Rmu_sc0008955.1_g000021

F-box kelch-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008955.1
Physical Location & Seq
Reverse (-)
79350 .. 80339
990 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008955.1_g000021.1.cds

Sequence Viewer

Length: 855 bp
atggaggaggaggagctgaactttgacctccctgaagatataattctgcagattctgtgtaggttgccagtcgagtctttgattcggttcagttgcgtatcgaaacggtggcatagtttaataacttctgacccacaatttggaaaaactcacctcaaactagcatctgagcagagacgtatcactaggagactcattctctccgtattcccttttgttggagatgattattcagtcacgaatctcatcttcccatccgaggagcattgcataattaatatactgggttcgtgcaacgggttgatagttctaggtaattcttataaaggctggtctatttggaacccatcaactaggttcttccgcaaaattcctgctccagacttttcatcagtaacgaaaaaatctagaacaattgaaccagatagatatggttttggttatgtctcatccactgatgactacaaacttgttttagcagtccacattggttctgatgactctggttctgcacaggatgttaaaatcttcatattctcagtgagagctaactcttggaaaatcagtgtgttggtgccaatttcggcatcaatgagtcaacggagtcctgtgccttgccttggtcgttcacctcttgtgactgaaggtatggcctcgggcttccttcacctgatcctgggcctccaagctaccttgtttggtgagactgattgtctcgtctcagatttccttcacctggtgttgggcttcctccacctaatgttgggtttcaagctcctttcttgggtggagctgatggcctcacgtcgggcttcctccacctcgtgttgggcttctaagctccttgttgggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

284

Amino Acids

31.74

Weight (kDa)

7.63

Isoelectric Point (pI)

