RchiOBHm_Chr2g0148521

Belongs to the terpene cyclase mutase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
66275280 .. 66275661
382 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGCTAAGAGAGAGAAACTTCAAGCAAGAAATTCCTCCAGTAAGAATTGGGGAAGGTGATGACATTACATTTGATCAGGCCACAGCTACCTATAGGAGGAATGCTACCTTCTGGAATGCCTTGCAATCACCCCATGGTCATTGGCCTACTGAAAATGCTGGTGTAAATTTTTTCTGTCCTCCCTTGGTAATGAGTTTATACACAATGGGATATCTCAATGTTGTTTTCTCTGCTGAGCATAAGAATGAAATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.69

Weight (kDa)

5.82

Isoelectric Point (pI)

58.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000173)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G66960 AT1G66960 AT1G66960 AT1G66960 AT1G78950 AT1G78950 AT1G78955 AT1G78955 AT1G78955 AT1G78955 AT1G78960 AT1G78960 AT1G78960 AT1G78960 AT1G78960 AT1G78970 AT1G78970 AT1G78970
fragaria_vesca FvH4_5g29480 FvH4_6g36450 FvH4_6g36450 FvH4_6g36500 FvH4_6g36520 FvH4_6g36520 FvH4_6g36520 FvH4_6g36520 FvH4_6g36520 FvH4_6g36520 FvH4_6g36520 FvH4_6g36520 FvH4_6g36520 FvH4_6g36520 FvH4_6g37620
malus_domestica MD03G1089600.v1.1 MD09G1167700.v1.1 MD09G1168200.v1.1 MD09G1168300.v1.1 MD11G1098600.v1.1 MD17G1158300.v1.1 MD17G1158700.v1.1 MD17G1159500.v1.1 MD17G1160500.v1.1 MD17G1182500.v1.1 MD17G1182700.v1.1 MD17G1245800.v1.1 MD17G1246300.v1.1 MD17G1246600.v1.1
prunus_persica Prupe.3G025700_v2.0.a1 Prupe.3G025700_v2.0.a1 Prupe.3G025800_v2.0.a1 Prupe.3G025900_v2.0.a1 Prupe.3G026200_v2.0.a1 Prupe.3G026200_v2.0.a1 Prupe.3G026200_v2.0.a1 Prupe.3G026200_v2.0.a1 Prupe.3G026400_v2.0.a1 Prupe.3G026500_v2.0.a1 Prupe.3G026700_v2.0.a1 Prupe.3G026800_v2.0.a1
pyrus_communis pycom03g07120 pycom09g08520 pycom09g08590 pycom09g08610 pycom10g10070 pycom11g08310 pycom16g19880 pycom17g15190 pycom17g15300
rosa_chinensis RchiOBHm_Chr2g0136221 RchiOBHm_Chr2g0148451 RchiOBHm_Chr2g0148501 RchiOBHm_Chr2g0148521 RchiOBHm_Chr2g0148661 RchiOBHm_Chr2g0148701 RchiOBHm_Chr2g0148811 RchiOBHm_Chr2g0148941 RchiOBHm_Chr2g0148981 RchiOBHm_Chr2g0150451 RchiOBHm_Chr2g0150521 RchiOBHm_Chr2g0150611 RchiOBHm_Chr4g0420831 RchiOBHm_Chr5g0049791 RchiOBHm_Chr5g0049801
rosa_laevigata RLG00000007735 RLG00000020351 RLG00000020352 RLG00000020357 RLG00000020358 RLG00000020360 RLG00000029093 RLG00000030686
rosa_multiflora Rmu_co8274513.1_g000001 Rmu_sc0000048.1_g000003 Rmu_sc0000048.1_g000033 Rmu_sc0000048.1_g000039 Rmu_sc0001397.1_g000011 Rmu_sc0001998.1_g000039 Rmu_sc0002070.1_g000055 Rmu_sc0002082.1_g000052 Rmu_sc0003181.1_g000010 Rmu_sc0005104.1_g000005 Rmu_sc0006758.1_g000002 Rmu_sc0008411.1_g000029 Rmu_sc0008411.1_g000030 Rmu_sc0017472.1_g000001 Rmu_sc0017472.1_g000003 Rmu_sc0029876.1_g000001 Rmu_ssc0000480.1_g000024 Rmu_ssc0000480.1_g000036
rosa_roxburghii Rroxscaffold_2G00097070 Rroxscaffold_2G00098540 Rroxscaffold_2G00098560 Rroxscaffold_2G00098570 Rroxscaffold_2G00098650 Rroxscaffold_2G00098710 Rroxscaffold_2G00098740 Rroxscaffold_3G00225830 Rroxscaffold_3G00236870 Rroxscaffold_4G00312240
rosa_rugosa Rorug01G0047000 Rorug02G0372300 Rorug02G0407200 Rorug02G0407300 Rorug02G0408400 Rorug02G0421500 Rorug07G0208900
rosa_samantha Rh2AG380200 Rh2AG465700 Rh2AG465800 Rh2AG466800 Rh2AG467100 Rh2AG467600 Rh2AG480900 Rh2AG481400 Rh2AG481700 Rh2CG073500 Rh2CG452200 Rh2CG453200 Rh2CG453600 Rh2CG454100 Rh2CG467100 Rh2CG467800 Rh2CG468000 Rh2DG403100 Rh2DG487800 Rh2DG487900 Rh2DG488800 Rh2DG502000 Rh2DG502200 Rh2DG502300 Rh2DG503100 Rh3AG319300 Rh4AG227700 Rh4BG371800 Rh5AG327400 Rh5DG350600 Rh7AG349800
rosa_wichuraiana Rw0G010080 Rw2G031110 Rw2G037980 Rw2G037990 Rw2G038000 Rw2G038010 Rw2G038080 Rw2G038100 Rw2G039260 Rw2G039290 Rw2G039470 Rw4G019710 Rw5G030930

