Rmu_sc0017772.1_g000004

AAA domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017772.1
OG0000279
Physical Location & Seq
Reverse (-)
26461 .. 32114
5654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017772.1_g000004.1.cds

Sequence Viewer

Length: 2631 bp
atggtcagagctttgggtttgctcaagtctattaaaactttattgcatactactggtgttgctaatgaagggttggagtcagtcttcaaagattccaaagttccacgaagcattgttggttcccttacgcagttgagaacaaagtgtacaaacacgctaaagtcccttccaatagaattctctgttcctattaatgaatattcattaaagaacttctgcctagaaaatgcttgcttaatattctgtactgcatcaacttcttccaaattgcatgatgtaacaggaacaagaccattggaattgttggtcattgatgaagctgctcagcttaaagaatgtgaatcagcaattcctttacaactatctggtctccgccatgctatccttgtaggagatgagaggcaactccctgccatggttaaaagcgagattgcagtaagtgctgattttggaagaagtttgtttggaaggctggcaaagttggggcacaagaagcacctactcaatgtccagtacaggatgcatccatccatcagtttatttccaaaaagggagttctacgacaaccagatagtagatggtccaaatgtcaaagaaagaagctatgggaggtgcttcctcaagggaaaaatgtaccaatcctattccttcataaatgtagccgatggaaaagaagaatttgatcacagatctagtctgaaaaatatggtggaggttgctgcagtctctgggatagtagcaagcctttataaagaatttattggaacaaagaagaaagttagtattggggtcatatcaccatacaaggctcaagtttatgcaattcaagagatactcagaaaatatactgaaacttctgatactggattctccgtaagtgtgagatctgttgatgggttccaaggtggtgaagaagatgtgataattatatctactgtccgatgtaatgggaacgggtcagttggtttcttgttaaaccagcaaagagtaaatgttgccttaacacgtgcaaggtattgcctttggatattggggaatgcgtcaactttgattgctagtgactctgtttggaagaagctagtccttgatgccaagaaacggaactgtttttataatgctgatgaggacagcaacttggctcaggctattacagctgccctgttggagcttgaccaacttcattctctgcttaatgtcgactctctgctgttcaaaaatgctatatggaaggataaaggaactatagtgtatgatgggacttctgctcaactgttagagaagtataaaatcaaagggaacttgaatctcatttggactgtcgatattctccaggagaatgcacattacatccaagttatgaagttttgggatattttgccattttctcatataccagaactagccaagcgtcttgacattgtttttgggaattttacagtggacaagatgaaccgctgccttcacaaatgcattgacatggatactgttgttccaatgagatggccggtggttttcagcaattaccctatagctgatcatgaggagttcctttcaaaaccattgtcttctttcagtataacaactaatcgagaaacagcaacttcaacatatggggagacagcaaaagcaaaaaaaacaattatctcttcaaaaagcaatgtcaatgaaaaagaaagacgactatggaaaataaagggtgaaggagtggaggatttcaacacttgccttgaagctaacccttcggagttcttgccaaaaccattatcatcactaagtctagcagataagccagaagcatctacttccactgacatggagacagggaaagcagtaaaacgatttatcgcttcgaaaagcaatgtcaatcgaaaagaaagattgttatggaaaataaagggtgaaggagtgaaggatttcagcacttgcgttgaagctaaccctgtggagttcttgtcaaaaccattttcatctccaagtctatcagataagccagaagcatctacttccactgacatggagacagcgaaagcagtaaaaccaattatcgcttcgaaaagtaatgtcaatcaaaaagaaaaattgttatggaaaataaagggtgaagaagaagtgaaggatttcagcacttgcgttgaagctatccctgtggagttcttgtcaaaaccattttcatcaccaagtctatcagataagccagaagcatctacttccactgatatggagacggcaaaagcagtaaaaccaattatcccttcgaaaagcaatgccaatcaaaaagaaagattgttatggaaaataaagggtgaagaacgagtgaaggatttcagcacttgccttgaagctaaccctgtggagttcttgtcaaaaccattatcatcactaagtctagcagataagccagaagcatctacttccactgacatggagacagcgaaagcagtaaaaccaattatcgctttgaaaagcaatgtcaatcaaaaagaaaaattgttatggaaaataaagggtcaagaagaagtgaaggatttcagcacttgcattgaagctatccctgtggagttcttgctaaaaccattatcatccctaagtctagcagataagccagaagcatctacttccactgacatgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA_11 AAA_12

Protein Analysis

876

Amino Acids

97.42

Weight (kDa)

8.69

Isoelectric Point (pI)

30.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000279)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G65810 AT1G65810 AT1G65810 AT4G05540 AT5G37140 AT5G37150 AT5G37160 AT5G37165 AT5G52090
fragaria_vesca FvH4_1g27541 FvH4_1g27542 FvH4_2g08960 FvH4_2g08960 FvH4_2g08960 FvH4_2g08960 FvH4_3g00170 FvH4_3g00170 FvH4_3g00170 FvH4_5g05930 FvH4_5g05930
malus_domestica MD08G1077700.v1.1 MD08G1077900.v1.1 MD08G1078000.v1.1 MD08G1078100.v1.1 MD08G1078300.v1.1 MD09G1057800.v1.1 MD09G1281400.v1.1 MD11G1222900.v1.1 MD14G1146400.v1.1
prunus_persica Prupe.1G201900_v2.0.a1 Prupe.1G201900_v2.0.a1 Prupe.1G201900_v2.0.a1 Prupe.1G201900_v2.0.a1 Prupe.1G201900_v2.0.a1 Prupe.1G202100_v2.0.a1 Prupe.1G202500_v2.0.a1 Prupe.1G202500_v2.0.a1 Prupe.1G202500_v2.0.a1 Prupe.3G013100_v2.0.a1
pyrus_communis pycom09g18900 pycom09g18910 pycom13g26720 pycom13g26730 pycom13g26760 pycom13g26770
rosa_chinensis RchiOBHm_Chr3g0488001 RchiOBHm_Chr3g0488011 RchiOBHm_Chr3g0488031 RchiOBHm_Chr3g0488061 RchiOBHm_Chr3g0488111 RchiOBHm_Chr3g0488201 RchiOBHm_Chr3g0488211 RchiOBHm_Chr3g0488221 RchiOBHm_Chr3g0488321 RchiOBHm_Chr3g0488431 RchiOBHm_Chr6g0264601 RchiOBHm_Chr6g0264641
rosa_laevigata RLG00000014240 RLG00000014241 RLG00000022910 RLG00000022949 RLG00000030376
rosa_multiflora Rmu_co8075388.1_g000001 Rmu_co8424869.1_g000001 Rmu_co8427783.1_g000001 Rmu_sc0000546.1_g000002 Rmu_sc0000546.1_g000015 Rmu_sc0011052.1_g000014 Rmu_sc0017772.1_g000004
rosa_roxburghii Rroxscaffold_175G00431980 Rroxscaffold_175G00431990 Rroxscaffold_1G00034600 Rroxscaffold_6G00394230 Rroxscaffold_6G00394270 Rroxscaffold_6G00394280 Rroxscaffold_6G00394350 Rroxscaffold_7G00203240 Rroxscaffold_7G00203270 Rroxscaffold_7G00203280 Rroxscaffold_7G00203300 Rroxscaffold_7G00205740
