Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007102.1

Orthogroup ID

OG0000314

Physical Location & Seq

Genomic Coordinates Reverse (-)

24350 .. 25620

Gene Structure 1271 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007102.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1125 bp

atggccaatgttgccaccaatggcgacactacgacaagagaggctttcgttgcgaagcctattccagtgggagcgatctccgaggtaaggttcgcgatcatcatggagaatattgaaaatcatcgcaagaagatagccgctgattttgacaatgaaaccgcaaagacagatcagctcatacgcgaactggacgagcgtatcgcccaacggactgaggataccaagcgacaaaagaaagtcatggaggccatcacaaaccaaaacaagcaaatctcatcggagttcgcgaccttgcgcagagaaggttccagcttggttactcaagtcagttcgcatcaaagtgaattggaaagtcaaaaatctgcacgcaaggaggtcgtttctacaactaacttgcctataggtggtaatcaacctacaggtctcgttgttgaatcacagccttacatagaggctgcacttggagatgatggtccacaaaattattcttctgacaagaaaattgtctctgaacagatagctgctttctccaccgatcaagccaaatacgtgggttctagtagcctagctgtgattaagtatggtccagacgaccaaatccgagtttaccaaaaaaaaaggcctctagaagaaaattgtcaacaaagatgtggccctgctactactggacgtcttcatgaccaagagggtcaggagtatggtccacttaattaccaattaaggcatgggccacttgattatcaattacgttttggtctagaaaattcaatctgtggctttattaatcaattcaacttgaagatcttcatatatgtttcaaggccagcaagtggttttgaaatttttaaagaaggatttggtgactctaaatatgatctcgatgcagagccaatatatgatgagtatgatgataattataatttaattattggttccaaaactcacaagcaggagttcaagttctttgaagctcttgatatggagaattcagaccaacaagtggtcaaatacaaaagccaacctgcagtggctaattctggagacagcatgttctatgatatggtagttggcgacaaagccgatcttgggacattattatctccaaaattgcaattgaagatctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004652 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006139 GO:0006276 GO:0006378 GO:0006396 GO:0006397 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0010467 GO:0016070 GO:0016071 GO:0016740 GO:0016772 GO:0016779 GO:0031123 GO:0031124 GO:0034641 GO:0043170 GO:0043412 GO:0043631 GO:0044237 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0070566 GO:0071704 GO:0090304 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PolyA_pol PolyA_pol_RNAbd

Protein Analysis

374

Amino Acids

41.94

Weight (kDa)

5.16

Isoelectric Point (pI)

