pycom06g11620

Retroviral aspartyl protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
OG0000291
Physical Location & Seq
Forward (+)
16862038 .. 16863101
1064 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g11620.3

Sequence Viewer

Length: 444 bp
ATGGAAACCAGAGCTCGGCCGCAACCAATGCGGCTCGTCGGATTCATCGCCGGTCGAACTATCCTTGTGTCGGTGGCGTCCGAATCCGCCCTGAACCTCATAAGCACATCTATAGTAGGTGAACTCGGCCTCGAAGTCGATCGGAATCTCTCCCTTTCTTTTCCGCTTGCAAACGGCACGGCGGCGAGAACCGACGACGTCGTGTCGAATCTGCGGGTGGAGATTGAAGAATACGAGTACGTTTCGGACTTTCACGTTTCTCCGCTGCCGGATTGCGACGTGGTGTTCGGGGCCGATTGGCTCGAGTCTCTAGGCGCTGTTGTTTGGAATTTTAGGGAGAAGTGGATGAGATTTACTGTAGATGGAATTAAGCACACGTTGGTTGGAGTTGGAGTCGACGGGCCGAGGGCCCACTCCAACAACACCGATACTGTCCCCACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVP_2 RVT_1 Retrotrans_gag

Protein Analysis

148

Amino Acids

16.1

Weight (kDa)

4.74

Isoelectric Point (pI)

20.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000291)

