Rroxscaffold_3G00242900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0000314
Physical Location & Seq
Reverse (-)
35413435 .. 35421988
8554 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00242900.1

Sequence Viewer

Length: 327 bp
ATGAAACTTGTATGGGAGACTCAACTAGCCACGCTACAGCCCCCGTATGATCAACAAGTTGGTCGCAATCTAATGGTAGAAGAAAATGTAAGCTCTTGGGGAGGTGCTGTAAAATCTTTTGAAAAAGCCATAAATGTGAATACGATCATTCAAAAAGGGGTACAAGAAATAGCCACTCAATTTTCTATTTTCAGAGAAGAGATGAAGATGATGAGACATCAAAAAATACCGAAGGAGACAAGCCACCATAACTGCGACCATGACCTCCAAAAAGAAGTATTCATCGATGATCAGATGGAAACTTGGCCACCTATTGTTCTTCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.59

Weight (kDa)

5.49

Isoelectric Point (pI)

37.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000314)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g02272 FvH4_1g22661 FvH4_2g10242 FvH4_2g34051 FvH4_3g19221 FvH4_3g29651 FvH4_3g30891 FvH4_4g11061 FvH4_5g09250 FvH4_5g15302 FvH4_5g15303 FvH4_5g15304 FvH4_5g28521 FvH4_6g23591 FvH4_7g05710 FvH4_7g19520
pyrus_communis pycom07g06330
rosa_chinensis RchiOBHm_Chr5g0027301 RchiOBHm_Chr6g0251451 RchiOBHm_Chr6g0274861
rosa_laevigata RLG00000007850
rosa_multiflora Rmu_co8230721.1_g000001 Rmu_sc0000271.1_g000027 Rmu_sc0000303.1_g000024 Rmu_sc0000368.1_g000024 Rmu_sc0000621.1_g000037 Rmu_sc0000693.1_g000081 Rmu_sc0001229.1_g000006 Rmu_sc0001373.1_g000003 Rmu_sc0001459.1_g000001 Rmu_sc0001744.1_g000002 Rmu_sc0001909.1_g000002 Rmu_sc0002053.1_g000012 Rmu_sc0002060.1_g000015 Rmu_sc0002119.1_g000036 Rmu_sc0002177.1_g000007 Rmu_sc0002822.1_g000024 Rmu_sc0002965.1_g000015 Rmu_sc0003363.1_g000051 Rmu_sc0003500.1_g000013 Rmu_sc0004191.1_g000020 Rmu_sc0004904.1_g000032 Rmu_sc0005325.1_g000008 Rmu_sc0005947.1_g000040 Rmu_sc0006475.1_g000001 Rmu_sc0006522.1_g000019 Rmu_sc0007102.1_g000005 Rmu_sc0007810.1_g000003 Rmu_sc0008339.1_g000025 Rmu_sc0008698.1_g000004 Rmu_sc0009313.1_g000006 Rmu_sc0009850.1_g000006 Rmu_sc0010598.1_g000003 Rmu_sc0011162.1_g000002 Rmu_sc0011824.1_g000004 Rmu_sc0011900.1_g000010 Rmu_sc0012291.1_g000006 Rmu_sc0012619.1_g000003 Rmu_sc0014679.1_g000001 Rmu_sc0019053.1_g000001 Rmu_sc0021462.1_g000003 Rmu_sc0024172.1_g000001 Rmu_sc0024173.1_g000001 Rmu_ssc0000052.1_g000016 Rmu_ssc0000392.1_g000010 Rmu_ssc0000421.1_g000062 Rmu_ssc0000479.1_g000006
rosa_roxburghii Rroxscaffold_153G00436600 Rroxscaffold_1G00008580 Rroxscaffold_1G00016770 Rroxscaffold_1G00029550 Rroxscaffold_1G00036450 Rroxscaffold_1G00040410 Rroxscaffold_1G00047110 Rroxscaffold_1G00060570 Rroxscaffold_2G00081500 Rroxscaffold_2G00081510 Rroxscaffold_2G00086080 Rroxscaffold_2G00099620 Rroxscaffold_2G00099630 Rroxscaffold_2G00099640 Rroxscaffold_2G00109170 Rroxscaffold_2G00127750 Rroxscaffold_2G00128590 Rroxscaffold_2G00130780 Rroxscaffold_2G00131040 Rroxscaffold_2G00143160 Rroxscaffold_3G00229280 Rroxscaffold_3G00229290 Rroxscaffold_3G00229970 Rroxscaffold_3G00242860 Rroxscaffold_3G00242890 Rroxscaffold_3G00242900 Rroxscaffold_3G00248200 Rroxscaffold_4G00284550 Rroxscaffold_4G00288780 Rroxscaffold_4G00298620 Rroxscaffold_4G00298630 Rroxscaffold_4G00312420 Rroxscaffold_4G00320310 Rroxscaffold_4G00322220 Rroxscaffold_4G00323600 Rroxscaffold_4G00331830 Rroxscaffold_4G00332010 Rroxscaffold_4G00332020 Rroxscaffold_5G00344470 Rroxscaffold_5G00345310 Rroxscaffold_5G00356120 Rroxscaffold_5G00368700 Rroxscaffold_5G00379820 Rroxscaffold_5G00382480 Rroxscaffold_6G00395080 Rroxscaffold_6G00405520 Rroxscaffold_6G00428210 Rroxscaffold_7G00193460
