Rmu_sc0014652.1_g000001

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014652.1
OG0000204
Physical Location & Seq
Forward (+)
3842 .. 4486
645 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014652.1_g000001.1.cds

Sequence Viewer

Length: 549 bp
atgagtttacacacggcctactacatttggcgtgctagaaatgatcttattttccgtagtcaagattttaactcaaccaaggttttctttgctgtaactaactcctatcttcttttgaatttaaacacctcgcttaaacgtcctgatcaaagtttaatcaaatggattccccctcaaagggctggtggctttgtttttaggaatgaagctggtgatcctgttctagcagcatgtaatcctttcacttctactgatatccttcttgctgaaggattagctagagctggtcttcatgcggcagttatccatggattctctcccctccaagttgaaggagattctaaacttctgattgatcccatcaatggtaaagcaaatctcccctggcgacttaagtccttaatccatgacatccatcacctgcataaatttctattggcgacggaagtcaagaatgtcaaacgtgaagctaaagttttggcagatgctttggcaaaaactggccatacaattatggctcaagtattgaattcggctttaattgaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

182

Amino Acids

20.25

Weight (kDa)

9.48

Isoelectric Point (pI)

37.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000204)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G04625 AT1G27220 AT1G27250 AT1G27870 AT1G47497 AT1G47497 AT1G50160 AT1G52990 AT1G52990 AT1G77815 AT2G02650 AT2G04420 AT2G11205 AT2G13980 AT2G33160 AT2G46460 AT3G09510 AT3G23320 AT3G25270 AT3G32130 AT4G03292 AT4G09775 AT5G26617 AT5G44470 AT5G52115 AT5G65005
fragaria_vesca FvH4_1g25222 FvH4_1g28481 FvH4_3g03751 FvH4_3g24081 FvH4_3g35341 FvH4_5g31961 FvH4_6g20891 FvH4_6g23253 FvH4_6g31361 FvH4_6g53051
malus_domestica MD14G1209300.v1.1
prunus_persica Prupe.1G168800_v2.0.a1 Prupe.1G509200_v2.0.a1 Prupe.2G042000_v2.0.a1 Prupe.2G133200_v2.0.a1 Prupe.2G140300_v2.0.a1 Prupe.3G103800_v2.0.a1 Prupe.4G217300_v2.0.a1 Prupe.4G245300_v2.0.a1 Prupe.5G002600_v2.0.a1 Prupe.5G134600_v2.0.a1 Prupe.6G185900_v2.0.a1 Prupe.6G308300_v2.0.a1 Prupe.7G010700_v2.0.a1 Prupe.8G078100_v2.0.a1 Prupe.8G128400_v2.0.a1
pyrus_communis pycom01g14230 pycom03g12410 pycom08g15160 pycom08g21670 pycom10g25730 pycom10g25740 pycom11g15380 pycom14g10440 pycom14g11510 pycom15g31840 pycom16g02370
rosa_chinensis RchiOBHm_Chr4g0440421 RchiOBHm_Chr5g0005841 RchiOBHm_Chr6g0289481 RchiOBHm_Chr7g0218671
rosa_laevigata RLG00000011653 RLG00000031330 RLG00000031331 RLG00000032722
rosa_multiflora Rmu_co8243061.1_g000001 Rmu_sc0000470.1_g000036 Rmu_sc0000581.1_g000008 Rmu_sc0000666.1_g000017 Rmu_sc0000905.1_g000019 Rmu_sc0000976.1_g000013 Rmu_sc0001066.1_g000001 Rmu_sc0001103.1_g000007 Rmu_sc0001180.1_g000001 Rmu_sc0001643.1_g000034 Rmu_sc0001759.1_g000007 Rmu_sc0001850.1_g000051 Rmu_sc0001910.1_g000008 Rmu_sc0001981.1_g000015 Rmu_sc0001981.1_g000029 Rmu_sc0002209.1_g000015 Rmu_sc0002406.1_g000010 Rmu_sc0003743.1_g000002 Rmu_sc0006416.1_g000026 Rmu_sc0006513.1_g000006 Rmu_sc0006577.1_g000010 Rmu_sc0014652.1_g000001 Rmu_sc0016202.1_g000003
rosa_roxburghii Rroxscaffold_1G00001530 Rroxscaffold_1G00047250 Rroxscaffold_5G00340720 Rroxscaffold_7G00171110 Rroxscaffold_7G00177650