Species Orthologous Gene IDs
arabidopsis_thaliana ATMG00860
fragaria_vesca FvH4_1g23712 FvH4_1g29809 FvH4_1g29810 FvH4_2g02661 FvH4_2g13451 FvH4_2g17921 FvH4_2g17922 FvH4_2g19251 FvH4_2g19252 FvH4_2g28221 FvH4_2g35961 FvH4_3g10372 FvH4_3g12461 FvH4_3g12461 FvH4_3g27861 FvH4_3g34591 FvH4_3g40201 FvH4_3g44612 FvH4_4g08352 FvH4_4g12251 FvH4_4g12742 FvH4_4g13904 FvH4_4g14287 FvH4_4g15243 FvH4_4g24071 FvH4_4g33448 FvH4_5g21912 FvH4_5g39371 FvH4_6g14992 FvH4_6g15221 FvH4_6g20603 FvH4_6g31093 FvH4_6g32372 FvH4_6g33012
malus_domestica MD11G1009100.v1.1 MD13G1145000.v1.1 MD16G1138700.v1.1
prunus_persica Prupe.5G246300_v2.0.a1 Prupe.7G034800_v2.0.a1 Prupe.8G084500_v2.0.a1
pyrus_communis pycom01g18240 pycom04g00330 pycom05g09010 pycom06g01670 pycom06g01690 pycom06g07180 pycom06g11620 pycom10g05720 pycom1134g00040 pycom1134g00060 pycom12486g00010 pycom12555g00230 pycom13g21670 pycom13g23130 pycom13g23140 pycom14g10580
rosa_chinensis RchiOBHm_Chr1g0330691 RchiOBHm_Chr2g0106171 RchiOBHm_Chr2g0134731 RchiOBHm_Chr2g0142791 RchiOBHm_Chr2g0149861 RchiOBHm_Chr3g0452401 RchiOBHm_Chr3g0461881 RchiOBHm_Chr4g0401341 RchiOBHm_Chr5g0075641 RchiOBHm_Chr6g0265961 RchiOBHm_Chr7g0200201 RchiOBHm_Chr7g0237811
rosa_laevigata RLG00000002773
rosa_multiflora Rmu_co8037806.1_g000001 Rmu_co8445989.1_g000001 Rmu_sc0000745.1_g000039 Rmu_sc0004448.1_g000029 Rmu_sc0004488.1_g000002 Rmu_sc0004591.1_g000018 Rmu_sc0005065.1_g000030 Rmu_sc0005150.1_g000005 Rmu_sc0005654.1_g000011 Rmu_sc0006986.1_g000016
rosa_roxburghii Rroxscaffold_164G00436490 Rroxscaffold_175G00432490 Rroxscaffold_1G00059440 Rroxscaffold_1G00064410 Rroxscaffold_2G00100310 Rroxscaffold_2G00128170 Rroxscaffold_3G00239420 Rroxscaffold_3G00264970 Rroxscaffold_3G00271550 Rroxscaffold_4G00300240 Rroxscaffold_5G00385050 Rroxscaffold_6G00399720
rosa_rugosa Rorug02G0252200
rosa_samantha Rh2DG251900 Rh7CG329900
rosa_wichuraiana Rw0G004800 Rw1G000850 Rw1G022350 Rw2G027030 Rw2G027760 Rw2G028410 Rw2G029130 Rw2G029390 Rw2G032490 Rw2G039460 Rw2G047800 Rw2G050340 Rw3G026430 Rw4G018370 Rw4G030750 Rw4G033140 Rw5G011950 Rw5G012010 Rw5G029280 Rw5G040190 Rw5G044570 Rw5G048240 Rw6G000340 Rw6G010140 Rw6G026480 Rw7G033750 Rw7G037250 Rw7G042080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 201
AccI GTMKAC 1 cut(s) 396
AciI CCGC 7 cut(s) 20, 31, 87, 164, 182, 214, 263
AcoI YGGCCR 1 cut(s) 17
AcsI RAATTY 1 cut(s) 328
AcyI GRCGYC 2 cut(s) 77, 198
AfaI GTAC 1 cut(s) 239
AfiI CCNNNNNNNGG 2 cut(s) 15, 70
AflIII ACRYGT 1 cut(s) 375
AgsI TTSAA 1 cut(s) 227
AhdI GACNNNNNGTC 1 cut(s) 202
AjiI CACGTC 1 cut(s) 280
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
Alw21I GWGCWC 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 312
Ama87I CYCGRG 1 cut(s) 302
AoxI GGCC 5 cut(s) 17, 127, 291, 401, 408
ApaI GGGCCC 1 cut(s) 412
ApeKI GCWGC 1 cut(s) 265
ApoI RAATTY 1 cut(s) 328
ArsI GACNNNNNNTTYG 2 cut(s) 269, 301
AspLEI GCGC 1 cut(s) 317
AspS9I GGNCC 4 cut(s) 291, 401, 408, 409
AsuHPI GGTGA 1 cut(s) 131
AvaI CYCGRG 1 cut(s) 302
BaeGI GKGCMC 1 cut(s) 412
BanII GRGCYC 2 cut(s) 16, 412
Bbv12I GWGCWC 1 cut(s) 16
