Rmu_sc0010190.1_g000007

UPF0481 protein At3g47200-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010190.1
OG0000188
Physical Location & Seq
Forward (+)
20883 .. 21260
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010190.1_g000007.1.cds

Sequence Viewer

Length: 378 bp
atgagatcaaagctttctagtcaaaccccattatctcctacaggttgcatcatcaaagttcctgaggtgtgcagaagacgaaaaccagaggcctataaacctgatgtggtctcaatcggacccttgcacagagtaggtaaacaagtccaacccctggaaaatgtgaaacattggtatttacataaccttctctttcattgtagcataagtttgaaagctttgatccaatgcattcttgaatttgagaaacaagctcgcgagttttatgcagaaacacttgatcatcttaaccagaatggcttcatagaaatgatgatacttgatggttgctttctagtttctaatggaactttttcagatcaaagctccggaacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

14.2

Weight (kDa)

8.31

Isoelectric Point (pI)

44.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000188)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g02500 FvH4_4g03110 FvH4_5g11900 FvH4_5g11910 FvH4_5g19510 FvH4_6g53141 FvH4_6g53141 FvH4_6g53143 FvH4_6g53143 FvH4_6g53260 FvH4_6g53260 FvH4_6g53260 FvH4_6g53280
malus_domestica MD00G1110800.v1.1 MD00G1111300.v1.1 MD08G1225300.v1.1 MD08G1225500.v1.1 MD08G1225700.v1.1 MD09G1013500.v1.1 MD09G1013700.v1.1 MD09G1013800.v1.1 MD09G1014000.v1.1
prunus_persica Prupe.1G028300_v2.0.a1 Prupe.1G029300_v2.0.a1 Prupe.1G029400_v2.0.a1 Prupe.1G029800_v2.0.a1 Prupe.1G165900_v2.0.a1 Prupe.3G303500_v2.0.a1 Prupe.5G029100_v2.0.a1 Prupe.5G029100_v2.0.a1 Prupe.5G029200_v2.0.a1 Prupe.7G037400_v2.0.a1
pyrus_communis pycom08g19660 pycom08g19690 pycom08g19710 pycom08g19720 pycom111g01160 pycom111g01170 pycom17g01140
rosa_chinensis RchiOBHm_Chr2g0111831 RchiOBHm_Chr2g0138211 RchiOBHm_Chr2g0163091 RchiOBHm_Chr2g0175051 RchiOBHm_Chr2g0175141 RchiOBHm_Chr2g0175171 RchiOBHm_Chr2g0175191 RchiOBHm_Chr3g0483151 RchiOBHm_Chr3g0483161 RchiOBHm_Chr3g0483171 RchiOBHm_Chr4g0389941 RchiOBHm_Chr4g0411021 RchiOBHm_Chr4g0411031 RchiOBHm_Chr4g0411041 RchiOBHm_Chr5g0041861 RchiOBHm_Chr5g0058261 RchiOBHm_Chr5g0065661 RchiOBHm_Chr5g0070431 RchiOBHm_Chr7g0185221 RchiOBHm_Chr7g0185581 RchiOBHm_Chr7g0185591 RchiOBHm_Chr7g0185611 RchiOBHm_Chr7g0185641
rosa_laevigata RLG00000004895 RLG00000004896 RLG00000004897 RLG00000008379 RLG00000021370 RLG00000022309 RLG00000034099 RLG00000035811 RLG00000036132 RLG00000036450
rosa_multiflora Rmu_co8229993.1_g000001 Rmu_co8360165.1_g000001 Rmu_co8461695.1_g000001 Rmu_sc0000213.1_g000004 Rmu_sc0000235.1_g000066 Rmu_sc0000367.1_g000060 Rmu_sc0000861.1_g000057 Rmu_sc0000861.1_g000068 Rmu_sc0001244.1_g000011 Rmu_sc0001244.1_g000013 Rmu_sc0001323.1_g000018 Rmu_sc0002180.1_g000032 Rmu_sc0002280.1_g000009 Rmu_sc0003226.1_g000095 Rmu_sc0003226.1_g000096 Rmu_sc0003555.1_g000010 Rmu_sc0003555.1_g000018 Rmu_sc0003920.1_g000011 Rmu_sc0003984.1_g000012 Rmu_sc0004336.1_g000026 Rmu_sc0006027.1_g000005 Rmu_sc0006570.1_g000004 Rmu_sc0007961.1_g000010 Rmu_sc0008747.1_g000001 Rmu_sc0008834.1_g000005 Rmu_sc0010190.1_g000004 Rmu_sc0010190.1_g000007 Rmu_sc0010190.1_g000008 Rmu_sc0010642.1_g000012 Rmu_sc0011497.1_g000002