38.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000314)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g02272 FvH4_1g22661 FvH4_2g10242 FvH4_2g34051 FvH4_3g19221 FvH4_3g29651 FvH4_3g30891 FvH4_4g11061 FvH4_5g09250 FvH4_5g15302 FvH4_5g15303 FvH4_5g15304 FvH4_5g28521 FvH4_6g23591 FvH4_7g05710 FvH4_7g19520
pyrus_communis	pycom07g06330
rosa_chinensis	RchiOBHm_Chr5g0027301 RchiOBHm_Chr6g0251451 RchiOBHm_Chr6g0274861
rosa_laevigata	RLG00000007850
rosa_multiflora	Rmu_co8230721.1_g000001 Rmu_sc0000271.1_g000027 Rmu_sc0000303.1_g000024 Rmu_sc0000368.1_g000024 Rmu_sc0000621.1_g000037 Rmu_sc0000693.1_g000081 Rmu_sc0001229.1_g000006 Rmu_sc0001373.1_g000003 Rmu_sc0001459.1_g000001 Rmu_sc0001744.1_g000002 Rmu_sc0001909.1_g000002 Rmu_sc0002053.1_g000012 Rmu_sc0002060.1_g000015 Rmu_sc0002119.1_g000036 Rmu_sc0002177.1_g000007 Rmu_sc0002822.1_g000024 Rmu_sc0002965.1_g000015 Rmu_sc0003363.1_g000051 Rmu_sc0003500.1_g000013 Rmu_sc0004191.1_g000020 Rmu_sc0004904.1_g000032 Rmu_sc0005325.1_g000008 Rmu_sc0005947.1_g000040 Rmu_sc0006475.1_g000001 Rmu_sc0006522.1_g000019 Rmu_sc0007102.1_g000005 Rmu_sc0007810.1_g000003 Rmu_sc0008339.1_g000025 Rmu_sc0008698.1_g000004 Rmu_sc0009313.1_g000006 Rmu_sc0009850.1_g000006 Rmu_sc0010598.1_g000003 Rmu_sc0011162.1_g000002 Rmu_sc0011824.1_g000004 Rmu_sc0011900.1_g000010 Rmu_sc0012291.1_g000006 Rmu_sc0012619.1_g000003 Rmu_sc0014679.1_g000001 Rmu_sc0019053.1_g000001 Rmu_sc0021462.1_g000003 Rmu_sc0024172.1_g000001 Rmu_sc0024173.1_g000001 Rmu_ssc0000052.1_g000016 Rmu_ssc0000392.1_g000010 Rmu_ssc0000421.1_g000062 Rmu_ssc0000479.1_g000006
rosa_roxburghii	Rroxscaffold_153G00436600 Rroxscaffold_1G00008580 Rroxscaffold_1G00016770 Rroxscaffold_1G00029550 Rroxscaffold_1G00036450 Rroxscaffold_1G00040410 Rroxscaffold_1G00047110 Rroxscaffold_1G00060570 Rroxscaffold_2G00081500 Rroxscaffold_2G00081510 Rroxscaffold_2G00086080 Rroxscaffold_2G00099620 Rroxscaffold_2G00099630 Rroxscaffold_2G00099640 Rroxscaffold_2G00109170 Rroxscaffold_2G00127750 Rroxscaffold_2G00128590 Rroxscaffold_2G00130780 Rroxscaffold_2G00131040 Rroxscaffold_2G00143160 Rroxscaffold_3G00229280 Rroxscaffold_3G00229290 Rroxscaffold_3G00229970 Rroxscaffold_3G00242860 Rroxscaffold_3G00242890 