Rroxscaffold_2G00113240

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
38755020 .. 38758423
3404 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00113240.1

Sequence Viewer

Length: 222 bp
ATGGGACGATCCTTTCCTAATGATAAGCTTCTGCTTGTTCTAGCACTAAGGAGAAGGGGACATGTTGTTGCTATTACTGGTGATGGCAATAATGATGCTCCTGCACTACATGAGGCCGACATTGGTCTTGCTATGGGTATTCAAGGTTCTGAGGTTGCCAAAGAGAGTTCTGATATCATTATCTTGGATGACAATTTTGCTTCAGTTGTGAAGGAGGATTAG

Protein Analysis

73

Amino Acids

7.76

Weight (kDa)

4.74

Isoelectric Point (pI)

44.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000174)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G22910
fragaria_vesca FvH4_4g01640 FvH4_4g01670 FvH4_4g01690 FvH4_4g01690 FvH4_4g01692 FvH4_4g06940
malus_domestica MD04G1223800.v1.1 MD12G1240600.v1.1 MD13G1201600.v1.1 MD15G1425600.v1.1 MD15G1425900.v1.1 MD15G1426000.v1.1 MD15G1426200.v1.1 MD15G1429900.v1.1 MD16G1186200.v1.1 MD16G1201500.v1.1 MD16G1201800.v1.1 MD16G1245900.v1.1
prunus_persica Prupe.1G023100_v2.0.a1 Prupe.1G023200_v2.0.a1 Prupe.1G023300_v2.0.a1 Prupe.1G023400_v2.0.a1 Prupe.2G086400_v2.0.a1
pyrus_communis pycom03g20400 pycom04g03220 pycom04g03230 pycom04g19720 pycom13g17500 pycom14g13160 pycom15g37720
rosa_chinensis RchiOBHm_Chr4g0385871 RchiOBHm_Chr4g0388251 RchiOBHm_Chr4g0388261 RchiOBHm_Chr4g0388291 RchiOBHm_Chr4g0388301 RchiOBHm_Chr4g0388321 RchiOBHm_Chr4g0388331 RchiOBHm_Chr4g0388341 RchiOBHm_Chr4g0388491 RchiOBHm_Chr4g0388501 RchiOBHm_Chr4g0388521 RchiOBHm_Chr4g0388541 RchiOBHm_Chr4g0388581 RchiOBHm_Chr4g0388591 RchiOBHm_Chr5g0038901 RchiOBHm_Chr5g0039001 RchiOBHm_Chr6g0264011
rosa_laevigata RLG00000003378 RLG00000003379 RLG00000010036 RLG00000010037 RLG00000010039 RLG00000010041 RLG00000010042 RLG00000010043 RLG00000010049 RLG00000010050 RLG00000010051 RLG00000010052 RLG00000010054 RLG00000010055 RLG00000010062 RLG00000010064 RLG00000010065 RLG00000010066 RLG00000010067 RLG00000010069 RLG00000010070 RLG00000010071 RLG00000014295 RLG00000033880
rosa_multiflora Rmu_co8110336.1_g000001 Rmu_sc0000533.1_g000070 Rmu_sc0000533.1_g000082 Rmu_sc0000753.1_g000013 Rmu_sc0000753.1_g000024 Rmu_sc0000753.1_g000027 Rmu_sc0000753.1_g000029 Rmu_sc0000753.1_g000030 Rmu_sc0000753.1_g000037 Rmu_sc0000753.1_g000048 Rmu_sc0001241.1_g000003 Rmu_sc0001241.1_g000020 Rmu_sc0001241.1_g000034 Rmu_sc0001241.1_g000045 Rmu_sc0001949.1_g000015 Rmu_sc0001949.1_g000020 Rmu_sc0001949.1_g000023 Rmu_sc0001949.1_g000028 Rmu_sc0002357.1_g000005 Rmu_sc0002357.1_g000017 Rmu_sc0002357.1_g000032 Rmu_sc0002357.1_g000035 Rmu_sc0002357.1_g000043 Rmu_sc0002694.1_g000002 Rmu_sc0004459.1_g000018 Rmu_sc0004773.1_g000011 Rmu_sc0006339.1_g000009 Rmu_sc0008728.1_g000008 Rmu_sc0012275.1_g000001
rosa_roxburghii Rroxscaffold_1G00042120 Rroxscaffold_2G00113240 Rroxscaffold_2G00131810 Rroxscaffold_4G00314870 Rroxscaffold_5G00334730 Rroxscaffold_5G00334750 Rroxscaffold_5G00334770 Rroxscaffold_5G00334790 Rroxscaffold_5G00334850 Rroxscaffold_5G00334970 Rroxscaffold_5G00335010 Rroxscaffold_5G00335030 Rroxscaffold_5G00335040
rosa_rugosa Rorug03G0301800 Rorug03G0316600 Rorug03G0316600 Rorug03G0316700 Rorug03G0316700 Rorug03G0316800.1 Rorug03G0317300 Rorug03G0317400 Rorug03G0318000 Rorug03G0318500 Rorug03G0318600 Rorug03G0318700 Rorug03G0319000 Rorug03G0319000 Rorug03G0319100 Rorug05G0175000 Rorug05G0175500
rosa_samantha Rh4CG007500 Rh4CG022300 Rh4CG022400 Rh4CG022600 Rh4CG022700 Rh4CG023500 Rh4CG023700 Rh4CG023900 Rh4CG024000 Rh4CG024600 Rh4CG025200 Rh4CG025300 Rh4CG025700 Rh4CG025800 Rh4CG025900 Rh4CG026000 Rh4CG026100 Rh4CG026200 Rh5BG266500 Rh6AG128500 Rh6DG110800
rosa_wichuraiana Rw0G009370 Rw4G000360 Rw4G001430 Rw4G001440 Rw4G001460 Rw4G001470 Rw4G001490 Rw4G001500 Rw4G001520 Rw4G001620 Rw4G001630 Rw4G001650 Rw4G001670 Rw5G024450 Rw5G024490 Rw6G011090 Rw6G011110

