Rmu_co8036800.1_g000001

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8036800.1
OG0000250
Physical Location & Seq
Forward (+)
1 .. 355
355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8036800.1_g000001.1.cds

Sequence Viewer

Length: 317 bp
ggttattattagccatcgattgtgtagcagaaaatgtcaacatcctcagtgattcacagctcgtgatcaatcatgtcaacgaaatttttcaagtcaaggacaaacaactggcggtatacctagggtacgccaagacactactcggcaagttcagtttcttcaacatcacgcaaataccccgtgaaaagctaaagccgactccctggcacgcctggcaacagctcaaccacatcaaagtcccgccgacactagggtggagacccttgaaaagcctagcatcacaaaaactctggcagaaacctacaccatcgaggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 Retrotrans_gag rve

Protein Analysis

104

Amino Acids

11.97

Weight (kDa)

9.87

Isoelectric Point (pI)

39.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000250)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g22373 FvH4_1g22374 FvH4_1g25831 FvH4_1g28031 FvH4_2g11354 FvH4_3g11301 FvH4_3g11302 FvH4_3g14364 FvH4_3g20862 FvH4_4g15482 FvH4_4g15483 FvH4_4g15484 FvH4_5g25502 FvH4_5g37242 FvH4_6g18432 FvH4_6g18433 FvH4_6g20952 FvH4_7g02201 FvH4_7g10991
prunus_persica Prupe.6G166700_v2.0.a1
pyrus_communis pycom01g03860 pycom02g16130 pycom05g08340 pycom07g08280 pycom16g20980 pycom16g25810
rosa_chinensis RchiOBHm_Chr5g0018261
rosa_laevigata RLG00000022447
rosa_multiflora Rmu_co7963284.1_g000001 Rmu_co7968088.1_g000001 Rmu_co8036800.1_g000001 Rmu_co8110294.1_g000001 Rmu_co8291955.1_g000001 Rmu_co8396209.1_g000002 Rmu_co8413879.1_g000001 Rmu_co8464165.1_g000001 Rmu_co8469565.1_g000001 Rmu_co8485695.1_g000003 Rmu_co8486821.1_g000003 Rmu_co8515379.1_g000001 Rmu_sc0000239.1_g000074 Rmu_sc0000327.1_g000028 Rmu_sc0000509.1_g000002 Rmu_sc0000677.1_g000042 Rmu_sc0000756.1_g000032 Rmu_sc0000782.1_g000013 Rmu_sc0001144.1_g000044 Rmu_sc0001861.1_g000003 Rmu_sc0002371.1_g000016 Rmu_sc0002451.1_g000061 Rmu_sc0002764.1_g000053 Rmu_sc0002868.1_g000041 Rmu_sc0003735.1_g000026 Rmu_sc0004654.1_g000006 Rmu_sc0005038.1_g000020 Rmu_sc0005236.1_g000001 Rmu_sc0006725.1_g000004 Rmu_sc0010685.1_g000001 Rmu_sc0011973.1_g000010 Rmu_sc0012722.1_g000001 Rmu_sc0015925.1_g000002 Rmu_sc0017188.1_g000001 Rmu_sc0021806.1_g000001 Rmu_sc0033125.1_g000001 Rmu_sc0038204.1_g000001 Rmu_ssc0000215.1_g000038
rosa_roxburghii Rroxscaffold_1G00001020 Rroxscaffold_1G00027520 Rroxscaffold_3G00228140 Rroxscaffold_4G00320850 Rroxscaffold_4G00321830 Rroxscaffold_4G00321840 Rroxscaffold_4G00332450 Rroxscaffold_5G00344360 Rroxscaffold_5G00365190 Rroxscaffold_5G00377320 Rroxscaffold_5G00377330 Rroxscaffold_7G00183080 Rroxscaffold_7G00184560 Rroxscaffold_7G00216010