rosa_rugosa Rorug03G0238000 Rorug03G0238100 Rorug03G0238100 Rorug03G0238500 Rorug05G0155400 Rorug05G0356000 Rorug05G0463000 Rorug06G0015200 Rorug06G0015300 Rorug06G0015400 Rorug06G0015500 Rorug06G0015500
rosa_samantha Rh1DG088100 Rh2AG244800 Rh2BG187500 Rh2CG247300 Rh3BG322700 Rh3BG322800 Rh3BG323100 Rh3BG323900 Rh3BG324000 Rh3BG324300 Rh3CG321300 Rh3CG321400 Rh3CG321500 Rh3DG319400 Rh3DG319900 Rh3DG320100 Rh3DG320200 Rh6AG133700 Rh6AG133800 Rh6AG133900 Rh6CG129300 Rh6CG129800 Rh6CG130200 Rh6DG116500 Rh6DG117200 Rh7DG378000
rosa_wichuraiana Rw2G014710 Rw3G025340 Rw3G025350 Rw3G025360 Rw5G020630 Rw6G011590 Rw6G011600 Rw7G041380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 750, 1113
AccI GTMKAC 1 cut(s) 1197
AciI CCGC 2 cut(s) 373, 1453
AcoI YGGCCR 1 cut(s) 1502
AcsI RAATTY 4 cut(s) 176, 677, 755, 1429
AcvI CACGTG 1 cut(s) 1007
AfaI GTAC 4 cut(s) 148, 247, 515, 635
AfiI CCNNNNNNNGG 2 cut(s) 415, 1098
AflIII ACRYGT 2 cut(s) 1004, 2625
AjnI CCWGG 1 cut(s) 1329
AjuI GAANNNNNNNTTGG 4 cut(s) 2032, 2064, 2236, 2268
Alw26I GTCTC 7 cut(s) 374, 730, 1610, 1811, 2012, 2216, 2420
AlwNI CAGNNNCTG 1 cut(s) 728
AoxI GGCC 1 cut(s) 1502
ApeKI GCWGC 4 cut(s) 320, 719, 1154, 1455
ApoI RAATTY 4 cut(s) 176, 677, 755, 1429
ArsI GACNNNNNNTTYG 4 cut(s) 1406, 1438, 1547, 1579
AseI ATTAAT 1 cut(s) 192
Asp700I GAANNNNTTC 4 cut(s) 1913, 2117, 2321, 2525
AspS9I GGNCC 1 cut(s) 581
AsuHPI GGTGA 7 cut(s) 789, 920, 1709, 1910, 2111, 2166, 2315
AsuII TTCGAA 3 cut(s) 1850, 2051, 2255
AvaII GGWCC 1 cut(s) 581
BaeGI GKGCMC 1 cut(s) 489
BaeI ACNNNNGTAYC 2 cut(s) 1473, 1506
BbrPI CACGTG 1 cut(s) 1007
BbsI GAAGAC 2 cut(s) 76, 1557
BbvI GCAGC 4 cut(s) 307, 706, 1141, 1442
BccI CCATC 7 cut(s) 535, 539, 572, 659, 887, 1247, 1494
BceAI ACGGC 1 cut(s) 2241
BciT130I CCWGG 1 cut(s) 1331
BciVI GTATCC 1 cut(s) 1474
BclI TGATCA 2 cut(s) 682, 1534
BcoDI GTCTC 7 cut(s) 374, 730, 1610, 1811, 2012, 2216, 2420
BfaI CTAG 8 cut(s) 221, 693, 1056, 1079, 1400, 1778, 2387, 2591
BfmI CTRYAG 3 cut(s) 720, 1242, 1527
BfuI GTATCC 1 cut(s) 1474
BglII AGATCT 2 cut(s) 689, 884
BisI GCNGC 4 cut(s) 321, 720, 1155, 1456
BlpI GCTNAGC 1 cut(s) 324
BlsI GCNGC 4 cut(s) 322, 721, 1156, 1457
Bme1390I CCNGG 1 cut(s) 1331
