Rmu_ssc0000486.1_g000017

subtilisin-like protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000486.1
OG0000302
Physical Location & Seq
Forward (+)
60177 .. 62408
2232 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000486.1_g000017.1.cds

Sequence Viewer

Length: 2232 bp
atgtcactagcagttgctgatgaaaaagtggcagcattggagccgctagccaagacaaagagcatgcaaacttatatagtttgggtggaaaagccaatcagcaatttgattgcacaatctgaacatgaagatttagggagttggtaccagacatttttgccccaaactattgcaaactcaaaccagcttgagaagccacgaatgatttatgcataccacaatgtggcaactggcttcgcagcaaagctgacagcaaaggaagttgaagagatggaaaagaaagatgggtttatctccgctcatccagaacgaaatctgcaattgcacacaactcatagtcctaacttcttggggctgcagcaaggaatgggacacggtaaagggcctaactatggtgaaggtgtgattattggaattttggatagtgggatattcccagaccatccttcatttagtgatgaaggagtaccacctcctccagctaaatggaaaggcaagtgtgatttcagcgggacagtctgcaataacaagcttataggtgccagaagttttaatggtggaaaaactactggaggccctccagttgacgatgaaggccatggaactcacacgtcaagcacagctggaggaaattttgtgagaggtgccagcgtgtttggaatggccaacggcacagcaactggcatggcacctcatgctcacttggcaatgtacaaagtatgctcagacgagggttgttctgaatcagacattatagctgctatggacactgctgttgatgatggcgtggatgtgttatccctttcaattggtggtggctcagcttatttttatgcagatggaattgcagtcggcgcatttggagcaattcagaagggaatctttgtcagctgttcagctggaaatgctggccctgactatatgactttatctaatgaagctccatggattctcacggttggagcaagcaccattgacagaaacataagagcaacagcaaagcttggaaatgggcaagaatatgacggggagtcagtattccagcctaaagattttagttcaaaacagttagctcttgtttatgcaggtgcacatagcaatgattcatcagctctttgcgatgtagggtcccttaaatatgttgaagggaaagtagtggtgtgtgaggtaggtggaggaattggaagaattgcaaaaggggtagaagtgaaaagagctggtggtgttgccatgattcttgtcaacccagacttcgctggctataccaccatagcagacgttcacgtgcttccggcaacacatgtgagttactctgcaggggtgagcatcaaaacctatataaattcaacctcaactcctacagcgacaatcttattcaaaggcactgtcatcggtgatcagcttgctcccaaggttgctttcttttcatcaagaggaccaagcctggcaagccctgcaattttgaaacctgacattattggtcccggtgtgagcatcctagctgcgtggcctttttcggtggataatgctttagaatctaaggccacatttgacattatttcaggtacttcaatgtcatgccctcacctaagtggcattgcagccttgctcaagagctcacaccctgactggtcacctgctgccattaagtctgcaatgatgacaactgctgaagtaaacaacctcgctggctcggccattcttgatcaaacacttcttgcagcagacctctttgccattggcgcaggccatgttaacccttcaaaagcaaatgaccctgggctcatctacgacatacaaccagaggactacattccttacttgtgtggtttgaattacacaagcaaacagatatcggcaatcacccaacaaaatgtgtcgtgctctaaagtaggagtcataccagaagcacagctaaactatcccacattttgtatctatatagagtctggtggtgagcctcagaattacacaagaaccttgaccaatgttggcccagcaaattcaacttacaaattggctcccctgagactacataaaatggacatcactgtgctacctgaggtgcttacatttacagaggttaaccaaaaattgacataccgtgtggtgtttgccacacaagatggagctgggaaagatggtataccattttctcagggatatttgagttgggtgtctcatcagcattctgttaacagccaaatatctgtggtctttgactatgagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Inhibitor_I9 PA Peptidase_S8

