Prupe.5G002600_v2.0.a1

Reverse transcriptase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
OG0000204
Physical Location & Seq
Forward (+)
401489 .. 403076
1588 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G002600.1

Sequence Viewer

Length: 207 bp
ATGCTTTATGGGTCGGCTCTCATGATAGAGATGGACGCTATAAGGACAGTTCTGTTTGCTTGTCAACATGGGGGTTTCTCACAGGTGGTGGTGGAGTCTAATTCCCAAGTTTCCATCAAGATGGTGAAGGGGGAGAGGGTGGTGGCTGTGGAGGTAGATAGTATTCTCTTCGACATCCAGACAGCGATTCGAGAATTCCAGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3

Protein Analysis

69

Amino Acids

7.56

Weight (kDa)

5.12

Isoelectric Point (pI)

33.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000204)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G04625 AT1G27220 AT1G27250 AT1G27870 AT1G47497 AT1G47497 AT1G50160 AT1G52990 AT1G52990 AT1G77815 AT2G02650 AT2G04420 AT2G11205 AT2G13980 AT2G33160 AT2G46460 AT3G09510 AT3G23320 AT3G25270 AT3G32130 AT4G03292 AT4G09775 AT5G26617 AT5G44470 AT5G52115 AT5G65005
fragaria_vesca FvH4_1g25222 FvH4_1g28481 FvH4_3g03751 FvH4_3g24081 FvH4_3g35341 FvH4_5g31961 FvH4_6g20891 FvH4_6g23253 FvH4_6g31361 FvH4_6g53051
malus_domestica MD14G1209300.v1.1
prunus_persica Prupe.1G168800_v2.0.a1 Prupe.1G509200_v2.0.a1 Prupe.2G042000_v2.0.a1 Prupe.2G133200_v2.0.a1 Prupe.2G140300_v2.0.a1 Prupe.3G103800_v2.0.a1 Prupe.4G217300_v2.0.a1 Prupe.4G245300_v2.0.a1 Prupe.5G002600_v2.0.a1 Prupe.5G134600_v2.0.a1 Prupe.6G185900_v2.0.a1 Prupe.6G308300_v2.0.a1 Prupe.7G010700_v2.0.a1 Prupe.8G078100_v2.0.a1 Prupe.8G128400_v2.0.a1
pyrus_communis pycom01g14230 pycom03g12410 pycom08g15160 pycom08g21670 pycom10g25730 pycom10g25740 pycom11g15380 pycom14g10440 pycom14g11510 pycom15g31840 pycom16g02370
rosa_chinensis RchiOBHm_Chr4g0440421 RchiOBHm_Chr5g0005841 RchiOBHm_Chr6g0289481 RchiOBHm_Chr7g0218671
rosa_laevigata RLG00000011653 RLG00000031330 RLG00000031331 RLG00000032722
rosa_multiflora Rmu_co8243061.1_g000001 Rmu_sc0000470.1_g000036 Rmu_sc0000581.1_g000008 Rmu_sc0000666.1_g000017 Rmu_sc0000905.1_g000019 Rmu_sc0000976.1_g000013 Rmu_sc0001066.1_g000001 Rmu_sc0001103.1_g000007 Rmu_sc0001180.1_g000001 Rmu_sc0001643.1_g000034 Rmu_sc0001759.1_g000007 Rmu_sc0001850.1_g000051 Rmu_sc0001910.1_g000008 Rmu_sc0001981.1_g000015 Rmu_sc0001981.1_g000029 Rmu_sc0002209.1_g000015 Rmu_sc0002406.1_g000010 Rmu_sc0003743.1_g000002 Rmu_sc0006416.1_g000026 Rmu_sc0006513.1_g000006 Rmu_sc0006577.1_g000010 Rmu_sc0014652.1_g000001 Rmu_sc0016202.1_g000003
rosa_roxburghii Rroxscaffold_1G00001530 Rroxscaffold_1G00047250 Rroxscaffold_5G00340720 Rroxscaffold_7G00171110 Rroxscaffold_7G00177650