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 186
AflIII ACRYGT 1 cut(s) 61
AgsI TTSAA 1 cut(s) 143
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
AlwI GGATC 1 cut(s) 3
AoxI GGCC 1 cut(s) 114
AsuHPI GGTGA 1 cut(s) 92
BccI CCATC 1 cut(s) 77
BfaI CTAG 1 cut(s) 41
BmsI GCATC 1 cut(s) 85
BoxI GACNNNNGTC 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 82
BseGI GGATG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 82
BsgI GTGCAG 1 cut(s) 87
BshFI GGCC 1 cut(s) 116
BslFI GGGAC 2 cut(s) 18, 72
BsmFI GGGAC 2 cut(s) 18, 72
BsnI GGCC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 8
BspANI GGCC 1 cut(s) 116
BspCNI CTCAG 1 cut(s) 142
BspPI GGATC 1 cut(s) 3
BsrI ACTGG 1 cut(s) 82
BssMI GATC 1 cut(s) 8
BstDEI CTNAG 2 cut(s) 47, 150
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 1 cut(s) 11
BstMBI GATC 1 cut(s) 8
BstNSI RCATGY 1 cut(s) 65
BstPAI GACNNNNGTC 1 cut(s) 123
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 1 cut(s) 193
CviAII CATG 2 cut(s) 62, 110
CviJI RGCY 2 cut(s) 28, 116
CviKI_1 RGCY 2 cut(s) 28, 116
DdeI CTNAG 2 cut(s) 47, 150
DpnI GATC 1 cut(s) 10
DpnII GATC 1 cut(s) 8
Eco32I GATATC 1 cut(s) 175
Eco57I CTGAAG 1 cut(s) 186
EcoRV GATATC 1 cut(s) 175
FaeI CATG 2 cut(s) 65, 113
FaiI YATR 3 cut(s) 63, 111, 134
FaqI GGGAC 2 cut(s) 18, 72
FatI CATG 2 cut(s) 61, 109
FokI GGATG 1 cut(s) 200
FspBI CTAG 1 cut(s) 41
HaeIII GGCC 1 cut(s) 116
Hin1II CATG 2 cut(s) 65, 113
HindIII AAGCTT 1 cut(s) 26
HphI GGTGA 1 cut(s) 92
Hpy188I TCNGA 2 cut(s) 151, 172
HpyAV CCTTC 2 cut(s) 48, 205
HpyCH4V TGCA 1 cut(s) 104
HpyF3I CTNAG 2 cut(s) 47, 150
Hsp92II CATG 2 cut(s) 65, 113
Kzo9I GATC 1 cut(s) 8
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 2 cut(s) 63, 114
LweI GCATC 1 cut(s) 85
MaeI CTAG 1 cut(s) 41
MalI GATC 1 cut(s) 10
MboI GATC 1 cut(s) 8
MluCI AATT 1 cut(s) 193
MnlI CCTC 3 cut(s) 106, 145, 208
NdeII GATC 1 cut(s) 8
NlaIII CATG 2 cut(s) 65, 113
NspI RCATGY 1 cut(s) 65
PciI ACATGT 1 cut(s) 61
PscI ACATGT 1 cut(s) 61
PshAI GACNNNNGTC 1 cut(s) 123
PsrI GAACNNNNNNTAC 2 cut(s) 130, 162
Sau3AI GATC 1 cut(s) 8
SetI ASST 3 cut(s) 30, 148, 156
SfaNI GCATC 1 cut(s) 85
SgeI CNNG 9 cut(s) 47, 53, 74, 90, 113, 122, 140, 155, 196
Sse9I AATT 1 cut(s) 193
SspMI CTAG 1 cut(s) 41
TasI AATT 1 cut(s) 193
XceI RCATGY 1 cut(s) 65
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.