Protein Analysis

743

Amino Acids

78.41

Weight (kDa)

5.5

Isoelectric Point (pI)

29.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000302)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g01091 FvH4_5g01093 FvH4_5g01120 FvH4_7g08400
malus_domestica MD00G1069300.v1.1 MD00G1069500.v1.1 MD04G1035800.v1.1 MD04G1071200.v1.1 MD04G1071500.v1.1 MD04G1071800.v1.1 MD04G1071900.v1.1 MD04G1072000.v1.1 MD04G1072200.v1.1 MD04G1072600.v1.1 MD04G1072700.v1.1 MD06G1068800.v1.1
prunus_persica Prupe.5G085000_v2.0.a1 Prupe.5G085100_v2.0.a1 Prupe.5G085200_v2.0.a1 Prupe.5G085300_v2.0.a1 Prupe.5G085400_v2.0.a1 Prupe.5G085500_v2.0.a1 Prupe.5G085600_v2.0.a1 Prupe.5G085700_v2.0.a1 Prupe.5G085800_v2.0.a1 Prupe.5G086100_v2.0.a1
pyrus_communis pycom04g02960 pycom04g06430 pycom04g06590
rosa_chinensis RchiOBHm_Chr0c20g0500201 RchiOBHm_Chr0c20g0500211 RchiOBHm_Chr6g0266941 RchiOBHm_Chr7g0200021 RchiOBHm_Chr7g0200051 RchiOBHm_Chr7g0200061 RchiOBHm_Chr7g0200121 RchiOBHm_Chr7g0200141 RchiOBHm_Chr7g0200151 RchiOBHm_Chr7g0200181 RchiOBHm_Chr7g0200191
rosa_laevigata RLG00000003743 RLG00000003744 RLG00000003745 RLG00000003746 RLG00000003747 RLG00000003748 RLG00000003749 RLG00000003750 RLG00000028998 RLG00000028999 RLG00000029001
rosa_multiflora Rmu_co8342527.1_g000001 Rmu_co8411041.1_g000001 Rmu_sc0003357.1_g000004 Rmu_sc0003357.1_g000005 Rmu_sc0003357.1_g000007 Rmu_sc0006398.1_g000001 Rmu_sc0006398.1_g000003 Rmu_sc0006398.1_g000007 Rmu_sc0006398.1_g000008 Rmu_sc0006398.1_g000009 Rmu_sc0006685.1_g000001 Rmu_sc0010281.1_g000004 Rmu_sc0020375.1_g000001 Rmu_ssc0000486.1_g000017
rosa_roxburghii Rroxscaffold_3G00256220 Rroxscaffold_3G00256230 Rroxscaffold_3G00256240 Rroxscaffold_3G00256250 Rroxscaffold_3G00256260 Rroxscaffold_3G00256270 Rroxscaffold_3G00256280 Rroxscaffold_4G00311060
rosa_rugosa Rorug01G0165100 Rorug01G0165100 Rorug07G0058000 Rorug07G0058000 Rorug07G0058000 Rorug07G0058000 Rorug07G0058100 Rorug07G0058100 Rorug07G0058200
rosa_samantha Rh1AG180000 Rh1CG167000 Rh1DG180300 Rh6AG149600 Rh6BG150600 Rh6CG145600 Rh7AG183300 Rh7AG183400 Rh7AG183800 Rh7AG184000 Rh7CG193000 Rh7CG193100 Rh7CG193200 Rh7CG193500 Rh7CG193600 Rh7CG193700 Rh7CG193800 Rh7CG194000 Rh7DG186300 Rh7DG186400 Rh7DG186500 Rh7DG186700 Rh7DG186800 Rh7DG187400 Rh7DG187500 Rh7DG187600 Rh7DG187800 Rh7DG187900 Rh7DG188000