58.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000139)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g08100 FvH4_1g08100 FvH4_3g41771 FvH4_3g42301 FvH4_3g42302 FvH4_3g42303 FvH4_3g42304 FvH4_3g42321 FvH4_3g42360 FvH4_3g42420 FvH4_3g42450 FvH4_3g42450 FvH4_3g42450 FvH4_3g42450 FvH4_3g42450 FvH4_3g42450 FvH4_3g42460 FvH4_3g42470 FvH4_3g42490 FvH4_3g42581 FvH4_3g42582 FvH4_5g30990 FvH4_5g30990 FvH4_5g37874 FvH4_6g47401
prunus_persica Prupe.2G278400_v2.0.a1 Prupe.2G278600_v2.0.a1 Prupe.2G278600_v2.0.a1 Prupe.2G278600_v2.0.a1 Prupe.2G278600_v2.0.a1 Prupe.2G278600_v2.0.a1 Prupe.2G278600_v2.0.a1 Prupe.6G215000_v2.0.a1
pyrus_communis pycom15g26480
rosa_chinensis RchiOBHm_Chr1g0361131 RchiOBHm_Chr1g0380591 RchiOBHm_Chr1g0380601 RchiOBHm_Chr5g0075661 RchiOBHm_Chr5g0075691 RchiOBHm_Chr5g0075921 RchiOBHm_Chr5g0075931 RchiOBHm_Chr5g0075941 RchiOBHm_Chr5g0076031 RchiOBHm_Chr5g0076061 RchiOBHm_Chr5g0076091 RchiOBHm_Chr5g0076101 RchiOBHm_Chr5g0076131 RchiOBHm_Chr5g0076141 RchiOBHm_Chr5g0076151 RchiOBHm_Chr7g0226061 RchiOBHm_Chr7g0226071 RchiOBHm_Chr7g0226091 RchiOBHm_Chr7g0226431 RchiOBHm_Chr7g0226441
rosa_laevigata RLG00000027157 RLG00000036604
rosa_multiflora Rmu_co8028714.1_g000001 Rmu_co8069518.1_g000001 Rmu_co8225880.1_g000001 Rmu_co8266415.1_g000001 Rmu_sc0001470.1_g000003 Rmu_sc0001470.1_g000004 Rmu_sc0001764.1_g000007 Rmu_sc0002627.1_g000001 Rmu_sc0002652.1_g000008 Rmu_sc0002652.1_g000010 Rmu_sc0002652.1_g000011 Rmu_sc0002652.1_g000013 Rmu_sc0002652.1_g000016 Rmu_sc0002820.1_g000003 Rmu_sc0002820.1_g000004 Rmu_sc0002863.1_g000037 Rmu_sc0003016.1_g000001 Rmu_sc0003601.1_g000001 Rmu_sc0003945.1_g000010 Rmu_sc0004200.1_g000005 Rmu_sc0004250.1_g000018 Rmu_sc0004647.1_g000006 Rmu_sc0004647.1_g000007 Rmu_sc0005762.1_g000005 Rmu_sc0005762.1_g000011 Rmu_sc0005762.1_g000014 Rmu_sc0005961.1_g000010 Rmu_sc0007791.1_g000001 Rmu_sc0007791.1_g000006 Rmu_sc0007791.1_g000010 Rmu_sc0008955.1_g000006 Rmu_sc0008955.1_g000008 Rmu_sc0008955.1_g000019 Rmu_sc0008955.1_g000021 Rmu_sc0010684.1_g000002 Rmu_sc0012777.1_g000003 Rmu_sc0014532.1_g000001 Rmu_sc0018126.1_g000001 Rmu_sc0021483.1_g000001 Rmu_sc0025529.1_g000001 Rmu_sc0027085.1_g000001 Rmu_sc0027085.1_g000003 Rmu_sc0028007.1_g000001 Rmu_sc0031697.1_g000001 Rmu_sc0033228.1_g000001 Rmu_sc0039198.1_g000001 Rmu_sc0042295.1_g000001 Rmu_ssc0000123.1_g000001