rosa_samantha Rh7CG413200 Rh7DG284900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 305
AfaI GTAC 1 cut(s) 162
AgsI TTSAA 2 cut(s) 122, 152
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
Alw26I GTCTC 3 cut(s) 11, 208, 230
AoxI GGCC 1 cut(s) 305
BalI TGGCCA 1 cut(s) 307
BccI CCATC 1 cut(s) 289
BclI TGATCA 2 cut(s) 49, 289
BcoDI GTCTC 3 cut(s) 11, 208, 230
BfaI CTAG 1 cut(s) 26
BfmI CTRYAG 1 cut(s) 35
Bsa29I ATCGAT 1 cut(s) 285
BsaXI ACNNNNNCTCC 2 cut(s) 93, 123
BseCI ATCGAT 1 cut(s) 285
BshFI GGCC 1 cut(s) 307
BshVI ATCGAT 1 cut(s) 285
BsmAI GTCTC 3 cut(s) 11, 208, 230
BsnI GGCC 1 cut(s) 307
Bsp143I GATC 3 cut(s) 49, 144, 289
BspANI GGCC 1 cut(s) 307
BspDI ATCGAT 1 cut(s) 285
BssMI GATC 3 cut(s) 49, 144, 289
Bst6I CTCTTC 1 cut(s) 192
BstKTI GATC 3 cut(s) 52, 147, 292
BstMAI GTCTC 3 cut(s) 11, 208, 230
BstMBI GATC 3 cut(s) 49, 144, 289
BstSFI CTRYAG 1 cut(s) 35
Bsu15I ATCGAT 1 cut(s) 285
BsuRI GGCC 1 cut(s) 307
BsuTUI ATCGAT 1 cut(s) 285
ClaI ATCGAT 1 cut(s) 285
Csp6I GTAC 1 cut(s) 161
CviAII CATG 1 cut(s) 260
CviJI RGCY 7 cut(s) 29, 40, 93, 128, 173, 243, 307
CviKI_1 RGCY 7 cut(s) 29, 40, 93, 128, 173, 243, 307
CviQI GTAC 1 cut(s) 161
DpnI GATC 3 cut(s) 51, 146, 291
DpnII GATC 3 cut(s) 49, 144, 289
EaeI YGGCCR 1 cut(s) 305
Eam1104I CTCTTC 1 cut(s) 192
EarI CTCTTC 1 cut(s) 192
FaeI CATG 1 cut(s) 263
FaiI YATR 5 cut(s) 13, 48, 131, 249, 261
FatI CATG 1 cut(s) 259
FbaI TGATCA 2 cut(s) 49, 289
FspBI CTAG 1 cut(s) 26
HaeIII GGCC 1 cut(s) 307
Hin1II CATG 1 cut(s) 263
HinfI GANTC 1 cut(s) 19
Hpy188I TCNGA 2 cut(s) 194, 294
HpyAV CCTTC 1 cut(s) 226
Hsp92II CATG 1 cut(s) 263
Ksp22I TGATCA 2 cut(s) 49, 289
Kzo9I GATC 3 cut(s) 49, 144, 289
MaeI CTAG 1 cut(s) 26
MalI GATC 3 cut(s) 51, 146, 291
MboI GATC 3 cut(s) 49, 144, 289
MboII GAAGA 4 cut(s) 92, 209, 217, 311
MlsI TGGCCA 1 cut(s) 307
MluCI AATT 1 cut(s) 179
MluNI TGGCCA 1 cut(s) 307
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 2 cut(s) 95, 275
Mox20I TGGCCA 1 cut(s) 307
MscI TGGCCA 1 cut(s) 307
MslI CAYNNNNRTG 1 cut(s) 134
Msp20I TGGCCA 1 cut(s) 307
NdeII GATC 3 cut(s) 49, 144, 289
NlaIII CATG 1 cut(s) 263
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
RsaI GTAC 1 cut(s) 162
RsaNI GTAC 1 cut(s) 161
RseI CAYNNNNRTG 1 cut(s) 134
Sau3AI GATC 3 cut(s) 49, 144, 289
SchI GAGTC 1 cut(s) 13
SetI ASST 4 cut(s) 95, 106, 267, 313
SfcI CTRYAG 1 cut(s) 35
SmiMI CAYNNNNRTG 1 cut(s) 134
Sse9I AATT 1 cut(s) 179
SspMI CTAG 1 cut(s) 26
TaqI TCGA 1 cut(s) 285
TasI AATT 1 cut(s) 179
TspDTI ATGAA 3 cut(s) 17, 218, 271
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.