Bme18I GGWCC 1 cut(s) 581
BmgT120I GGNCC 1 cut(s) 581
BmiI GGNNCC 2 cut(s) 121, 899
BmrFI CCNGG 1 cut(s) 1331
BmsI GCATC 9 cut(s) 260, 510, 532, 1078, 1805, 2006, 2210, 2414, 2618
BpiI GAAGAC 2 cut(s) 76, 1557
BpmI CTGGAG 1 cut(s) 1313
Bpu10I CCTNAGC 1 cut(s) 1140
Bpu1102I GCTNAGC 1 cut(s) 324
Bpu14I TTCGAA 3 cut(s) 1850, 2051, 2255
BpuEI CTTGAG 3 cut(s) 8, 605, 795
BsaAI YACGTR 1 cut(s) 1007
BsaI GGTCTC 1 cut(s) 374
BsaJI CCNNGG 2 cut(s) 414, 901
BsaXI ACNNNNNCTCC 6 cut(s) 1937, 1967, 2141, 2171, 2345, 2375
Bsc4I CCNNNNNNNGG 2 cut(s) 415, 1098
Bse118I RCCGGY 1 cut(s) 1504
Bse1I ACTGG 3 cut(s) 58, 511, 868
Bse3DI GCAATG 4 cut(s) 1663, 1864, 2269, 2473
BseBI CCWGG 1 cut(s) 1331
BseDI CCNNGG 2 cut(s) 414, 901
BseGI GGATG 5 cut(s) 523, 525, 527, 1347, 2579
BseLI CCNNNNNNNGG 2 cut(s) 415, 1098
BseMI GCAATG 4 cut(s) 1663, 1864, 2269, 2473
BseMII CTCAG 3 cut(s) 338, 850, 1154
BseNI ACTGG 3 cut(s) 58, 511, 868
BseRI GAGGAG 1 cut(s) 1556
BseSI GKGCMC 1 cut(s) 489
BseXI GCAGC 4 cut(s) 307, 706, 1141, 1442
BshFI GGCC 1 cut(s) 1504
BsiSI CCGG 1 cut(s) 1505
BslFI GGGAC 2 cut(s) 148, 1270
BslI CCNNNNNNNGG 2 cut(s) 415, 1098
BsmAI GTCTC 7 cut(s) 374, 730, 1610, 1811, 2012, 2216, 2420
BsmBI CGTCTC 1 cut(s) 2216
BsmFI GGGAC 2 cut(s) 148, 1270
BsmI GAATGC 2 cut(s) 1042, 1342
BsnI GGCC 1 cut(s) 1504
Bso31I GGTCTC 1 cut(s) 374
Bsp119I TTCGAA 3 cut(s) 1850, 2051, 2255
Bsp1286I GDGCHC 1 cut(s) 489
Bsp1407I TGTACA 1 cut(s) 146
Bsp143I GATC 4 cut(s) 682, 689, 884, 1534
Bsp1720I GCTNAGC 1 cut(s) 324
Bsp19I CCATGG 1 cut(s) 414
BspACI CCGC 2 cut(s) 373, 1453
BspANI GGCC 1 cut(s) 1504
BspCNI CTCAG 3 cut(s) 337, 849, 1153
BspHI TCATGA 1 cut(s) 1537
BspLI GGNNCC 2 cut(s) 121, 899
BspMAI CTGCAG 1 cut(s) 724
BspT104I TTCGAA 3 cut(s) 1850, 2051, 2255
BspTNI GGTCTC 1 cut(s) 374
BsrDI GCAATG 4 cut(s) 1663, 1864, 2269, 2473
BsrFI RCCGGY 1 cut(s) 1504
BsrGI TGTACA 1 cut(s) 146
BsrI ACTGG 3 cut(s) 58, 511, 868
BssAI RCCGGY 1 cut(s) 1504
BssECI CCNNGG 2 cut(s) 414, 901
BssMI GATC 4 cut(s) 682, 689, 884, 1534
BssT1I CCWWGG 2 cut(s) 414, 901
Bst2UI CCWGG 1 cut(s) 1331
Bst4CI ACNGT 6 cut(s) 937, 1106, 1272, 1318, 1438, 1486
Bst6I CTCTTC 1 cut(s) 1651
BstAPI GCANNNNNTGC 1 cut(s) 440
BstAUI TGTACA 1 cut(s) 146
BstBAI YACGTR 1 cut(s) 1007
BstBI TTCGAA 3 cut(s) 1850, 2051, 2255
BstC8I GCNNGC 3 cut(s) 232, 474, 742