rosa_roxburghii Rroxscaffold_1G00005610 Rroxscaffold_1G00005660 Rroxscaffold_1G00005670 Rroxscaffold_1G00005680 Rroxscaffold_1G00005690 Rroxscaffold_1G00005700 Rroxscaffold_1G00005710 Rroxscaffold_1G00005730 Rroxscaffold_1G00005740 Rroxscaffold_1G00005750 Rroxscaffold_1G00005760 Rroxscaffold_1G00005920 Rroxscaffold_1G00005930 Rroxscaffold_1G00006710 Rroxscaffold_2G00084870 Rroxscaffold_3G00232830 Rroxscaffold_3G00233180 Rroxscaffold_3G00233260 Rroxscaffold_3G00233280 Rroxscaffold_4G00279150 Rroxscaffold_4G00279160
rosa_rugosa Rorug01G0285800 Rorug01G0285900 Rorug01G0348200 Rorug01G0419100 Rorug01G0419100 Rorug01G0422800 Rorug01G0422900 Rorug05G0435100 Rorug05G0435100 Rorug05G0435100 Rorug05G0435200 Rorug05G0442200 Rorug05G0442200 Rorug05G0442200 Rorug05G0444000 Rorug05G0444100 Rorug05G0444200 Rorug05G0444300 Rorug05G0444400 Rorug05G0444500 Rorug05G0444600 Rorug05G0444700 Rorug05G0444800 Rorug05G0444900 Rorug05G0445000 Rorug05G0445100 Rorug05G0445700.1 Rorug05G0445900.1 Rorug07G0237200
rosa_samantha Rh1BG318300 Rh1BG402600 Rh1DG349000 Rh1DG432800 Rh5AG498500 Rh5BG519400 Rh5BG521700 Rh5BG521800 Rh5BG521900 Rh5BG522100 Rh5BG522300 Rh5BG522600 Rh5BG522700 Rh5BG523100 Rh5CG543100 Rh5CG545700 Rh5CG545800 Rh5CG545900 Rh5CG546100 Rh5CG546300 Rh5CG546500 Rh5CG547000 Rh5DG525900 Rh5DG535600 Rh7BG368800 Rh7BG368900 Rh7CG387000 Rh7CG387100 Rh7DG379900
rosa_wichuraiana Rw0G009610 Rw0G011310 Rw1G038910 Rw1G038920 Rw2G049110 Rw5G045620 Rw5G046230 Rw5G046250 Rw5G046260 Rw5G046460 Rw5G046470 Rw5G046480 Rw5G046490 Rw5G046500 Rw5G046510 Rw5G046520 Rw7G019970 Rw7G032250 Rw7G032260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 324
AccB1I GGYRCC 1 cut(s) 574
AccB7I CCANNNNNTGG 1 cut(s) 140
AciI CCGC 1 cut(s) 364
AclWI GGATC 1 cut(s) 667
AcsI RAATTY 1 cut(s) 369
AcuI CTGAAG 2 cut(s) 54, 663
AdeI CACNNNGTG 2 cut(s) 739, 825
AgsI TTSAA 2 cut(s) 419, 772
AhdI GACNNNNNGTC 1 cut(s) 711
AjiI CACGTC 1 cut(s) 806
AjnI CCWGG 2 cut(s) 675, 735
AluBI AGCT 6 cut(s) 16, 548, 689, 775, 793, 841
AluI AGCT 6 cut(s) 16, 548, 689, 775, 793, 841
Alw26I GTCTC 6 cut(s) 169, 184, 451, 698, 719, 724
AlwI GGATC 1 cut(s) 667
AlwNI CAGNNNCTG 1 cut(s) 55
Ama87I CYCGRG 1 cut(s) 655
AoxI GGCC 3 cut(s) 651, 679, 798
ApoI RAATTY 1 cut(s) 369
ArsI GACNNNNNNTTYG 2 cut(s) 122, 154
AseI ATTAAT 1 cut(s) 276
AspS9I GGNCC 1 cut(s) 679
AsuHPI GGTGA 5 cut(s) 143, 621, 659, 713, 725
AvaI CYCGRG 1 cut(s) 655
BanI GGYRCC 1 cut(s) 574
BauI CACGAG 1 cut(s) 823
BccI CCATC 3 cut(s) 262, 355, 790
BciT130I CCWGG 2 cut(s) 677, 737
BcoDI GTCTC 6 cut(s) 169, 184, 451, 698, 719, 724
BfaI CTAG 5 cut(s) 161, 186, 311, 354, 408
BfmI CTRYAG 1 cut(s) 47
Bme1390I CCNGG 2 cut(s) 677, 737
BmeRI GACNNNNNGTC 1 cut(s) 711