BbvI GCAGC 1 cut(s) 252
BccI CCATC 1 cut(s) 356
BceAI ACGGC 2 cut(s) 190, 195
BcoDI GTCTC 1 cut(s) 312
BfaI CTAG 1 cut(s) 311
BfmI CTRYAG 2 cut(s) 111, 357
BfoI RGCGCY 1 cut(s) 318
BisI GCNGC 4 cut(s) 20, 32, 183, 266
BlsI GCNGC 4 cut(s) 21, 33, 184, 267
BmeRI GACNNNNNGTC 1 cut(s) 202
BmeT110I CYCGRG 1 cut(s) 302
BmgBI CACGTC 1 cut(s) 280
BmgT120I GGNCC 4 cut(s) 291, 401, 408, 409
BmiI GGNNCC 2 cut(s) 292, 410
BsaBI GATNNNNATC 1 cut(s) 144
BsaHI GRCGYC 2 cut(s) 77, 198
BsaJI CCNNGG 1 cut(s) 404
BsaXI ACNNNNNCTCC 2 cut(s) 378, 408
Bsc4I CCNNNNNNNGG 2 cut(s) 15, 70
Bse118I RCCGGY 1 cut(s) 50
Bse8I GATNNNNATC 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 404
BseGI GGATG 1 cut(s) 351
BseJI GATNNNNATC 1 cut(s) 144
BseLI CCNNNNNNNGG 2 cut(s) 15, 70
BseSI GKGCMC 1 cut(s) 412
BseX3I CGGCCG 1 cut(s) 17
BseXI GCAGC 1 cut(s) 252
Bsh1285I CGRYCG 3 cut(s) 20, 55, 142
BshFI GGCC 5 cut(s) 19, 129, 293, 403, 410
BsiEI CGRYCG 3 cut(s) 20, 55, 142
BsiHKAI GWGCWC 1 cut(s) 16
BsiHKCI CYCGRG 1 cut(s) 302
BsiSI CCGG 2 cut(s) 51, 269
BslFI GGGAC 1 cut(s) 419
BslI CCNNNNNNNGG 2 cut(s) 15, 70
BsmAI GTCTC 1 cut(s) 312
BsmFI GGGAC 1 cut(s) 419
BsnI GGCC 5 cut(s) 19, 129, 293, 403, 410
BsoBI CYCGRG 1 cut(s) 302
Bsp120I GGGCCC 1 cut(s) 408
Bsp1286I GDGCHC 2 cut(s) 16, 412
Bsp143I GATC 1 cut(s) 139
BspACI CCGC 7 cut(s) 20, 31, 87, 164, 182, 214, 263
BspANI GGCC 5 cut(s) 19, 129, 293, 403, 410
BspLI GGNNCC 2 cut(s) 292, 410
BsrFI RCCGGY 1 cut(s) 50
BssAI RCCGGY 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 404
BssMI GATC 1 cut(s) 139
BssNI GRCGYC 2 cut(s) 77, 198
Bst4CI ACNGT 2 cut(s) 358, 433
BstACI GRCGYC 2 cut(s) 77, 198
BstAPI GCANNNNNTGC 1 cut(s) 28
BstC8I GCNNGC 1 cut(s) 168
BstF5I GGATG 1 cut(s) 351
BstH2I RGCGCY 1 cut(s) 318
BstHHI GCGC 1 cut(s) 317
BstKTI GATC 1 cut(s) 142
BstMAI GTCTC 1 cut(s) 312
BstMBI GATC 1 cut(s) 139
BstMCI CGRYCG 3 cut(s) 20, 55, 142
BstMWI GCNNNNNNNGC 1 cut(s) 28
BstSFI CTRYAG 2 cut(s) 111, 357
BstSLI GKGCMC 1 cut(s) 412
BstV1I GCAGC 1 cut(s) 252
BstZI CGGCCG 1 cut(s) 17
BsuRI GGCC 5 cut(s) 19, 129, 293, 403, 410
BtgZI GCGATG 1 cut(s) 31
BtrI CACGTC 1 cut(s) 280
BtsCI GGATG 1 cut(s) 351
Cac8I GCNNGC 1 cut(s) 168
CfoI GCGC 1 cut(s) 317
Cfr10I RCCGGY 1 cut(s) 50
Cfr13I GGNCC 4 cut(s) 291, 401, 408, 409
CseI GACGC 1 cut(s) 66
Csp6I GTAC 1 cut(s) 238
CviJI RGCY 8 cut(s) 14, 19, 34, 129, 293, 301, 403, 410
CviKI_1 RGCY 8 cut(s) 14, 19, 34, 129, 293, 301, 403, 410
CviQI GTAC 1 cut(s) 238
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
DriI GACNNNNNGTC 1 cut(s) 202
EaeI YGGCCR 1 cut(s) 17
EagI CGGCCG 1 cut(s) 17
Eam1105I GACNNNNNGTC 1 cut(s) 202
EciI GGCGGA 1 cut(s) 76
Ecl136II GAGCTC 1 cut(s) 14
EclXI CGGCCG 1 cut(s) 17
Eco24I GRGCYC 2 cut(s) 16, 412
Eco52I CGGCCG 1 cut(s) 17
Eco53kI GAGCTC 1 cut(s) 14
Eco88I CYCGRG 1 cut(s) 302
EcoICRI GAGCTC 1 cut(s) 14
EcoO109I RGGNCCY 1 cut(s) 408
EcoT38I GRGCYC 2 cut(s) 16, 412
FaiI YATR 2 cut(s) 101, 113
FaqI GGGAC 1 cut(s) 419
FauI CCCGC 1 cut(s) 207
FblI GTMKAC 1 cut(s) 396
Fnu4HI GCNGC 4 cut(s) 20, 32, 183, 266
FokI GGATG 1 cut(s) 358