BstDEI CTNAG 6 cut(s) 324, 836, 1140, 1772, 2381, 2585
BstDSI CCRYGG 1 cut(s) 414
BstF5I GGATG 5 cut(s) 523, 525, 527, 1347, 2579
BstKTI GATC 4 cut(s) 685, 692, 887, 1537
BstMAI GTCTC 7 cut(s) 374, 730, 1610, 1811, 2012, 2216, 2420
BstMBI GATC 4 cut(s) 682, 689, 884, 1534
BstMWI GCNNNNNNNGC 3 cut(s) 440, 493, 1151
BstNI CCWGG 1 cut(s) 1331
BstNSI RCATGY 1 cut(s) 2629
BstSCI CCNGG 1 cut(s) 1329
BstSFI CTRYAG 3 cut(s) 720, 1242, 1527
BstSLI GKGCMC 1 cut(s) 489
BstV1I GCAGC 4 cut(s) 307, 706, 1141, 1442
BstV2I GAAGAC 2 cut(s) 76, 1557
BstX2I RGATCY 2 cut(s) 689, 884
BstXI CCANNNNNNTGG 5 cut(s) 1500, 1813, 2014, 2218, 2422
BstYI RGATCY 2 cut(s) 689, 884
BsuI GTATCC 1 cut(s) 1474
BsuRI GGCC 1 cut(s) 1504
BtgI CCRYGG 1 cut(s) 414
BtsCI GGATG 5 cut(s) 523, 525, 527, 1347, 2579
BtsIMutI CAGTG 6 cut(s) 1443, 1806, 2007, 2211, 2415, 2619
Cac8I GCNNGC 3 cut(s) 232, 474, 742
CaiI CAGNNNCTG 1 cut(s) 728
CciI TCATGA 1 cut(s) 1537
Cfr10I RCCGGY 1 cut(s) 1504
Cfr13I GGNCC 1 cut(s) 581
CseI GACGC 2 cut(s) 1029, 1397
Csp6I GTAC 4 cut(s) 147, 246, 514, 634
CviAII CATG 9 cut(s) 272, 377, 415, 1477, 1538, 1813, 2014, 2422, 2626
CviQI GTAC 4 cut(s) 147, 246, 514, 634
DdeI CTNAG 6 cut(s) 324, 836, 1140, 1772, 2381, 2585
DpnI GATC 4 cut(s) 684, 691, 886, 1536
DpnII GATC 4 cut(s) 682, 689, 884, 1534
EaeI YGGCCR 1 cut(s) 1502
Eam1104I CTCTTC 1 cut(s) 1651
EarI CTCTTC 1 cut(s) 1651
EciI GGCGGA 1 cut(s) 362
Eco130I CCWWGG 2 cut(s) 414, 901
Eco31I GGTCTC 1 cut(s) 374
Eco47I GGWCC 1 cut(s) 581
Eco72I CACGTG 1 cut(s) 1007
EcoRI GAATTC 1 cut(s) 176
EcoRII CCWGG 1 cut(s) 1329
EcoT14I CCWWGG 2 cut(s) 414, 901
EcoT22I ATGCAT 2 cut(s) 525, 1472
ErhI CCWWGG 2 cut(s) 414, 901
Esp3I CGTCTC 1 cut(s) 2216
FaeI CATG 9 cut(s) 275, 380, 418, 1480, 1541, 1816, 2017, 2425, 2629
FaqI GGGAC 2 cut(s) 148, 1270
FatI CATG 9 cut(s) 271, 376, 414, 1476, 1537, 1812, 2013, 2421, 2625
FauNDI CATATG 1 cut(s) 1609
FbaI TGATCA 2 cut(s) 682, 1534
FblI GTMKAC 1 cut(s) 1197
Fnu4HI GCNGC 4 cut(s) 321, 720, 1155, 1456
FokI GGATG 5 cut(s) 510, 514, 532, 1334, 2566
Fsp4HI GCNGC 4 cut(s) 321, 720, 1155, 1456
FspBI CTAG 8 cut(s) 221, 693, 1056, 1079, 1400, 1778, 2387, 2591
GluI GCNGC 4 cut(s) 321, 720, 1155, 1456
GsuI CTGGAG 1 cut(s) 1313
HaeIII GGCC 1 cut(s) 1504
HapII CCGG 1 cut(s) 1505
HgaI GACGC 2 cut(s) 1029, 1397
Hin1II CATG 9 cut(s) 275, 380, 418, 1480, 1541, 1816, 2017, 2425, 2629