BmeT110I CYCGRG 1 cut(s) 655
BmgBI CACGTC 1 cut(s) 806
BmgT120I GGNCC 1 cut(s) 679
BmiI GGNNCC 2 cut(s) 344, 576
BmrFI CCNGG 2 cut(s) 677, 737
BmrI ACTGGG 1 cut(s) 293
BmsI GCATC 2 cut(s) 173, 596
BmuI ACTGGG 1 cut(s) 293
BpmI CTGGAG 1 cut(s) 363
BsaJI CCNNGG 4 cut(s) 258, 619, 654, 676
Bse1I ACTGG 2 cut(s) 68, 288
Bse3DI GCAATG 1 cut(s) 265
BseBI CCWGG 2 cut(s) 677, 737
BseDI CCNNGG 4 cut(s) 258, 619, 654, 676
BseGI GGATG 3 cut(s) 254, 449, 523
BseMI GCAATG 1 cut(s) 265
BseMII CTCAG 3 cut(s) 159, 552, 735
BseNI ACTGG 2 cut(s) 68, 288
BseRI GAGGAG 4 cut(s) 20, 23, 26, 275
BsgI GTGCAG 1 cut(s) 495
BshFI GGCC 3 cut(s) 653, 681, 800
BshNI GGYRCC 1 cut(s) 574
BsiHKCI CYCGRG 1 cut(s) 655
BsmAI GTCTC 6 cut(s) 169, 184, 451, 698, 719, 724
BsmBI CGTCTC 2 cut(s) 169, 724
BsnI GGCC 3 cut(s) 653, 681, 800
BsoBI CYCGRG 1 cut(s) 655
Bsp143I GATC 1 cut(s) 672
BspACI CCGC 1 cut(s) 364
BspANI GGCC 3 cut(s) 653, 681, 800
BspCNI CTCAG 3 cut(s) 160, 551, 734
BspLI GGNNCC 2 cut(s) 344, 576
BspMAI CTGCAG 1 cut(s) 51
BspPI GGATC 1 cut(s) 667
BspT107I GGYRCC 1 cut(s) 574
BsrDI GCAATG 1 cut(s) 265
BsrI ACTGG 2 cut(s) 68, 288
BssECI CCNNGG 4 cut(s) 258, 619, 654, 676
BssMI GATC 1 cut(s) 672
BssSI CACGAG 1 cut(s) 823
BssT1I CCWWGG 1 cut(s) 619
Bst2BI CACGAG 1 cut(s) 823
Bst2UI CCWGG 2 cut(s) 677, 737
Bst4CI ACNGT 1 cut(s) 108
BstDEI CTNAG 4 cut(s) 168, 538, 721, 837
BstF5I GGATG 3 cut(s) 254, 449, 523
BstKTI GATC 1 cut(s) 675
BstMAI GTCTC 6 cut(s) 169, 184, 451, 698, 719, 724
BstMBI GATC 1 cut(s) 672
BstNI CCWGG 2 cut(s) 677, 737
BstSCI CCNGG 2 cut(s) 675, 735
BstSFI CTRYAG 1 cut(s) 47
BsuRI GGCC 3 cut(s) 653, 681, 800
BtrI CACGTC 1 cut(s) 806
BtsCI GGATG 3 cut(s) 254, 449, 523
BtsIMutI CAGTG 3 cut(s) 453, 546, 571
CaiI CAGNNNCTG 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 679
CsiI ACCWGGT 1 cut(s) 735
DdeI CTNAG 4 cut(s) 168, 538, 721, 837
DpnI GATC 1 cut(s) 674
DpnII GATC 1 cut(s) 672
DraIII CACNNNGTG 2 cut(s) 739, 825
DriI GACNNNNNGTC 1 cut(s) 711
Eam1105I GACNNNNNGTC 1 cut(s) 711
Eco130I CCWWGG 1 cut(s) 619
Eco57I CTGAAG 2 cut(s) 54, 663
Eco88I CYCGRG 1 cut(s) 655
EcoRII CCWGG 2 cut(s) 675, 735
EcoT14I CCWWGG 1 cut(s) 619
ErhI CCWWGG 1 cut(s) 619
Esp3I CGTCTC 2 cut(s) 169, 724
FaiI YATR 9 cut(s) 41, 114, 272, 281, 324, 432, 444, 533, 650
FokI GGATG 3 cut(s) 241, 436, 530
FspBI CTAG 5 cut(s) 161, 186, 311, 354, 408
GsuI CTGGAG 1 cut(s) 363
HaeIII GGCC 3 cut(s) 653, 681, 800
HincII GTYRAC 1 cut(s) 599
HindII GTYRAC 1 cut(s) 599
HinfI GANTC 8 cut(s) 52, 74, 82, 192, 241, 500, 595, 604