rosa_wichuraiana Rw1G014970 Rw6G012950 Rw7G016050 Rw7G016060 Rw7G016070 Rw7G016080 Rw7G016090 Rw7G016100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 2 cut(s) 1076, 1645
Acc36I ACCTGC 2 cut(s) 1076, 1645
Acc65I GGTACC 1 cut(s) 144
AccB1I GGYRCC 4 cut(s) 144, 539, 644, 688
AccB7I CCANNNNNTGG 1 cut(s) 223
AccBSI CCGCTC 1 cut(s) 299
AccI GTMKAC 1 cut(s) 2146
AciI CCGC 3 cut(s) 44, 297, 510
AcoI YGGCCR 2 cut(s) 663, 1695
AcsI RAATTY 4 cut(s) 414, 631, 1342, 2002
AcuI CTGAAG 1 cut(s) 1692
AcvI CACGTG 1 cut(s) 1285
AdeI CACNNNGTG 1 cut(s) 223
AfaI GTAC 4 cut(s) 146, 468, 713, 1567
AfiI CCNNNNNNNGG 2 cut(s) 223, 392
AflIII ACRYGT 2 cut(s) 609, 1300
AhdI GACNNNNNGTC 1 cut(s) 1030
AjiI CACGTC 1 cut(s) 612
AjnI CCWGG 2 cut(s) 1443, 1777
AjuI GAANNNNNNNTTGG 2 cut(s) 1403, 1435
AleI CACNNNNGTG 1 cut(s) 1590
Alw21I GWGCWC 3 cut(s) 1093, 1619, 1886
Alw26I GTCTC 2 cut(s) 2023, 2184
Alw44I GTGCAC 1 cut(s) 1089
AlwNI CAGNNNCTG 2 cut(s) 17, 680
ApaLI GTGCAC 1 cut(s) 1089
ApeKI GCWGC 9 cut(s) 32, 239, 355, 358, 758, 1502, 1601, 1640, 1721
ApoI RAATTY 4 cut(s) 414, 631, 1342, 2002
ArsI GACNNNNNNTTYG 2 cut(s) 1371, 1403
Asp718I GGTACC 1 cut(s) 144
AspLEI GCGC 2 cut(s) 857, 1745
AspS9I GGNCC 7 cut(s) 383, 575, 911, 1128, 1436, 1481, 1994
AsuC2I CCSGG 1 cut(s) 1485
AsuHPI GGTGA 7 cut(s) 407, 1333, 1406, 1577, 1626, 1855, 1967
AsuNHI GCTAGC 1 cut(s) 46
AvaII GGWCC 3 cut(s) 1128, 1436, 1481
AxyI CCTNAGG 1 cut(s) 2061
BaeGI GKGCMC 1 cut(s) 1093
BalI TGGCCA 1 cut(s) 665
BanI GGYRCC 4 cut(s) 144, 539, 644, 688
BanII GRGCYC 2 cut(s) 1619, 1785
BbrPI CACGTG 1 cut(s) 1285
Bbv12I GWGCWC 3 cut(s) 1093, 1619, 1886
BbvI GCAGC 9 cut(s) 44, 251, 342, 370, 745, 1489, 1613, 1627, 1733
BccI CCATC 7 cut(s) 265, 278, 450, 776, 833, 2120, 2135
BceAI ACGGC 1 cut(s) 685
BcgI CGANNNNNNTGC 2 cut(s) 1372, 1406
BciT130I CCWGG 2 cut(s) 1445, 1779
BclI TGATCA 2 cut(s) 1396, 1705
BcnI CCSGG 1 cut(s) 1485
BcoDI GTCTC 2 cut(s) 2023, 2184
BfaI CTAG 3 cut(s) 8, 47, 1499
BfmI CTRYAG 3 cut(s) 356, 1314, 1359
BfuAI ACCTGC 2 cut(s) 1076, 1645
BlpI GCTNAGC 1 cut(s) 820
Bme1390I CCNGG 3 cut(s) 1445, 1485, 1779
Bme18I GGWCC 3 cut(s) 1128, 1436, 1481
BmeRI GACNNNNNGTC 1 cut(s) 1030
BmgBI CACGTC 1 cut(s) 612
BmgT120I GGNCC 7 cut(s) 383, 575, 911, 1128, 1436, 1481, 1994
BmiI GGNNCC 9 cut(s) 42, 146, 541, 646, 690, 1129, 1130, 1483, 2022