Rroxscaffold_3G00242900 Rroxscaffold_3G00248200 Rroxscaffold_4G00284550 Rroxscaffold_4G00288780 Rroxscaffold_4G00298620 Rroxscaffold_4G00298630 Rroxscaffold_4G00312420 Rroxscaffold_4G00320310 Rroxscaffold_4G00322220 Rroxscaffold_4G00323600 Rroxscaffold_4G00331830 Rroxscaffold_4G00332010 Rroxscaffold_4G00332020 Rroxscaffold_5G00344470 Rroxscaffold_5G00345310 Rroxscaffold_5G00356120 Rroxscaffold_5G00368700 Rroxscaffold_5G00379820 Rroxscaffold_5G00382480 Rroxscaffold_6G00395080 Rroxscaffold_6G00405520 Rroxscaffold_6G00428210 Rroxscaffold_7G00193460
rosa_samantha	Rh7CG413200 Rh7DG284900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	918
AatII	GACGTC	1 cut(s)	673
Acc16I	TGCGCA	1 cut(s)	296
Acc36I	ACCTGC	1 cut(s)	1030
AccB7I	CCANNNNNTGG	2 cut(s)	830, 1000
AccII	CGCG	3 cut(s)	95, 183, 287
AciI	CCGC	2 cut(s)	138, 159
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	3 cut(s)	763, 840, 985
AcyI	GRCGYC	1 cut(s)	670
AfiI	CCNNNNNNNGG	5 cut(s)	87, 404, 830, 1000, 1086
AloI	GAACNNNNNNTCC	2 cut(s)	944, 976
AluBI	AGCT	5 cut(s)	175, 312, 521, 569, 971
AluI	AGCT	5 cut(s)	175, 312, 521, 569, 971
Alw26I	GTCTC	3 cut(s)	428, 511, 1035
AoxI	GGCC	6 cut(s)	3, 246, 620, 652, 728, 821
ApeKI	GCWGC	2 cut(s)	455, 521
ApoI	RAATTY	3 cut(s)	763, 840, 985
AseI	ATTAAT	1 cut(s)	783
Asp700I	GAANNNNTTC	1 cut(s)	803
AspLEI	GCGC	1 cut(s)	297
AspS9I	GGNCC	5 cut(s)	473, 584, 653, 701, 728
AsuHPI	GGTGA	1 cut(s)	872
AvaII	GGWCC	3 cut(s)	473, 584, 701
BaeI	ACNNNNGTAYC	2 cut(s)	181, 214
BalI	TGGCCA	1 cut(s)	5
BbsI	GAAGAC	1 cut(s)	665
BbvI	GCAGC	2 cut(s)	442, 508
BccI	CCATC	2 cut(s)	257, 464
BcgI	CGANNNNNNTGC	2 cut(s)	358, 392
BciVI	GTATCC	1 cut(s)	211
BcoDI	GTCTC	3 cut(s)	428, 511, 1035
BfaI	CTAG	5 cut(s)	558, 566, 626, 758, 1123
BfmI	CTRYAG	3 cut(s)	399, 417, 1023
BfuAI	ACCTGC	1 cut(s)	1030
BfuI	GTATCC	1 cut(s)	211
BglII	AGATCT	2 cut(s)	801, 1119
BisI	GCNGC	3 cut(s)	138, 456, 522
BlsI	GCNGC	3 cut(s)	139, 457, 523
Bme18I	GGWCC	3 cut(s)	473, 584, 701
BmgT120I	GGNCC	5 cut(s)	473, 584, 653, 701, 728
BmiI	GGNNCC	2 cut(s)	307, 934
BmsI	GCATC	2 cut(s)	343, 871
BpiI	GAAGAC	1 cut(s)	665
BpmI	CTGGAG	1 cut(s)	1059
BpuEI	CTTGAG	1 cut(s)	306
BsaAI	YACGTR	1 cut(s)	550
BsaHI	GRCGYC	1 cut(s)	670
BsaI	GGTCTC	1 cut(s)	428