HphI GGTGA 5 cut(s) 143, 621, 659, 713, 725
Hpy166II GTNNAC 3 cut(s) 484, 599, 629
Hpy188I TCNGA 5 cut(s) 130, 169, 259, 496, 724
Hpy188III TCNNGA 3 cut(s) 238, 380, 408
Hpy8I GTNNAC 3 cut(s) 484, 599, 629
Hpy99I CGWCG 1 cut(s) 810
HpyAV CCTTC 3 cut(s) 638, 674, 740
HpyCH4III ACNGT 1 cut(s) 108
HpyCH4IV ACGT 2 cut(s) 178, 805
HpyCH4V TGCA 4 cut(s) 49, 270, 294, 512
HpyF3I CTNAG 4 cut(s) 168, 538, 721, 837
HpySE526I ACGT 2 cut(s) 178, 805
Kzo9I GATC 1 cut(s) 672
LmnI GCTCC 6 cut(s) 13, 262, 382, 780, 790, 846
LweI GCATC 2 cut(s) 173, 596
MabI ACCWGGT 1 cut(s) 735
MaeI CTAG 5 cut(s) 161, 186, 311, 354, 408
MaeII ACGT 2 cut(s) 178, 805
MaeIII GTNAC 3 cut(s) 235, 394, 637
MalI GATC 1 cut(s) 674
MboI GATC 1 cut(s) 672
MboII GAAGA 4 cut(s) 47, 241, 352, 520
MfeI CAATTG 1 cut(s) 414
MluCI AATT 7 cut(s) 42, 137, 273, 316, 369, 414, 579
MlyI GAGTC 5 cut(s) 83, 186, 494, 604, 613
MmeI TCCRAC 1 cut(s) 199
MseI TTAA 3 cut(s) 119, 276, 522
MspR9I CCNGG 2 cut(s) 677, 737
MunI CAATTG 1 cut(s) 414
MvaI CCWGG 2 cut(s) 677, 737
NdeII GATC 1 cut(s) 672
NlaIV GGNNCC 2 cut(s) 344, 576
NmuCI GTSAC 2 cut(s) 235, 637
PfeI GAWTC 3 cut(s) 52, 82, 241
PflMI CCANNNNNTGG 1 cut(s) 140
PleI GAGTC 5 cut(s) 82, 186, 494, 603, 612
PpsI GAGTC 5 cut(s) 82, 186, 494, 603, 612
PshBI ATTAAT 1 cut(s) 276
PsiI TTATAA 1 cut(s) 324
Psp6I CCWGG 2 cut(s) 675, 735
PspGI CCWGG 2 cut(s) 675, 735
PspN4I GGNNCC 2 cut(s) 344, 576
PspPI GGNCC 1 cut(s) 679
PstI CTGCAG 1 cut(s) 51
PstNI CAGNNNCTG 1 cut(s) 55
SaqAI TTAA 3 cut(s) 119, 276, 522
Sau3AI GATC 1 cut(s) 672
Sau96I GGNCC 1 cut(s) 679
SchI GAGTC 5 cut(s) 83, 186, 494, 604, 613
ScrFI CCNGG 2 cut(s) 677, 737
SexAI ACCWGGT 1 cut(s) 735
SfaNI GCATC 2 cut(s) 173, 596
SfcI CTRYAG 1 cut(s) 47
Sse9I AATT 7 cut(s) 42, 137, 273, 316, 369, 414, 579
SsiI CCGC 1 cut(s) 364
SspMI CTAG 5 cut(s) 161, 186, 311, 354, 408
StyD4I CCNGG 2 cut(s) 675, 735
StyI CCWWGG 1 cut(s) 619
TaaI ACNGT 1 cut(s) 108
TaiI ACGT 2 cut(s) 181, 808
TaqI TCGA 2 cut(s) 72, 101
TasI AATT 7 cut(s) 42, 137, 273, 316, 369, 414, 579
TfiI GAWTC 3 cut(s) 52, 82, 241
Tru1I TTAA 3 cut(s) 119, 276, 522
Tru9I TTAA 3 cut(s) 119, 276, 522
TscAI CASTG 3 cut(s) 460, 546, 571
TseFI GTSAC 2 cut(s) 235, 637
Tsp45I GTSAC 2 cut(s) 235, 637
TspDTI ATGAA 2 cut(s) 378, 520
TspGWI ACGGA 2 cut(s) 193, 616
TspRI CASTG 3 cut(s) 460, 546, 571
Van91I CCANNNNNTGG 1 cut(s) 140
VspI ATTAAT 1 cut(s) 276
XapI RAATTY 1 cut(s) 369
XbaI TCTAGA 1 cut(s) 407
XspI CTAG 5 cut(s) 161, 186, 311, 354, 408
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.