rosa_rugosa Rorug02G0381000
rosa_samantha Rh1AG155000 Rh1AG167000 Rh2AG095000 Rh3BG335500 Rh4AG082900 Rh4CG090200 Rh5CG445500 Rh7DG403200
rosa_wichuraiana Rw0G001000 Rw0G014090 Rw0G019800 Rw0G020130 Rw0G020350 Rw1G002560 Rw1G013310 Rw1G014300 Rw1G014670 Rw1G016610 Rw1G021110 Rw1G024950 Rw1G028180 Rw2G020910 Rw2G024170 Rw2G024770 Rw2G029990 Rw2G031960 Rw2G034100 Rw3G013950 Rw3G028980 Rw3G029200 Rw4G004150 Rw4G008130 Rw4G012200 Rw4G018750 Rw4G019330 Rw4G021010 Rw4G022120 Rw4G030810 Rw5G015840 Rw5G015850 Rw5G022430 Rw5G022480 Rw5G026870 Rw5G033550 Rw6G009170 Rw6G010190 Rw6G011570 Rw6G018280 Rw6G023730 Rw7G025660 Rw7G029890 Rw7G031130 Rw7G042550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 116
AciI CCGC 2 cut(s) 112, 241
AcsI RAATTY 1 cut(s) 83
AfaI GTAC 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 250
AgsI TTSAA 3 cut(s) 91, 162, 267
AjnI CCWGG 2 cut(s) 202, 211
AleI CACNNNNGTG 1 cut(s) 252
AluBI AGCT 3 cut(s) 60, 189, 222
AluI AGCT 3 cut(s) 60, 189, 222
Alw26I GTCTC 1 cut(s) 252
ApoI RAATTY 1 cut(s) 83
Asp700I GAANNNNTTC 1 cut(s) 86
AspA2I CCTAGG 1 cut(s) 120
AvrII CCTAGG 1 cut(s) 120
BauI CACGAG 1 cut(s) 61
BccI CCATC 2 cut(s) 22, 315
BciT130I CCWGG 2 cut(s) 204, 213
BclI TGATCA 1 cut(s) 65
BcoDI GTCTC 1 cut(s) 252
BfaI CTAG 3 cut(s) 121, 250, 274
BlnI CCTAGG 1 cut(s) 120
Bme1390I CCNGG 2 cut(s) 204, 213
BmrFI CCNGG 2 cut(s) 204, 213
BmsI GCATC 1 cut(s) 286
Bsa29I ATCGAT 1 cut(s) 17
BsaI GGTCTC 1 cut(s) 252
BsaJI CCNNGG 2 cut(s) 120, 202
Bsc4I CCNNNNNNNGG 1 cut(s) 250
Bse1I ACTGG 1 cut(s) 113
BseBI CCWGG 2 cut(s) 204, 213
BseCI ATCGAT 1 cut(s) 17
BseDI CCNNGG 2 cut(s) 120, 202
BseGI GGATG 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 250
BseMII CTCAG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 113
BshVI ATCGAT 1 cut(s) 17
BslFI GGGAC 1 cut(s) 223
BslI CCNNNNNNNGG 1 cut(s) 250
BsmAI GTCTC 1 cut(s) 252
BsmFI GGGAC 1 cut(s) 223
Bso31I GGTCTC 1 cut(s) 252
Bsp143I GATC 1 cut(s) 65
BspACI CCGC 2 cut(s) 112, 241
BspCNI CTCAG 1 cut(s) 59
BspDI ATCGAT 1 cut(s) 17
BspTNI GGTCTC 1 cut(s) 252
BsrI ACTGG 1 cut(s) 113
BssECI CCNNGG 2 cut(s) 120, 202
BssMI GATC 1 cut(s) 65
BssNAI GTATAC 1 cut(s) 117
BssSI CACGAG 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 120
Bst1107I GTATAC 1 cut(s) 117
Bst2BI CACGAG 1 cut(s) 61
Bst2UI CCWGG 2 cut(s) 204, 213
BstC8I GCNNGC 1 cut(s) 209
BstDEI CTNAG 1 cut(s) 46
BstF5I GGATG 1 cut(s) 41
BstKTI GATC 1 cut(s) 68
BstMAI GTCTC 1 cut(s) 252
BstMBI GATC 1 cut(s) 65
BstMWI GCNNNNNNNGC 1 cut(s) 213
BstNI CCWGG 2 cut(s) 204, 213