BsaJI	CCNNGG	1 cut(s)	81
BsaXI	ACNNNNNCTCC	2 cut(s)	944, 974
Bsc4I	CCNNNNNNNGG	5 cut(s)	87, 404, 830, 1000, 1086
Bse1I	ACTGG	3 cut(s)	65, 192, 670
BseDI	CCNNGG	1 cut(s)	81
BseLI	CCNNNNNNNGG	5 cut(s)	87, 404, 830, 1000, 1086
BseMII	CTCAG	1 cut(s)	204
BseNI	ACTGG	3 cut(s)	65, 192, 670
BseXI	GCAGC	2 cut(s)	442, 508
BsgI	GTGCAG	2 cut(s)	348, 441
Bsh1236I	CGCG	3 cut(s)	95, 183, 287
BshFI	GGCC	6 cut(s)	5, 248, 622, 654, 730, 823
BslFI	GGGAC	1 cut(s)	1102
BslI	CCNNNNNNNGG	5 cut(s)	87, 404, 830, 1000, 1086
BsmAI	GTCTC	3 cut(s)	428, 511, 1035
BsmFI	GGGAC	1 cut(s)	1102
BsnI	GGCC	6 cut(s)	5, 248, 622, 654, 730, 823
Bso31I	GGTCTC	1 cut(s)	428
Bsp143I	GATC	8 cut(s)	75, 96, 169, 535, 801, 874, 1081, 1119
Bsp68I	TCGCGA	2 cut(s)	95, 287
BspACI	CCGC	2 cut(s)	138, 159
BspANI	GGCC	6 cut(s)	5, 248, 622, 654, 730, 823
BspCNI	CTCAG	1 cut(s)	205
BspFNI	CGCG	3 cut(s)	95, 183, 287
BspHI	TCATGA	1 cut(s)	676
BspLI	GGNNCC	2 cut(s)	307, 934
BspMAI	CTGCAG	1 cut(s)	1027
BspMI	ACCTGC	1 cut(s)	1030
BspTNI	GGTCTC	1 cut(s)	428
BsrI	ACTGG	3 cut(s)	65, 192, 670
BssECI	CCNNGG	1 cut(s)	81
BssMI	GATC	8 cut(s)	75, 96, 169, 535, 801, 874, 1081, 1119
BssNI	GRCGYC	1 cut(s)	670
BstACI	GRCGYC	1 cut(s)	670
BstBAI	YACGTR	1 cut(s)	550
BstC8I	GCNNGC	2 cut(s)	367, 825
BstDEI	CTNAG	1 cut(s)	213
BstFNI	CGCG	3 cut(s)	95, 183, 287
BstHHI	GCGC	1 cut(s)	297
BstKTI	GATC	8 cut(s)	78, 99, 172, 538, 804, 877, 1084, 1122
BstMAI	GTCTC	3 cut(s)	428, 511, 1035
BstMBI	GATC	8 cut(s)	75, 96, 169, 535, 801, 874, 1081, 1119
BstMWI	GCNNNNNNNGC	2 cut(s)	11, 50
BstNSI	RCATGY	1 cut(s)	1051
BstSFI	CTRYAG	3 cut(s)	399, 417, 1023
BstUI	CGCG	3 cut(s)	95, 183, 287
BstV1I	GCAGC	2 cut(s)	442, 508
BstV2I	GAAGAC	1 cut(s)	665
BstX2I	RGATCY	2 cut(s)	801, 1119
BstXI	CCANNNNNNTGG	1 cut(s)	550
BstYI	RGATCY	2 cut(s)	801, 1119
BsuI	GTATCC	1 cut(s)	211
BsuRI	GGCC	6 cut(s)	5, 248, 622, 654, 730, 823
BtgZI	GCGATG	1 cut(s)	107
BtsI	GCAGTG	1 cut(s)	1032
BtsIMutI	CAGTG	2 cut(s)	72, 1032
BtuMI	TCGCGA	2 cut(s)	95, 287
BveI	ACCTGC	1 cut(s)	1030
Cac8I	GCNNGC	2 cut(s)	367, 825
CciI	TCATGA	1 cut(s)	676
CfoI	GCGC	1 cut(s)	297
Cfr13I	GGNCC	5 cut(s)	473, 584, 653, 701, 728
CviAII	CATG	5 cut(s)	103, 241, 677, 725, 1048
DdeI	CTNAG	1 cut(s)	213