BmrFI CCNGG 3 cut(s) 1445, 1485, 1779
BmsI GCATC 2 cut(s) 1335, 1503
BmtI GCTAGC 1 cut(s) 50
BpmI CTGGAG 4 cut(s) 462, 564, 591, 645
Bpu1102I GCTNAGC 1 cut(s) 820
BpuEI CTTGAG 2 cut(s) 209, 1595
BpuMI CCSGG 1 cut(s) 1485
BsaAI YACGTR 1 cut(s) 1285
BsaJI CCNNGG 5 cut(s) 598, 944, 1410, 1777, 1778
BsaXI ACNNNNNCTCC 2 cut(s) 1339, 1369
Bsc4I CCNNNNNNNGG 2 cut(s) 223, 392
Bse1I ACTGG 5 cut(s) 235, 574, 581, 685, 1634
Bse21I CCTNAGG 1 cut(s) 2061
Bse3DI GCAATG 4 cut(s) 714, 1105, 1596, 1662
BseBI CCWGG 2 cut(s) 1445, 1779
BseDI CCNNGG 5 cut(s) 598, 944, 1410, 1777, 1778
BseGI GGATG 4 cut(s) 301, 442, 796, 1494
BseLI CCNNNNNNNGG 2 cut(s) 223, 392
BseMI GCAATG 4 cut(s) 714, 1105, 1596, 1662
BseMII CTCAG 6 cut(s) 738, 834, 1976, 2018, 2052, 2171
BseNI ACTGG 5 cut(s) 235, 574, 581, 685, 1634
BseRI GAGGAG 1 cut(s) 465
BseSI GKGCMC 1 cut(s) 1093
BseXI GCAGC 9 cut(s) 44, 251, 342, 370, 745, 1489, 1613, 1627, 1733
BseYI CCCAGC 2 cut(s) 1996, 2132
BshNI GGYRCC 4 cut(s) 144, 539, 644, 688
BsiHKAI GWGCWC 3 cut(s) 1093, 1619, 1886
BsiSI CCGG 2 cut(s) 1292, 1485
BslFI GGGAC 4 cut(s) 384, 526, 1114, 1467
BslI CCNNNNNNNGG 2 cut(s) 223, 392
BsmAI GTCTC 2 cut(s) 2023, 2184
BsmFI GGGAC 4 cut(s) 384, 526, 1114, 1467
BsmI GAATGC 1 cut(s) 2188
Bsp1286I GDGCHC 4 cut(s) 1093, 1619, 1785, 1886
Bsp1407I TGTACA 1 cut(s) 711
Bsp143I GATC 2 cut(s) 1396, 1705
Bsp1720I GCTNAGC 1 cut(s) 820
Bsp19I CCATGG 2 cut(s) 598, 944
BspACI CCGC 3 cut(s) 44, 297, 510
BspCNI CTCAG 6 cut(s) 737, 833, 1975, 2019, 2053, 2170
BspLI GGNNCC 9 cut(s) 42, 146, 541, 646, 690, 1129, 1130, 1483, 2022
BspMAI CTGCAG 2 cut(s) 360, 1318
BspMI ACCTGC 2 cut(s) 1076, 1645
BspOI GCTAGC 1 cut(s) 50
BspT107I GGYRCC 4 cut(s) 144, 539, 644, 688
BsrBI CCGCTC 1 cut(s) 299
BsrDI GCAATG 4 cut(s) 714, 1105, 1596, 1662
BsrGI TGTACA 1 cut(s) 711
BsrI ACTGG 5 cut(s) 235, 574, 581, 685, 1634
BssECI CCNNGG 5 cut(s) 598, 944, 1410, 1777, 1778
BssMI GATC 2 cut(s) 1396, 1705
BssNAI GTATAC 1 cut(s) 2147
BssT1I CCWWGG 3 cut(s) 598, 944, 1410
Bst1107I GTATAC 1 cut(s) 2147
Bst2UI CCWGG 2 cut(s) 1445, 1779
Bst4CI ACNGT 7 cut(s) 377, 517, 958, 1068, 1387, 2053, 2105
Bst6I CTCTTC 1 cut(s) 261
BstAPI GCANNNNNTGC 2 cut(s) 695, 1454
BstAUI TGTACA 1 cut(s) 711
BstBAI YACGTR 1 cut(s) 1285
BstDEI CTNAG 8 cut(s) 724, 820, 1539, 1589, 1962, 2027, 2061, 2157
BstDSI CCRYGG 2 cut(s) 598, 944
BstEII GGTNACC 1 cut(s) 1632
BstF5I GGATG 4 cut(s) 301, 442, 796, 1494