FriOI GRGCYC 2 cut(s) 16, 412
Fsp4HI GCNGC 4 cut(s) 20, 32, 183, 266
FspBI CTAG 1 cut(s) 311
GlaI GCGC 1 cut(s) 316
GluI GCNGC 4 cut(s) 20, 32, 183, 266
HaeII RGCGCY 1 cut(s) 318
HaeIII GGCC 5 cut(s) 19, 129, 293, 403, 410
HapII CCGG 2 cut(s) 51, 269
HgaI GACGC 1 cut(s) 66
HhaI GCGC 1 cut(s) 317
Hin1I GRCGYC 2 cut(s) 77, 198
Hin6I GCGC 1 cut(s) 315
HinP1I GCGC 1 cut(s) 315
HincII GTYRAC 1 cut(s) 397
HindII GTYRAC 1 cut(s) 397
HinfI GANTC 6 cut(s) 42, 83, 145, 208, 305, 393
HpaII CCGG 2 cut(s) 51, 269
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 2 cut(s) 122, 397
Hpy188I TCNGA 4 cut(s) 41, 82, 144, 247
Hpy8I GTNNAC 2 cut(s) 122, 397
Hpy99I CGWCG 6 cut(s) 41, 197, 200, 203, 281, 401
HpyCH4III ACNGT 2 cut(s) 358, 433
HpyCH4IV ACGT 5 cut(s) 198, 240, 255, 279, 377
HpyCH4V TGCA 1 cut(s) 170
HpyF10VI GCNNNNNNNGC 1 cut(s) 28
HpySE526I ACGT 5 cut(s) 198, 240, 255, 279, 377
Hsp92I GRCGYC 2 cut(s) 77, 198
HspAI GCGC 1 cut(s) 315
Kzo9I GATC 1 cut(s) 139
LpnPI CCDG 4 cut(s) 22, 64, 104, 282
Lsp1109I GCAGC 1 cut(s) 252
MaeI CTAG 1 cut(s) 311
MaeII ACGT 5 cut(s) 198, 240, 255, 279, 377
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 1 cut(s) 239
MhlI GDGCHC 2 cut(s) 16, 412
MluCI AATT 2 cut(s) 328, 366
MlyI GAGTC 2 cut(s) 314, 402
MmeI TCCRAC 4 cut(s) 19, 364, 370, 441
MnlI CCTC 3 cut(s) 107, 140, 399
MseI TTAA 2 cut(s) 369, 442
MspA1I CMGCKG 1 cut(s) 265
MspI CCGG 2 cut(s) 51, 269
MwoI GCNNNNNNNGC 1 cut(s) 28
NdeII GATC 1 cut(s) 139
NlaIV GGNNCC 2 cut(s) 292, 410
NmeAIII GCCGAG 2 cut(s) 105, 429
PaeR7I CTCGAG 1 cut(s) 302
PfeI GAWTC 4 cut(s) 42, 83, 145, 208
PflFI GACNNNGTC 1 cut(s) 197
PkrI GCNGC 4 cut(s) 21, 33, 184, 267
Ple19I CGATCG 1 cut(s) 142
PleI GAGTC 2 cut(s) 313, 401
PpsI GAGTC 2 cut(s) 313, 401
Psp124BI GAGCTC 1 cut(s) 16
PspN4I GGNNCC 2 cut(s) 292, 410
PspOMI GGGCCC 1 cut(s) 408
PspPI GGNCC 4 cut(s) 291, 401, 408, 409
PspXI VCTCGAGB 1 cut(s) 302
PsyI GACNNNGTC 1 cut(s) 197
PvuI CGATCG 1 cut(s) 142
RsaI GTAC 1 cut(s) 239
RsaNI GTAC 1 cut(s) 238
SacI GAGCTC 1 cut(s) 16
SalI GTCGAC 1 cut(s) 395
SaqAI TTAA 2 cut(s) 369, 442
SatI GCNGC 4 cut(s) 20, 32, 183, 266
Sau3AI GATC 1 cut(s) 139
Sau96I GGNCC 4 cut(s) 291, 401, 408, 409
SchI GAGTC 2 cut(s) 314, 402
SduI GDGCHC 2 cut(s) 16, 412
SetI ASST 8 cut(s) 16, 99, 121, 201, 243, 258, 282, 380
SfcI CTRYAG 2 cut(s) 111, 357
Sfr274I CTCGAG 1 cut(s) 302
SlaI CTCGAG 1 cut(s) 302
SmlI CTYRAG 1 cut(s) 302
SmoI CTYRAG 1 cut(s) 302
Sse9I AATT 2 cut(s) 328, 366
SsiI CCGC 7 cut(s) 20, 31, 87, 164, 182, 214, 263
SspMI CTAG 1 cut(s) 311
SstI GAGCTC 1 cut(s) 16
TaaI ACNGT 2 cut(s) 358, 433
TaiI ACGT 5 cut(s) 201, 243, 258, 282, 380
TaqI TCGA 6 cut(s) 55, 132, 138, 206, 303, 396
TasI AATT 2 cut(s) 328, 366
TauI GCSGC 3 cut(s) 22, 34, 185
TfiI GAWTC 4 cut(s) 42, 83, 145, 208
Tru1I TTAA 2 cut(s) 369, 442
Tru9I TTAA 2 cut(s) 369, 442
TseI GCWGC 1 cut(s) 265
TspDTI ATGAA 1 cut(s) 34
Tth111I GACNNNGTC 1 cut(s) 197
XapI RAATTY 1 cut(s) 328
XhoI CTCGAG 1 cut(s) 302
XmiI GTMKAC 1 cut(s) 396
XspI CTAG 1 cut(s) 311
ZraI GACGTC 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.