HincII GTYRAC 2 cut(s) 1044, 1198
HindII GTYRAC 2 cut(s) 1044, 1198
HinfI GANTC 7 cut(s) 77, 92, 341, 867, 1061, 1199, 1303
HpaII CCGG 1 cut(s) 1505
HphI GGTGA 7 cut(s) 789, 920, 1709, 1910, 2111, 2166, 2315
Hpy166II GTNNAC 4 cut(s) 147, 1044, 1198, 1441
Hpy188I TCNGA 8 cut(s) 8, 699, 839, 859, 941, 1744, 1984, 2188
Hpy188III TCNNGA 5 cut(s) 827, 1412, 1538, 1589, 2510
Hpy8I GTNNAC 4 cut(s) 147, 1044, 1198, 1441
HpyCH4III ACNGT 6 cut(s) 937, 1106, 1272, 1318, 1438, 1486
HpyCH4IV ACGT 1 cut(s) 1006
HpyF10VI GCNNNNNNNGC 3 cut(s) 440, 493, 1151
HpyF3I CTNAG 6 cut(s) 324, 836, 1140, 1772, 2381, 2585
HpySE526I ACGT 1 cut(s) 1006
Hsp92II CATG 9 cut(s) 275, 380, 418, 1480, 1541, 1816, 2017, 2425, 2629
Ksp22I TGATCA 2 cut(s) 682, 1534
Kzo9I GATC 4 cut(s) 682, 689, 884, 1534
LmnI GCTCC 1 cut(s) 1165
Lsp1109I GCAGC 4 cut(s) 307, 706, 1141, 1442
LweI GCATC 9 cut(s) 260, 510, 532, 1078, 1805, 2006, 2210, 2414, 2618
MaeI CTAG 8 cut(s) 221, 693, 1056, 1079, 1400, 1778, 2387, 2591
MaeII ACGT 1 cut(s) 1006
MaeIII GTNAC 2 cut(s) 277, 1058
MalI GATC 4 cut(s) 684, 691, 886, 1536
MboI GATC 4 cut(s) 682, 689, 884, 1534
MflI RGATCY 2 cut(s) 689, 884
MhlI GDGCHC 1 cut(s) 489
MlyI GAGTC 3 cut(s) 86, 1055, 1193
MmeI TCCRAC 2 cut(s) 54, 1143
MnlI CCTC 7 cut(s) 393, 603, 629, 706, 1117, 1534, 1702
Mph1103I ATGCAT 2 cut(s) 525, 1472
MroXI GAANNNNTTC 4 cut(s) 1913, 2117, 2321, 2525
MseI TTAA 9 cut(s) 33, 192, 206, 236, 330, 420, 974, 1001, 1191
MslI CAYNNNNRTG 6 cut(s) 1475, 1811, 2012, 2216, 2420, 2624
MspA1I CMGCKG 2 cut(s) 1154, 1455
MspI CCGG 1 cut(s) 1505
MspR9I CCNGG 1 cut(s) 1331
Mva1269I GAATGC 2 cut(s) 1042, 1342
MvaI CCWGG 1 cut(s) 1331
MwoI GCNNNNNNNGC 3 cut(s) 440, 493, 1151
NcoI CCATGG 1 cut(s) 414
NdeI CATATG 1 cut(s) 1609
NdeII GATC 4 cut(s) 682, 689, 884, 1534
NlaIII CATG 9 cut(s) 275, 380, 418, 1480, 1541, 1816, 2017, 2425, 2629
NlaIV GGNNCC 2 cut(s) 121, 899
NmuCI GTSAC 1 cut(s) 1058
NsiI ATGCAT 2 cut(s) 525, 1472
NspI RCATGY 1 cut(s) 2629
NspV TTCGAA 3 cut(s) 1850, 2051, 2255
PagI TCATGA 1 cut(s) 1537
PciI ACATGT 1 cut(s) 2625
PctI GAATGC 2 cut(s) 1042, 1342
PdmI GAANNNNTTC 4 cut(s) 1913, 2117, 2321, 2525
PfeI GAWTC 4 cut(s) 92, 341, 867, 1303
PfoI TCCNGGA 1 cut(s) 1329
PkrI GCNGC 4 cut(s) 322, 721, 1156, 1457
PleI GAGTC 3 cut(s) 85, 1055, 1193
PmaCI CACGTG 1 cut(s) 1007