DpnI	GATC	8 cut(s)	77, 98, 171, 537, 803, 876, 1083, 1121
DpnII	GATC	8 cut(s)	75, 96, 169, 535, 801, 874, 1081, 1119
DraI	TTTAAA	1 cut(s)	847
EaeI	YGGCCR	1 cut(s)	3
Eco147I	AGGCCT	1 cut(s)	622
Eco31I	GGTCTC	1 cut(s)	428
Eco47I	GGWCC	3 cut(s)	473, 584, 701
EcoRI	GAATTC	1 cut(s)	985
FaeI	CATG	5 cut(s)	106, 244, 680, 728, 1051
FalI	AAGNNNNNCTT	4 cut(s)	28, 60, 1068, 1100
FaqI	GGGAC	1 cut(s)	1102
FatI	CATG	5 cut(s)	102, 240, 676, 724, 1047
Fnu4HI	GCNGC	3 cut(s)	138, 456, 522
Fsp4HI	GCNGC	3 cut(s)	138, 456, 522
FspBI	CTAG	5 cut(s)	558, 566, 626, 758, 1123
FspI	TGCGCA	1 cut(s)	296
GlaI	GCGC	1 cut(s)	296
GluI	GCNGC	3 cut(s)	138, 456, 522
GsuI	CTGGAG	1 cut(s)	1059
HaeIII	GGCC	6 cut(s)	5, 248, 622, 654, 730, 823
HhaI	GCGC	1 cut(s)	297
Hin1I	GRCGYC	1 cut(s)	670
Hin1II	CATG	5 cut(s)	106, 244, 680, 728, 1051
Hin6I	GCGC	1 cut(s)	295
HinP1I	GCGC	1 cut(s)	295
HincII	GTYRAC	1 cut(s)	641
HindII	GTYRAC	1 cut(s)	641
HinfI	GANTC	2 cut(s)	434, 863
HphI	GGTGA	1 cut(s)	872
Hpy166II	GTNNAC	4 cut(s)	476, 607, 641, 704
Hpy188I	TCNGA	6 cut(s)	82, 280, 493, 511, 602, 991
Hpy8I	GTNNAC	4 cut(s)	476, 607, 641, 704
HpyAV	CCTTC	2 cut(s)	296, 845
HpyCH4IV	ACGT	3 cut(s)	549, 670, 748
HpyCH4V	TGCA	5 cut(s)	365, 458, 884, 1025, 1111
HpyF10VI	GCNNNNNNNGC	2 cut(s)	11, 50
HpyF3I	CTNAG	1 cut(s)	213
HpySE526I	ACGT	3 cut(s)	549, 670, 748
Hsp92I	GRCGYC	1 cut(s)	670
Hsp92II	CATG	5 cut(s)	106, 244, 680, 728, 1051
HspAI	GCGC	1 cut(s)	295
Kzo9I	GATC	8 cut(s)	75, 96, 169, 535, 801, 874, 1081, 1119
LmnI	GCTCC	1 cut(s)	71
Lsp1109I	GCAGC	2 cut(s)	442, 508
LweI	GCATC	2 cut(s)	343, 871
MaeI	CTAG	5 cut(s)	558, 566, 626, 758, 1123
MaeII	ACGT	3 cut(s)	549, 670, 748
MaeIII	GTNAC	2 cut(s)	316, 860
MalI	GATC	8 cut(s)	77, 98, 171, 537, 803, 876, 1083, 1121
MboI	GATC	8 cut(s)	75, 96, 169, 535, 801, 874, 1081, 1119
MboII	GAAGA	6 cut(s)	142, 480, 641, 665, 796, 811
MfeI	CAATTG	1 cut(s)	1112
MflI	RGATCY	2 cut(s)	801, 1119
MlsI	TGGCCA	1 cut(s)	5
MluNI	TGGCCA	1 cut(s)	5
MlyI	GAGTC	1 cut(s)	857
MnlI	CCTC	8 cut(s)	34, 76, 208, 238, 367, 445, 633, 679
Mox20I	TGGCCA	1 cut(s)	5
MroXI	GAANNNNTTC	1 cut(s)	803
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	6 cut(s)	576, 708, 719, 783, 846, 923
MslI	CAYNNNNRTG	1 cut(s)	339
Msp20I	TGGCCA	1 cut(s)	5
