACI CCGC 2 cut(s) 214, 341
BspANI GGCC 2 cut(s) 49, 378
BspCNI CTCAG 2 cut(s) 106, 211
BspLI GGNNCC 2 cut(s) 237, 485
BspMAI CTGCAG 1 cut(s) 510
BspPI GGATC 8 cut(s) 63, 230, 243, 250, 371, 478, 491, 507
BsrBI CCGCTC 1 cut(s) 343
BsrFI RCCGGY 1 cut(s) 49
BsrI ACTGG 1 cut(s) 18
BssAI RCCGGY 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 272
BssSI CACGAG 1 cut(s) 69
BssT1I CCWWGG 1 cut(s) 272
Bst2BI CACGAG 1 cut(s) 69
Bst4CI ACNGT 3 cut(s) 124, 309, 404
BstC8I GCNNGC 2 cut(s) 47, 380
BstDEI CTNAG 2 cut(s) 93, 198
BstF5I GGATG 1 cut(s) 340
BstMCI CGRYCG 1 cut(s) 297
BstNSI RCATGY 1 cut(s) 160
BstSFI CTRYAG 1 cut(s) 506
BstV1I GCAGC 2 cut(s) 29, 520
BstX2I RGATCY 4 cut(s) 55, 235, 483, 499
BstYI RGATCY 4 cut(s) 55, 235, 483, 499
BsuRI GGCC 2 cut(s) 49, 378
BtsCI GGATG 1 cut(s) 340
Cac8I GCNNGC 2 cut(s) 47, 380
Cfr10I RCCGGY 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 269
CspCI CAANNNNNGTGG 2 cut(s) 355, 390
CviAII CATG 4 cut(s) 151, 157, 171, 206
CviJI RGCY 9 cut(s) 20, 49, 131, 178, 279, 290, 356, 378, 511
CviKI_1 RGCY 9 cut(s) 20, 49, 131, 178, 279, 290, 356, 378, 511
DdeI CTNAG 2 cut(s) 93, 198
Ecl136II GAGCTC 1 cut(s) 290
Eco130I CCWWGG 1 cut(s) 272
Eco24I GRGCYC 1 cut(s) 292
Eco47I GGWCC 1 cut(s) 269
Eco53kI GAGCTC 1 cut(s) 290
EcoICRI GAGCTC 1 cut(s) 290
EcoT14I CCWWGG 1 cut(s) 272
EcoT38I GRGCYC 1 cut(s) 292
ErhI CCWWGG 1 cut(s) 272
FaeI CATG 4 cut(s) 154, 160, 174, 209
FatI CATG 4 cut(s) 150, 156, 170, 205
Fnu4HI GCNGC 2 cut(s) 18, 509
FokI GGATG 1 cut(s) 347
FriOI GRGCYC 1 cut(s) 292
Fsp4HI GCNGC 2 cut(s) 18, 509
FspBI CTAG 2 cut(s) 32, 302
GluI GCNGC 2 cut(s) 18, 509
HaeIII GGCC 2 cut(s) 49, 378
HapII CCGG 2 cut(s) 50, 293
Hin1II CATG 4 cut(s) 154, 160, 174, 209
HincII GTYRAC 1 cut(s) 120
HindII GTYRAC 1 cut(s) 120
HinfI GANTC 1 cut(s) 478
HpaII CCGG 2 cut(s) 50, 293
HphI GGTGA 1 cut(s) 217
Hpy166II GTNNAC 2 cut(s) 120, 225
Hpy188I TCNGA 6 cut(s) 96, 105, 244, 483, 488, 524
Hpy188III TCNNGA 2 cut(s) 200, 361
Hpy8I GTNNAC 2 cut(s) 120, 225
HpyAV CCTTC 4 cut(s) 269, 408, 464, 468
HpyCH4III ACNGT 3 cut(s) 124, 309, 404
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 3 cut(s) 170, 445, 508
HpyF3I CTNAG 2 cut(s) 93, 198
HpySE526I ACGT 1 cut(s) 39
Hsp92II CATG 4 cut(s) 154, 160, 174, 209
LmnI GCTCC 1 cut(s) 295
LpnPI CCDG 9 cut(s) 31, 63, 78, 148, 185, 266, 306, 346, 392
Lsp1109I GCAGC 2 cut(s) 29, 520
MaeI CTAG 2 cut(s) 32, 302
MaeII ACGT 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 248
MbiI CCGCTC 1 cut(s) 343
MboII GAAGA 4 cut(s) 50, 479, 494, 511
MflI RGATCY 4 cut(s) 55, 235, 483, 499
MhlI GDGCHC 1 cut(s) 292
MluCI AATT 1 cut(s) 461
MnlI CCTC 4 cut(s) 70, 168, 257, 429
MseI TTAA 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 155
MspI CCGG 2 cut(s) 50, 293
NlaIII CATG 4 cut(s) 154, 160, 174, 209
NlaIV GGNNCC 2 cut(s) 237, 485
NspI RCATGY 1 cut(s) 160
PcsI WCGNNNNNNNCGW 1 cut(s) 67
PfeI GAWTC 1 cut(s) 478
PkrI GCNGC 2 cut(s) 19, 510
Psp124BI GAGCTC 1 cut(s) 292
PspN4I GGNNCC 2 cut(s) 237, 485
PspPI GGNCC 1 cut(s) 269
PstI CTGCAG 1 cut(s) 510
PsuI RGATCY 4 cut(s) 55, 235, 483, 499
RseI CAYNNNNRTG 1 cut(s) 155
SacI GAGCTC 1 cut(s) 292
SaqAI TTAA 1 cut(s) 135
SatI GCNGC 2 cut(s) 18, 509
Sau96I GGNCC 1 cut(s) 269
SduI GDGCHC 1 cut(s) 292
SfcI CTRYAG 1 cut(s) 506
SinI GGWCC 1 cut(s) 269
SmiMI CAYNNNNRTG 1 cut(s) 155
SmlI CTYRAG 1 cut(s) 409
SmoI CTYRAG 1 cut(s) 409
Sse9I AATT 1 cut(s) 461
SsiI CCGC 2 cut(s) 214, 341
SspMI CTAG 2 cut(s) 32, 302
SstI GAGCTC 1 cut(s) 292
StyI CCWWGG 1 cut(s) 272
TaaI ACNGT 3 cut(s) 124, 309, 404
TaiI ACGT 1 cut(s) 42
TaqI TCGA 2 cut(s) 10, 262
TasI AATT 1 cut(s) 461
TfiI GAWTC 1 cut(s) 478
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TseI GCWGC 2 cut(s) 17, 508
TspDTI ATGAA 2 cut(s) 139, 383
TspGWI ACGGA 1 cut(s) 248
VpaK11BI GGWCC 1 cut(s) 269
XapI RAATTY 1 cut(s) 461
XceI RCATGY 1 cut(s) 160
XspI CTAG 2 cut(s) 32, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.