rosa_roxburghii Rroxscaffold_1G00010770 Rroxscaffold_1G00010780 Rroxscaffold_1G00011860 Rroxscaffold_1G00015470 Rroxscaffold_1G00038670 Rroxscaffold_2G00077520 Rroxscaffold_2G00077550 Rroxscaffold_2G00106420 Rroxscaffold_3G00268750 Rroxscaffold_3G00268770 Rroxscaffold_3G00268780 Rroxscaffold_3G00268790 Rroxscaffold_3G00269130 Rroxscaffold_5G00336020 Rroxscaffold_5G00343150 Rroxscaffold_5G00355700
rosa_rugosa Rorug02G0500300 Rorug02G0581200 Rorug03G0204700 Rorug03G0327300 Rorug05G0196100 Rorug05G0196400 Rorug05G0405900 Rorug05G0406000 Rorug06G0467000 Rorug06G0467000 Rorug06G0470200 Rorug06G0470200 Rorug07G0180500
rosa_samantha Rh2AG566700 Rh2AG661900 Rh2AG663200 Rh3CG286400 Rh3CG286500 Rh3CG366100 Rh4DG024200 Rh4DG076600 Rh4DG160000 Rh4DG160100 Rh5BG286800 Rh5DG295500 Rh5DG461000 Rh7DG072100 Rh7DG075500
rosa_wichuraiana Rw1G002310 Rw1G015820 Rw2G046920 Rw2G054280 Rw3G022880 Rw3G029170 Rw4G002330 Rw4G013670 Rw5G026420 Rw5G026440 Rw5G040490 Rw5G042130 Rw7G006300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 154
AccII CGCG 1 cut(s) 258
AccIII TCCGGA 1 cut(s) 368
AclWI GGATC 1 cut(s) 217
AcsI RAATTY 1 cut(s) 239
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 2 cut(s) 214, 239
AjnI CCWGG 1 cut(s) 153
AluBI AGCT 4 cut(s) 13, 218, 254, 366
AluI AGCT 4 cut(s) 13, 218, 254, 366
Alw26I GTCTC 1 cut(s) 115
AlwI GGATC 1 cut(s) 217
Aor13HI TCCGGA 1 cut(s) 368
AoxI GGCC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 239
Asp700I GAANNNNTTC 2 cut(s) 299, 352
AspS9I GGNCC 1 cut(s) 119
AvaII GGWCC 1 cut(s) 119
AxyI CCTNAGG 1 cut(s) 63
BbsI GAAGAC 1 cut(s) 82
BccI CCATC 1 cut(s) 317
BcgI CGANNNNNNTGC 2 cut(s) 248, 282
BciT130I CCWGG 1 cut(s) 155
BclI TGATCA 1 cut(s) 280
BcoDI GTCTC 1 cut(s) 115
BfaI CTAG 2 cut(s) 18, 335
BfmI CTRYAG 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 155
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 155
BmsI GCATC 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 82
BsaI GGTCTC 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 153
BsaWI WCCGGW 1 cut(s) 368
Bsc4I CCNNNNNNNGG 1 cut(s) 154
Bse21I CCTNAGG 1 cut(s) 63
BseAI TCCGGA 1 cut(s) 368
BseBI CCWGG 1 cut(s) 155
BseDI CCNNGG 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 154
BseMII CTCAG 1 cut(s) 54
BsgI GTGCAG 1 cut(s) 91
Bsh1236I CGCG 1 cut(s) 258
BshFI GGCC 1 cut(s) 92
BsiSI CCGG 1 cut(s) 369
BslI CCNNNNNNNGG 1 cut(s) 154
BsmAI GTCTC 1 cut(s) 115
BsmI GAATGC 1 cut(s) 231
BsnI GGCC 1 cut(s) 92
Bso31I GGTCTC 1 cut(s) 115
Bsp13I TCCGGA 1 cut(s) 368
Bsp143I GATC 4 cut(s) 5, 222, 280, 358
Bsp68I TCGCGA 1 cut(s) 258
BspANI GGCC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 55
BspEI TCCGGA 1 cut(s) 368
BspFNI CGCG 1 cut(s) 258
BspLI GGNNCC 1 cut(s) 121
BspPI GGATC 1 cut(s) 217
BspTNI GGTCTC 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 4 cut(s) 5, 222, 280, 358
Bst2UI CCWGG 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 256
BstDEI CTNAG 1 cut(s) 63
BstFNI CGCG 1 cut(s) 258