MspA1I	CMGCKG	1 cut(s)	140
MunI	CAATTG	1 cut(s)	1112
MvnI	CGCG	3 cut(s)	95, 183, 287
MwoI	GCNNNNNNNGC	2 cut(s)	11, 50
NdeII	GATC	8 cut(s)	75, 96, 169, 535, 801, 874, 1081, 1119
NlaIII	CATG	5 cut(s)	106, 244, 680, 728, 1051
NlaIV	GGNNCC	2 cut(s)	307, 934
NmuCI	GTSAC	1 cut(s)	860
NruI	TCGCGA	2 cut(s)	95, 287
NsbI	TGCGCA	1 cut(s)	296
NspI	RCATGY	1 cut(s)	1051
PagI	TCATGA	1 cut(s)	676
PceI	AGGCCT	1 cut(s)	622
PcsI	WCGNNNNNNNCGW	1 cut(s)	284
PdmI	GAANNNNTTC	1 cut(s)	803
PfeI	GAWTC	1 cut(s)	434
PflMI	CCANNNNNTGG	2 cut(s)	830, 1000
PkrI	GCNGC	3 cut(s)	139, 457, 523
PleI	GAGTC	1 cut(s)	857
PpsI	GAGTC	1 cut(s)	857
Ppu21I	YACGTR	1 cut(s)	550
PshBI	ATTAAT	1 cut(s)	783
PsiI	TTATAA	1 cut(s)	918
PspN4I	GGNNCC	2 cut(s)	307, 934
PspPI	GGNCC	5 cut(s)	473, 584, 653, 701, 728
PstI	CTGCAG	1 cut(s)	1027
PsuI	RGATCY	2 cut(s)	801, 1119
RruI	TCGCGA	2 cut(s)	95, 287
RseI	CAYNNNNRTG	1 cut(s)	339
SaqAI	TTAA	6 cut(s)	576, 708, 719, 783, 846, 923
SatI	GCNGC	3 cut(s)	138, 456, 522
Sau3AI	GATC	8 cut(s)	75, 96, 169, 535, 801, 874, 1081, 1119
Sau96I	GGNCC	5 cut(s)	473, 584, 653, 701, 728
SchI	GAGTC	1 cut(s)	857
SfaNI	GCATC	2 cut(s)	343, 871
SfcI	CTRYAG	3 cut(s)	399, 417, 1023
SinI	GGWCC	3 cut(s)	473, 584, 701
SmiMI	CAYNNNNRTG	1 cut(s)	339
SmlI	CTYRAG	1 cut(s)	321
SmoI	CTYRAG	1 cut(s)	321
SseBI	AGGCCT	1 cut(s)	622
SsiI	CCGC	2 cut(s)	138, 159
SspI	AATATT	1 cut(s)	112
SspMI	CTAG	5 cut(s)	558, 566, 626, 758, 1123
StuI	AGGCCT	1 cut(s)	622
TaiI	ACGT	3 cut(s)	552, 673, 751
TaqI	TCGA	1 cut(s)	879
TauI	GCSGC	1 cut(s)	140
TfiI	GAWTC	1 cut(s)	434
Tru1I	TTAA	6 cut(s)	576, 708, 719, 783, 846, 923
Tru9I	TTAA	6 cut(s)	576, 708, 719, 783, 846, 923
TscAI	CASTG	2 cut(s)	72, 1032
TseFI	GTSAC	1 cut(s)	860
TseI	GCWGC	2 cut(s)	455, 521
Tsp45I	GTSAC	1 cut(s)	860
TspDTI	ATGAA	3 cut(s)	168, 665, 796
TspGWI	ACGGA	1 cut(s)	223
TspRI	CASTG	2 cut(s)	72, 1032
Van91I	CCANNNNNTGG	2 cut(s)	830, 1000
VpaK11BI	GGWCC	3 cut(s)	473, 584, 701
VspI	ATTAAT	1 cut(s)	783
XapI	RAATTY	3 cut(s)	763, 840, 985
XbaI	TCTAGA	2 cut(s)	625, 757
XceI	RCATGY	1 cut(s)	1051
XcmI	CCANNNNNNNNNTGG	1 cut(s)	722
XmnI	GAANNNNTTC	1 cut(s)	803
XspI	CTAG	5 cut(s)	558, 566, 626, 758, 1123
ZraI	GACGTC	1 cut(s)	671

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.