PmlI CACGTG 1 cut(s) 1007
PpsI GAGTC 3 cut(s) 85, 1055, 1193
Ppu21I YACGTR 1 cut(s) 1007
PscI ACATGT 1 cut(s) 2625
PshBI ATTAAT 1 cut(s) 192
PsiI TTATAA 2 cut(s) 750, 1113
Psp6I CCWGG 1 cut(s) 1329
PspCI CACGTG 1 cut(s) 1007
PspGI CCWGG 1 cut(s) 1329
PspN4I GGNNCC 2 cut(s) 121, 899
PspPI GGNCC 1 cut(s) 581
PsrI GAACNNNNNNTAC 2 cut(s) 130, 162
PstI CTGCAG 1 cut(s) 724
PstNI CAGNNNCTG 1 cut(s) 728
PsuI RGATCY 2 cut(s) 689, 884
PvuII CAGCTG 1 cut(s) 1154
RsaI GTAC 4 cut(s) 148, 247, 515, 635
RsaNI GTAC 4 cut(s) 147, 246, 514, 634
RseI CAYNNNNRTG 6 cut(s) 1475, 1811, 2012, 2216, 2420, 2624
SalI GTCGAC 1 cut(s) 1196
SaqAI TTAA 9 cut(s) 33, 192, 206, 236, 330, 420, 974, 1001, 1191
SatI GCNGC 4 cut(s) 321, 720, 1155, 1456
Sau3AI GATC 4 cut(s) 682, 689, 884, 1534
Sau96I GGNCC 1 cut(s) 581
SchI GAGTC 3 cut(s) 86, 1055, 1193
ScrFI CCNGG 1 cut(s) 1331
SduI GDGCHC 1 cut(s) 489
SfaNI GCATC 9 cut(s) 260, 510, 532, 1078, 1805, 2006, 2210, 2414, 2618
SfcI CTRYAG 3 cut(s) 720, 1242, 1527
SfuI TTCGAA 3 cut(s) 1850, 2051, 2255
SinI GGWCC 1 cut(s) 581
SmiMI CAYNNNNRTG 6 cut(s) 1475, 1811, 2012, 2216, 2420, 2624
SmlI CTYRAG 3 cut(s) 23, 620, 810
SmoI CTYRAG 3 cut(s) 23, 620, 810
SsiI CCGC 2 cut(s) 373, 1453
SspI AATATT 2 cut(s) 200, 240
SspMI CTAG 8 cut(s) 221, 693, 1056, 1079, 1400, 1778, 2387, 2591
StyD4I CCNGG 1 cut(s) 1329
StyI CCWWGG 2 cut(s) 414, 901
TaaI ACNGT 6 cut(s) 937, 1106, 1272, 1318, 1438, 1486
TaiI ACGT 1 cut(s) 1009
TaqI TCGA 7 cut(s) 1197, 1320, 1588, 1850, 1867, 2051, 2255
TatI WGTACW 3 cut(s) 146, 245, 513
TfiI GAWTC 4 cut(s) 92, 341, 867, 1303
Tru1I TTAA 9 cut(s) 33, 192, 206, 236, 330, 420, 974, 1001, 1191
Tru9I TTAA 9 cut(s) 33, 192, 206, 236, 330, 420, 974, 1001, 1191
TscAI CASTG 6 cut(s) 1443, 1813, 2014, 2218, 2422, 2626
TseFI GTSAC 1 cut(s) 1058
TseI GCWGC 4 cut(s) 320, 719, 1154, 1455
Tsp45I GTSAC 1 cut(s) 1058
TspGWI ACGGA 2 cut(s) 862, 1114
TspRI CASTG 6 cut(s) 1443, 1813, 2014, 2218, 2422, 2626
VpaK11BI GGWCC 1 cut(s) 581
VspI ATTAAT 1 cut(s) 192
XapI RAATTY 4 cut(s) 176, 677, 755, 1429
XceI RCATGY 1 cut(s) 2629
XcmI CCANNNNNNNNNTGG 1 cut(s) 575
XmiI GTMKAC 1 cut(s) 1197
XmnI GAANNNNTTC 4 cut(s) 1913, 2117, 2321, 2525
XspI CTAG 8 cut(s) 221, 693, 1056, 1079, 1400, 1778, 2387, 2591
Zsp2I ATGCAT 2 cut(s) 525, 1472
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.