rosa_rugosa Rorug01G0044800 Rorug01G0204500 Rorug01G0224700 Rorug01G0267800 Rorug02G0038400 Rorug02G0107100 Rorug02G0180700 Rorug02G0363800 Rorug02G0374300 Rorug02G0491400 Rorug02G0491400 Rorug03G0104200 Rorug03G0109800 Rorug03G0334200 Rorug04G0007100 Rorug04G0061400.1 Rorug04G0080000 Rorug05G0152200 Rorug05G0188800 Rorug05G0234800 Rorug05G0239900 Rorug05G0284800 Rorug06G0044700 Rorug06G0205700 Rorug06G0266900 Rorug06G0440700 Rorug07G0037400 Rorug07G0192100 Rorug07G0196900 Rorug07G0237500 Rorug07G0336400.1 RorugPtG0002500.1
rosa_samantha Rh1BG014800 Rh1CG017500 Rh2CG332500 Rh3BG371800 Rh5AG046000 Rh5AG046100 Rh5BG044700 Rh5BG044800 Rh5BG248000 Rh5CG053600 Rh5CG053700 Rh5DG044500 Rh5DG044600 Rh6AG052800 Rh6AG315400 Rh6DG021400 Rh7AG409500
rosa_wichuraiana Rw3G007750 Rw3G018750 Rw4G008820 Rw5G004630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 194
ApoI RAATTY 1 cut(s) 194
AsuHPI GGTGA 1 cut(s) 136
BccI CCATC 3 cut(s) 25, 115, 122
BseGI GGATG 1 cut(s) 174
BspHI TCATGA 1 cut(s) 21
Bst4CI ACNGT 1 cut(s) 49
Bst6I CTCTTC 1 cut(s) 173
BstF5I GGATG 1 cut(s) 174
BstXI CCANNNNNNTGG 1 cut(s) 121
BtsCI GGATG 1 cut(s) 174
CciI TCATGA 1 cut(s) 21
CseI GACGC 1 cut(s) 44
CviAII CATG 2 cut(s) 22, 68
CviJI RGCY 2 cut(s) 17, 146
CviKI_1 RGCY 2 cut(s) 17, 146
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
EcoRI GAATTC 1 cut(s) 194
FaeI CATG 2 cut(s) 25, 71
FaiI YATR 4 cut(s) 9, 23, 41, 69
FatI CATG 2 cut(s) 21, 67
FokI GGATG 1 cut(s) 161
HgaI GACGC 1 cut(s) 44
Hin1II CATG 2 cut(s) 25, 71
HincII GTYRAC 1 cut(s) 65
HindII GTYRAC 1 cut(s) 65
HinfI GANTC 2 cut(s) 95, 187
HphI GGTGA 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 65
Hpy188III TCNNGA 5 cut(s) 22, 118, 178, 191, 199
Hpy8I GTNNAC 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 49
Hsp92II CATG 2 cut(s) 25, 71
LpnPI CCDG 2 cut(s) 68, 191
MboII GAAGA 1 cut(s) 160
MluCI AATT 2 cut(s) 100, 194
MlyI GAGTC 1 cut(s) 104
MnlI CCTC 2 cut(s) 129, 145
MslI CAYNNNNRTG 1 cut(s) 119
NlaIII CATG 2 cut(s) 25, 71
PagI TCATGA 1 cut(s) 21
PfeI GAWTC 1 cut(s) 187
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
RseI CAYNNNNRTG 1 cut(s) 119
SchI GAGTC 1 cut(s) 104
SetI ASST 2 cut(s) 87, 156
SgeI CNNG 8 cut(s) 34, 72, 80, 95, 119, 130, 190, 203
SmiMI CAYNNNNRTG 1 cut(s) 119
Sse9I AATT 2 cut(s) 100, 194
TaaI ACNGT 1 cut(s) 49
TaqI TCGA 2 cut(s) 171, 190
TasI AATT 2 cut(s) 100, 194
TfiI GAWTC 1 cut(s) 187
XapI RAATTY 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.