BstKTI GATC 4 cut(s) 8, 225, 283, 361
BstMAI GTCTC 1 cut(s) 115
BstMBI GATC 4 cut(s) 5, 222, 280, 358
BstNI CCWGG 1 cut(s) 155
BstSCI CCNGG 1 cut(s) 153
BstSFI CTRYAG 1 cut(s) 39
BstUI CGCG 1 cut(s) 258
BstV2I GAAGAC 1 cut(s) 82
Bsu36I CCTNAGG 1 cut(s) 63
BsuRI GGCC 1 cut(s) 92
BtuMI TCGCGA 1 cut(s) 258
Cac8I GCNNGC 1 cut(s) 256
Cfr13I GGNCC 1 cut(s) 119
CviJI RGCY 6 cut(s) 13, 92, 218, 254, 300, 366
CviKI_1 RGCY 6 cut(s) 13, 92, 218, 254, 300, 366
DdeI CTNAG 1 cut(s) 63
DpnI GATC 4 cut(s) 7, 224, 282, 360
DpnII GATC 4 cut(s) 5, 222, 280, 358
Eco147I AGGCCT 1 cut(s) 92
Eco31I GGTCTC 1 cut(s) 115
Eco47I GGWCC 1 cut(s) 119
Eco81I CCTNAGG 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 153
EcoT22I ATGCAT 1 cut(s) 233
FaiI YATR 5 cut(s) 96, 183, 206, 267, 305
FbaI TGATCA 1 cut(s) 280
FspBI CTAG 2 cut(s) 18, 335
HaeIII GGCC 1 cut(s) 92
HapII CCGG 1 cut(s) 369
HindIII AAGCTT 2 cut(s) 11, 216
HpaII CCGG 1 cut(s) 369
Hpy166II GTNNAC 1 cut(s) 140
Hpy188I TCNGA 2 cut(s) 119, 358
Hpy188III TCNNGA 4 cut(s) 62, 236, 257, 369
Hpy8I GTNNAC 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 197
HpyCH4V TGCA 5 cut(s) 48, 72, 127, 231, 269
HpyF3I CTNAG 1 cut(s) 63
Kpn2I TCCGGA 1 cut(s) 368
Ksp22I TGATCA 1 cut(s) 280
Kzo9I GATC 4 cut(s) 5, 222, 280, 358
LmnI GCTCC 1 cut(s) 371
LpnPI CCDG 7 cut(s) 27, 75, 99, 114, 140, 167, 305
LweI GCATC 1 cut(s) 57
MaeI CTAG 2 cut(s) 18, 335
MalI GATC 4 cut(s) 7, 224, 282, 360
MboI GATC 4 cut(s) 5, 222, 280, 358
MboII GAAGA 1 cut(s) 87
MluCI AATT 1 cut(s) 239
MmeI TCCRAC 1 cut(s) 172
MnlI CCTC 2 cut(s) 58, 82
Mph1103I ATGCAT 1 cut(s) 233
MroI TCCGGA 1 cut(s) 368
MroXI GAANNNNTTC 2 cut(s) 299, 352
MseI TTAA 1 cut(s) 288
MslI CAYNNNNRTG 1 cut(s) 308
MspI CCGG 1 cut(s) 369
MspR9I CCNGG 1 cut(s) 155
Mva1269I GAATGC 1 cut(s) 231
MvaI CCWGG 1 cut(s) 155
MvnI CGCG 1 cut(s) 258
NdeII GATC 4 cut(s) 5, 222, 280, 358
NlaIV GGNNCC 1 cut(s) 121
NruI TCGCGA 1 cut(s) 258
NsiI ATGCAT 1 cut(s) 233
PceI AGGCCT 1 cut(s) 92
PctI GAATGC 1 cut(s) 231
PdmI GAANNNNTTC 2 cut(s) 299, 352
PflMI CCANNNNNTGG 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 153
PspGI CCWGG 1 cut(s) 153
PspN4I GGNNCC 1 cut(s) 121
PspPI GGNCC 1 cut(s) 119
RruI TCGCGA 1 cut(s) 258
RseI CAYNNNNRTG 1 cut(s) 308
SaqAI TTAA 1 cut(s) 288
Sau3AI GATC 4 cut(s) 5, 222, 280, 358
Sau96I GGNCC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 155
SetI ASST 9 cut(s) 15, 46, 69, 103, 139, 189, 220, 256, 368
SfaNI GCATC 1 cut(s) 57
SfcI CTRYAG 1 cut(s) 39
SinI GGWCC 1 cut(s) 119
SmiMI CAYNNNNRTG 1 cut(s) 308
Sse9I AATT 1 cut(s) 239
SseBI AGGCCT 1 cut(s) 92
SspMI CTAG 2 cut(s) 18, 335
StuI AGGCCT 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 153
TasI AATT 1 cut(s) 239
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TspDTI ATGAA 2 cut(s) 185, 292
Van91I CCANNNNNTGG 1 cut(s) 154
VpaK11BI GGWCC 1 cut(s) 119
XapI RAATTY 1 cut(s) 239
XmnI GAANNNNTTC 2 cut(s) 299, 352
XspI CTAG 2 cut(s) 18, 335
Zsp2I ATGCAT 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.