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 30, 166
AfiI CCNNNNNNNGG 1 cut(s) 96
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
AoxI GGCC 2 cut(s) 78, 143
ApoI RAATTY 2 cut(s) 30, 166
ArsI GACNNNNNNTTYG 2 cut(s) 53, 85
AsuHPI GGTGA 2 cut(s) 68, 120
BclI TGATCA 1 cut(s) 73
BfaI CTAG 1 cut(s) 253
BfmI CTRYAG 1 cut(s) 91
BlpI GCTNAGC 1 cut(s) 234
BpmI CTGGAG 1 cut(s) 21
Bpu1102I GCTNAGC 1 cut(s) 234
BsaJI CCNNGG 2 cut(s) 133, 183
Bsc4I CCNNNNNNNGG 1 cut(s) 96
Bse1I ACTGG 1 cut(s) 38
BseDI CCNNGG 2 cut(s) 133, 183
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 225
BseNI ACTGG 1 cut(s) 38
BshFI GGCC 2 cut(s) 80, 145
BslI CCNNNNNNNGG 1 cut(s) 96
BsmI GAATGC 2 cut(s) 106, 121
BsnI GGCC 2 cut(s) 80, 145
Bsp143I GATC 1 cut(s) 73
Bsp1720I GCTNAGC 1 cut(s) 234
Bsp19I CCATGG 1 cut(s) 133
BspANI GGCC 2 cut(s) 80, 145
BspCNI CTCAG 1 cut(s) 226
BsrI ACTGG 1 cut(s) 38
BssECI CCNNGG 2 cut(s) 133, 183
BssMI GATC 1 cut(s) 73
BssT1I CCWWGG 2 cut(s) 133, 183
BstDEI CTNAG 2 cut(s) 5, 234
BstDSI CCRYGG 1 cut(s) 133
BstENI CCTNNNNNAGG 1 cut(s) 94
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
BstSFI CTRYAG 1 cut(s) 91
BsuRI GGCC 2 cut(s) 80, 145
BtgI CCRYGG 1 cut(s) 133
CviAII CATG 1 cut(s) 134
CviJI RGCY 3 cut(s) 80, 86, 145
CviKI_1 RGCY 3 cut(s) 80, 86, 145
DdeI CTNAG 2 cut(s) 5, 234
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eco130I CCWWGG 2 cut(s) 133, 183
Eco32I GATATC 1 cut(s) 212
EcoNI CCTNNNNNAGG 1 cut(s) 94
EcoRV GATATC 1 cut(s) 212
EcoT14I CCWWGG 2 cut(s) 133, 183
ErhI CCWWGG 2 cut(s) 133, 183
FaeI CATG 1 cut(s) 137
FaiI YATR 4 cut(s) 93, 135, 199, 240
FatI CATG 1 cut(s) 133
FbaI TGATCA 1 cut(s) 73
FspBI CTAG 1 cut(s) 253
GsuI CTGGAG 1 cut(s) 21
HaeIII GGCC 2 cut(s) 80, 145
Hin1II CATG 1 cut(s) 137
HphI GGTGA 2 cut(s) 68, 120
Hpy188III TCNNGA 1 cut(s) 112
HpyAV CCTTC 2 cut(s) 47, 118
HpyCH4V TGCA 1 cut(s) 124
HpyF3I CTNAG 2 cut(s) 5, 234
Hsp92II CATG 1 cut(s) 137
Ksp22I TGATCA 1 cut(s) 73
Kzo9I GATC 1 cut(s) 73
LpnPI CCDG 4 cut(s) 51, 62, 97, 144
MaeI CTAG 1 cut(s) 253
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MluCI AATT 3 cut(s) 30, 45, 166
MnlI CCTC 3 cut(s) 45, 90, 189
MslI CAYNNNNRTG 1 cut(s) 243
Mva1269I GAATGC 2 cut(s) 106, 121
NcoI CCATGG 1 cut(s) 133
NdeII GATC 1 cut(s) 73
NlaIII CATG 1 cut(s) 137
PctI GAATGC 2 cut(s) 106, 121
RseI CAYNNNNRTG 1 cut(s) 243
Sau3AI GATC 1 cut(s) 73
SetI ASST 4 cut(s) 58, 88, 92, 110
SfcI CTRYAG 1 cut(s) 91
SgeI CNNG 9 cut(s) 34, 38, 50, 89, 124, 133, 146, 171, 196
SmiMI CAYNNNNRTG 1 cut(s) 243
Sse9I AATT 3 cut(s) 30, 45, 166
SspMI CTAG 1 cut(s) 253
StyI CCWWGG 2 cut(s) 133, 183
TasI AATT 3 cut(s) 30, 45, 166
XagI CCTNNNNNAGG 1 cut(s) 94
XapI RAATTY 2 cut(s) 30, 166
XspI CTAG 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.