BstHHI GCGC 2 cut(s) 857, 1745
BstKTI GATC 2 cut(s) 1399, 1708
BstMAI GTCTC 2 cut(s) 2023, 2184
BstMBI GATC 2 cut(s) 1396, 1705
BstNI CCWGG 2 cut(s) 1445, 1779
BstNSI RCATGY 2 cut(s) 67, 1304
BstPI GGTNACC 1 cut(s) 1632
BstSCI CCNGG 3 cut(s) 1443, 1483, 1777
BstSFI CTRYAG 3 cut(s) 356, 1314, 1359
BstSLI GKGCMC 1 cut(s) 1093
BstV1I GCAGC 9 cut(s) 44, 251, 342, 370, 745, 1489, 1613, 1627, 1733
BstXI CCANNNNNNTGG 1 cut(s) 486
BstZ17I GTATAC 1 cut(s) 2147
Bsu36I CCTNAGG 1 cut(s) 2061
BtgI CCRYGG 2 cut(s) 598, 944
BtgZI GCGATG 1 cut(s) 1134
BtrI CACGTC 1 cut(s) 612
BtsCI GGATG 4 cut(s) 301, 442, 796, 1494
BtsI GCAGTG 1 cut(s) 768
BtsIMutI CAGTG 3 cut(s) 768, 1383, 2049
BveI ACCTGC 2 cut(s) 1076, 1645
CaiI CAGNNNCTG 2 cut(s) 17, 680
CfoI GCGC 2 cut(s) 857, 1745
Cfr13I GGNCC 7 cut(s) 383, 575, 911, 1128, 1436, 1481, 1994
Csp6I GTAC 4 cut(s) 145, 467, 712, 1566
CviQI GTAC 4 cut(s) 145, 467, 712, 1566
DdeI CTNAG 8 cut(s) 724, 820, 1539, 1589, 1962, 2027, 2061, 2157
DpnI GATC 2 cut(s) 1398, 1707
DpnII GATC 2 cut(s) 1396, 1705
DraIII CACNNNGTG 1 cut(s) 223
DriI GACNNNNNGTC 1 cut(s) 1030
EaeI YGGCCR 2 cut(s) 663, 1695
Eam1104I CTCTTC 1 cut(s) 261
Eam1105I GACNNNNNGTC 1 cut(s) 1030
EarI CTCTTC 1 cut(s) 261
Ecl136II GAGCTC 1 cut(s) 1617
Eco130I CCWWGG 3 cut(s) 598, 944, 1410
Eco24I GRGCYC 2 cut(s) 1619, 1785
Eco32I GATATC 1 cut(s) 1854
Eco47I GGWCC 3 cut(s) 1128, 1436, 1481
Eco53kI GAGCTC 1 cut(s) 1617
Eco57I CTGAAG 1 cut(s) 1692
Eco72I CACGTG 1 cut(s) 1285
Eco81I CCTNAGG 1 cut(s) 2061
Eco91I GGTNACC 1 cut(s) 1632
EcoICRI GAGCTC 1 cut(s) 1617
EcoO109I RGGNCCY 3 cut(s) 383, 575, 1128
EcoO65I GGTNACC 1 cut(s) 1632
EcoRII CCWGG 2 cut(s) 1443, 1777
EcoRV GATATC 1 cut(s) 1854
EcoT14I CCWWGG 3 cut(s) 598, 944, 1410
EcoT22I ATGCAT 1 cut(s) 214
EcoT38I GRGCYC 2 cut(s) 1619, 1785
ErhI CCWWGG 3 cut(s) 598, 944, 1410
FalI AAGNNNNNCTT 2 cut(s) 866, 898
FaqI GGGAC 4 cut(s) 384, 526, 1114, 1467
FauI CCCGC 1 cut(s) 503
FbaI TGATCA 2 cut(s) 1396, 1705
FblI GTMKAC 1 cut(s) 2146
FokI GGATG 4 cut(s) 288, 429, 803, 1481
FriOI GRGCYC 2 cut(s) 1619, 1785
FspBI CTAG 3 cut(s) 8, 47, 1499
GlaI GCGC 2 cut(s) 856, 1744
GsaI CCCAGC 2 cut(s) 2000, 2136
GsuI CTGGAG 4 cut(s) 462, 564, 591, 645
HapII CCGG 2 cut(s) 1292, 1485
HhaI GCGC 2 cut(s) 857, 1745
Hin6I GCGC 2 cut(s) 855, 1743
HinP1I GCGC 2 cut(s) 855, 1743
HincII GTYRAC 5 cut(s) 586, 1243, 1756, 2086, 2197
HindII GTYRAC 5 cut(s) 586, 1243, 1756, 2086, 2197