BstSCI CCNGG 2 cut(s) 202, 211
BstZ17I GTATAC 1 cut(s) 117
Bsu15I ATCGAT 1 cut(s) 17
BsuTUI ATCGAT 1 cut(s) 17
BtsCI GGATG 1 cut(s) 41
BtsIMutI CAGTG 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 209
ClaI ATCGAT 1 cut(s) 17
Csp6I GTAC 1 cut(s) 126
CviAII CATG 1 cut(s) 73
CviJI RGCY 6 cut(s) 13, 60, 189, 195, 222, 272
CviKI_1 RGCY 6 cut(s) 13, 60, 189, 195, 222, 272
CviQI GTAC 1 cut(s) 126
DdeI CTNAG 1 cut(s) 46
DpnI GATC 1 cut(s) 67
DpnII GATC 1 cut(s) 65
Eco130I CCWWGG 1 cut(s) 120
Eco31I GGTCTC 1 cut(s) 252
EcoRII CCWGG 2 cut(s) 202, 211
EcoT14I CCWWGG 1 cut(s) 120
ErhI CCWWGG 1 cut(s) 120
FaeI CATG 1 cut(s) 76
FaiI YATR 2 cut(s) 74, 117
FaqI GGGAC 1 cut(s) 223
FatI CATG 1 cut(s) 72
FauI CCCGC 1 cut(s) 248
FbaI TGATCA 1 cut(s) 65
FblI GTMKAC 1 cut(s) 116
FokI GGATG 1 cut(s) 28
FspBI CTAG 3 cut(s) 121, 250, 274
Hin1II CATG 1 cut(s) 76
HincII GTYRAC 2 cut(s) 39, 78
HindII GTYRAC 2 cut(s) 39, 78
HinfI GANTC 2 cut(s) 52, 198
Hpy166II GTNNAC 3 cut(s) 39, 78, 117
Hpy188III TCNNGA 1 cut(s) 63
Hpy8I GTNNAC 3 cut(s) 39, 78, 117
HpyF10VI GCNNNNNNNGC 1 cut(s) 213
HpyF3I CTNAG 1 cut(s) 46
Hsp92II CATG 1 cut(s) 76
Ksp22I TGATCA 1 cut(s) 65
Kzo9I GATC 1 cut(s) 65
LpnPI CCDG 6 cut(s) 94, 189, 198, 216, 225, 276
LweI GCATC 1 cut(s) 286
MaeI CTAG 3 cut(s) 121, 250, 274
MalI GATC 1 cut(s) 67
MboI GATC 1 cut(s) 65
MboII GAAGA 1 cut(s) 150
MluCI AATT 1 cut(s) 83
MlyI GAGTC 1 cut(s) 192
MnlI CCTC 2 cut(s) 55, 305
MroXI GAANNNNTTC 1 cut(s) 86
MslI CAYNNNNRTG 1 cut(s) 252
MspR9I CCNGG 2 cut(s) 204, 213
MvaI CCWGG 2 cut(s) 204, 213
MwoI GCNNNNNNNGC 1 cut(s) 213
NdeII GATC 1 cut(s) 65
NlaIII CATG 1 cut(s) 76
NmeAIII GCCGAG 1 cut(s) 122
OliI CACNNNNGTG 1 cut(s) 252
PdmI GAANNNNTTC 1 cut(s) 86
PfeI GAWTC 1 cut(s) 52
PleI GAGTC 1 cut(s) 192
PpsI GAGTC 1 cut(s) 192
Psp6I CCWGG 2 cut(s) 202, 211
PspGI CCWGG 2 cut(s) 202, 211
RsaI GTAC 1 cut(s) 127
RsaNI GTAC 1 cut(s) 126
RseI CAYNNNNRTG 1 cut(s) 252
Sau3AI GATC 1 cut(s) 65
SchI GAGTC 1 cut(s) 192
ScrFI CCNGG 2 cut(s) 204, 213
SetI ASST 6 cut(s) 62, 122, 191, 224, 303, 316
SfaNI GCATC 1 cut(s) 286
SmiMI CAYNNNNRTG 1 cut(s) 252
Sse9I AATT 1 cut(s) 83
SsiI CCGC 2 cut(s) 112, 241
SspMI CTAG 3 cut(s) 121, 250, 274
StyD4I CCNGG 2 cut(s) 202, 211
StyI CCWWGG 1 cut(s) 120
TaqI TCGA 2 cut(s) 17, 310
TasI AATT 1 cut(s) 83
TfiI GAWTC 1 cut(s) 52
TscAI CASTG 1 cut(s) 54
TspRI CASTG 1 cut(s) 54
XapI RAATTY 1 cut(s) 83
XmaJI CCTAGG 1 cut(s) 120
XmiI GTMKAC 1 cut(s) 116
XmnI GAANNNNTTC 1 cut(s) 86
XspI CTAG 3 cut(s) 121, 250, 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.