HindIII AAGCTT 2 cut(s) 530, 1001
HinfI GANTC 9 cut(s) 743, 879, 949, 1031, 1103, 1234, 1535, 1896, 1946
HpaI GTTAAC 3 cut(s) 1756, 2086, 2197
HpaII CCGG 2 cut(s) 1292, 1485
HphI GGTGA 7 cut(s) 407, 1333, 1406, 1577, 1626, 1855, 1967
Hpy166II GTNNAC 9 cut(s) 586, 1091, 1243, 1282, 1678, 1756, 2086, 2147, 2197
Hpy188I TCNGA 6 cut(s) 121, 727, 742, 748, 873, 1965
Hpy188III TCNNGA 4 cut(s) 305, 1431, 1612, 1703
Hpy8I GTNNAC 9 cut(s) 586, 1091, 1243, 1282, 1678, 1756, 2086, 2147, 2197
HpyAV CCTTC 7 cut(s) 392, 455, 456, 587, 868, 1139, 1770
HpyCH4III ACNGT 7 cut(s) 377, 517, 958, 1068, 1387, 2053, 2105
HpyCH4IV ACGT 3 cut(s) 611, 1278, 1284
HpyF3I CTNAG 8 cut(s) 724, 820, 1539, 1589, 1962, 2027, 2061, 2157
HpySE526I ACGT 3 cut(s) 611, 1278, 1284
HspAI GCGC 2 cut(s) 855, 1743
KflI GGGWCCC 1 cut(s) 1128
KpnI GGTACC 1 cut(s) 148
Ksp22I TGATCA 2 cut(s) 1396, 1705
KspAI GTTAAC 3 cut(s) 1756, 2086, 2197
Kzo9I GATC 2 cut(s) 1396, 1705
LmnI GCTCC 7 cut(s) 40, 863, 946, 962, 1411, 2026, 2129
Lsp1109I GCAGC 9 cut(s) 44, 251, 342, 370, 745, 1489, 1613, 1627, 1733
LweI GCATC 2 cut(s) 1335, 1503
MaeI CTAG 3 cut(s) 8, 47, 1499
MaeII ACGT 3 cut(s) 611, 1278, 1284
MaeIII GTNAC 3 cut(s) 3, 1307, 1632
MalI GATC 2 cut(s) 1398, 1707
MbiI CCGCTC 1 cut(s) 299
MboI GATC 2 cut(s) 1396, 1705
MboII GAAGA 3 cut(s) 140, 278, 1197
MfeI CAATTG 2 cut(s) 320, 807
MhlI GDGCHC 4 cut(s) 1093, 1619, 1785, 1886
MlsI TGGCCA 1 cut(s) 665
MluNI TGGCCA 1 cut(s) 665
MlyI GAGTC 3 cut(s) 1040, 1905, 1955
MmeI TCCRAC 1 cut(s) 940
Mox20I TGGCCA 1 cut(s) 665
Mph1103I ATGCAT 1 cut(s) 214
MscI TGGCCA 1 cut(s) 665
MseI TTAA 6 cut(s) 552, 1134, 1647, 1755, 2085, 2196
MslI CAYNNNNRTG 3 cut(s) 1098, 1590, 2051
Msp20I TGGCCA 1 cut(s) 665
MspA1I CMGCKG 4 cut(s) 510, 623, 891, 899
MspI CCGG 2 cut(s) 1292, 1485
MspR9I CCNGG 3 cut(s) 1445, 1485, 1779
MunI CAATTG 2 cut(s) 320, 807
Mva1269I GAATGC 1 cut(s) 2188
MvaI CCWGG 2 cut(s) 1445, 1779
NciI CCSGG 1 cut(s) 1485
NcoI CCATGG 2 cut(s) 598, 944
NdeII GATC 2 cut(s) 1396, 1705
NheI GCTAGC 1 cut(s) 46
NlaIV GGNNCC 9 cut(s) 42, 146, 541, 646, 690, 1129, 1130, 1483, 2022
NmeAIII GCCGAG 1 cut(s) 1673
NmuCI GTSAC 2 cut(s) 3, 1632
NsiI ATGCAT 1 cut(s) 214
NspI RCATGY 2 cut(s) 67, 1304
OliI CACNNNNGTG 1 cut(s) 1590
PaeI GCATGC 1 cut(s) 67
PaqCI CACCTGC 2 cut(s) 1076, 1645
PasI CCCWGGG 1 cut(s) 1778
PciI ACATGT 1 cut(s) 1300
PctI GAATGC 1 cut(s) 2188
PfeI GAWTC 6 cut(s) 743, 879, 949, 1103, 1234, 1535
PflMI CCANNNNNTGG 1 cut(s) 223
PleI GAGTC 3 cut(s) 1039, 1904, 1954
PmaCI CACGTG 1 cut(s) 1285
PmlI CACGTG 1 cut(s) 1285
PpsI GAGTC 3 cut(s) 1039, 1904, 1954
Ppu21I YACGTR 1 cut(s) 1285
PpuMI RGGWCCY 1 cut(s) 1128
PscI ACATGT 1 cut(s) 1300
Psp124BI GAGCTC 1 cut(s) 1619
Psp5II RGGWCCY 1 cut(s) 1128
Psp6I CCWGG 2 cut(s) 1443, 1777
PspCI CACGTG 1 cut(s) 1285
PspEI GGTNACC 1 cut(s) 1632
PspFI CCCAGC 2 cut(s) 1996, 2132
PspGI CCWGG 2 cut(s) 1443, 1777
PspN4I GGNNCC 9 cut(s) 42, 146, 541, 646, 690, 1129, 1130, 1483, 2022
PspPI GGNCC 7 cut(s) 383, 575, 911, 1128, 1436, 1481, 1994
PspPPI RGGWCCY 1 cut(s) 1128
PstI CTGCAG 2 cut(s) 360, 1318
PstNI CAGNNNCTG 2 cut(s) 17, 680
PvuII CAGCTG 3 cut(s) 623, 891, 899
RsaI GTAC 4 cut(s) 146, 468, 713, 1567
RsaNI GTAC 4 cut(s) 145, 467, 712, 1566
RseI CAYNNNNRTG 3 cut(s) 1098, 1590, 2051
SacI GAGCTC 1 cut(s) 1619
SaqAI TTAA 6 cut(s) 552, 1134, 1647, 1755, 2085, 2196
Sau3AI GATC 2 cut(s) 1396, 1705
Sau96I GGNCC 7 cut(s) 383, 575, 911, 1128, 1436, 1481, 1994
SchI GAGTC 3 cut(s) 1040, 1905, 1955
ScrFI CCNGG 3 cut(s) 1445, 1485, 1779
SduI GDGCHC 4 cut(s) 1093, 1619, 1785, 1886
SfaNI GCATC 2 cut(s) 1335, 1503
SfcI CTRYAG 3 cut(s) 356, 1314, 1359
SinI GGWCC 3 cut(s) 1128, 1436, 1481
SmiMI CAYNNNNRTG 3 cut(s) 1098, 1590, 2051
SmlI CTYRAG 2 cut(s) 188, 1610
SmoI CTYRAG 2 cut(s) 188, 1610
SphI GCATGC 1 cut(s) 67
SsiI CCGC 3 cut(s) 44, 297, 510
SspMI CTAG 3 cut(s) 8, 47, 1499
SstI GAGCTC 1 cut(s) 1619
StyD4I CCNGG 3 cut(s) 1443, 1483, 1777
StyI CCWWGG 3 cut(s) 598, 944, 1410
TaaI ACNGT 7 cut(s) 377, 517, 958, 1068, 1387, 2053, 2105
TaiI ACGT 3 cut(s) 614, 1281, 1287
TatI WGTACW 1 cut(s) 711
TauI GCSGC 1 cut(s) 46
TfiI GAWTC 6 cut(s) 743, 879, 949, 1103, 1234, 1535
Tru1I TTAA 6 cut(s) 552, 1134, 1647, 1755, 2085, 2196
Tru9I TTAA 6 cut(s) 552, 1134, 1647, 1755, 2085, 2196
TscAI CASTG 3 cut(s) 775, 1390, 2056
TseFI GTSAC 2 cut(s) 3, 1632
TseI GCWGC 9 cut(s) 32, 239, 355, 358, 758, 1502, 1601, 1640, 1721
Tsp45I GTSAC 2 cut(s) 3, 1632
TspDTI ATGAA 8 cut(s) 36, 141, 438, 474, 606, 951, 1095, 1416
TspRI CASTG 3 cut(s) 775, 1390, 2056
Van91I CCANNNNNTGG 1 cut(s) 223
VneI GTGCAC 1 cut(s) 1089
VpaK11BI GGWCC 3 cut(s) 1128, 1436, 1481
XapI RAATTY 4 cut(s) 414, 631, 1342, 2002
XceI RCATGY 2 cut(s) 67, 1304
XmiI GTMKAC 1 cut(s) 2146
XspI CTAG 3 cut(s) 8, 47, 1499
Zsp2I ATGCAT 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.