rosa_rugosa Rorug01G0044800 Rorug01G0204500 Rorug01G0224700 Rorug01G0267800 Rorug02G0038400 Rorug02G0107100 Rorug02G0180700 Rorug02G0363800 Rorug02G0374300 Rorug02G0491400 Rorug02G0491400 Rorug03G0104200 Rorug03G0109800 Rorug03G0334200 Rorug04G0007100 Rorug04G0061400.1 Rorug04G0080000 Rorug05G0152200 Rorug05G0188800 Rorug05G0234800 Rorug05G0239900 Rorug05G0284800 Rorug06G0044700 Rorug06G0205700 Rorug06G0266900 Rorug06G0440700 Rorug07G0037400 Rorug07G0192100 Rorug07G0196900 Rorug07G0237500 Rorug07G0336400.1 RorugPtG0002500.1
rosa_samantha Rh1BG014800 Rh1CG017500 Rh2CG332500 Rh3BG371800 Rh5AG046000 Rh5AG046100 Rh5BG044700 Rh5BG044800 Rh5BG248000 Rh5CG053600 Rh5CG053700 Rh5DG044500 Rh5DG044600 Rh6AG052800 Rh6AG315400 Rh6DG021400 Rh7AG409500
rosa_wichuraiana Rw3G007750 Rw3G018750 Rw4G008820 Rw5G004630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 429
Acc36I ACCTGC 1 cut(s) 429
AciI CCGC 1 cut(s) 296
AclWI GGATC 2 cut(s) 209, 350
AcoI YGGCCR 1 cut(s) 502
AcsI RAATTY 3 cut(s) 118, 428, 529
AcuI CTGAAG 1 cut(s) 288
AfiI CCNNNNNNNGG 3 cut(s) 177, 178, 365
AflII CTTAAG 1 cut(s) 392
AgsI TTSAA 4 cut(s) 118, 332, 529, 545
AjnI CCWGG 1 cut(s) 383
AluBI AGCT 4 cut(s) 209, 278, 284, 470
AluI AGCT 4 cut(s) 209, 278, 284, 470
AlwI GGATC 2 cut(s) 209, 350
AoxI GGCC 2 cut(s) 15, 502
ApeKI GCWGC 1 cut(s) 227
ApoI RAATTY 3 cut(s) 118, 428, 529
AsuHPI GGTGA 2 cut(s) 224, 410
BalI TGGCCA 1 cut(s) 504
BbsI GAAGAC 1 cut(s) 281
BbvI GCAGC 1 cut(s) 239
BccI CCATC 2 cut(s) 368, 423
BceAI ACGGC 1 cut(s) 30
BciT130I CCWGG 1 cut(s) 385
BclI TGATCA 1 cut(s) 145
BfaI CTAG 3 cut(s) 36, 224, 279
BfrI CTTAAG 1 cut(s) 392
BfuAI ACCTGC 1 cut(s) 429
BisI GCNGC 2 cut(s) 228, 297
BlsI GCNGC 2 cut(s) 229, 298
Bme1390I CCNGG 1 cut(s) 385
BmrFI CCNGG 1 cut(s) 385
BmsI GCATC 1 cut(s) 475
BoxI GACNNNNGTC 2 cut(s) 394, 446
BpiI GAAGAC 1 cut(s) 281
BpuEI CTTGAG 1 cut(s) 504
BsaJI CCNNGG 3 cut(s) 78, 307, 383
Bsc4I CCNNNNNNNGG 3 cut(s) 177, 178, 365
Bse1I ACTGG 1 cut(s) 505
BseBI CCWGG 1 cut(s) 385
BseDI CCNNGG 3 cut(s) 78, 307, 383
BseGI GGATG 1 cut(s) 411
BseLI CCNNNNNNNGG 3 cut(s) 177, 178, 365
BseNI ACTGG 1 cut(s) 505
BseXI GCAGC 1 cut(s) 239
BshFI GGCC 2 cut(s) 17, 504
BslI CCNNNNNNNGG 3 cut(s) 177, 178, 365
BsnI GGCC 2 cut(s) 17, 504
Bsp143I GATC 4 cut(s) 43, 145, 214, 355
Bsp19I CCATGG 1 cut(s) 307
BspACI CCGC 1 cut(s) 296
BspANI GGCC 2 cut(s) 17, 504
BspMI ACCTGC 1 cut(s) 429
BspPI GGATC 2 cut(s) 209, 350
BspTI CTTAAG 1 cut(s) 392
BsrI ACTGG 1 cut(s) 505
BssECI CCNNGG 3 cut(s) 78, 307, 383
BssMI GATC 4 cut(s) 43, 145, 214, 355
BssT1I CCWWGG 2 cut(s) 78, 307
Bst2UI CCWGG 1 cut(s) 385
BstAFI CTTAAG 1 cut(s) 392
BstC8I GCNNGC 1 cut(s) 33
BstDSI CCRYGG 1 cut(s) 307
BstF5I GGATG 1 cut(s) 411
BstKTI GATC 4 cut(s) 46, 148, 217, 358
BstMBI GATC 4 cut(s) 43, 145, 214, 355
BstNI CCWGG 1 cut(s) 385
BstNSI RCATGY 1 cut(s) 234
BstPAI GACNNNNGTC 2 cut(s) 394, 446
BstSCI CCNGG 1 cut(s) 383
BstV1I GCAGC 1 cut(s) 239
BstV2I GAAGAC 1 cut(s) 281
BsuRI GGCC 2 cut(s) 17, 504
BtgI CCRYGG 1 cut(s) 307
BtsCI GGATG 1 cut(s) 411
BveI ACCTGC 1 cut(s) 429
Cac8I GCNNGC 1 cut(s) 33
CviAII CATG 4 cut(s) 231, 293, 308, 407
DpnI GATC 4 cut(s) 45, 147, 216, 357
DpnII GATC 4 cut(s) 43, 145, 214, 355
DraI TTTAAA 1 cut(s) 123
EaeI YGGCCR 1 cut(s) 502
Eco130I CCWWGG 2 cut(s) 78, 307
Eco32I GATATC 1 cut(s) 256
Eco57I CTGAAG 1 cut(s) 288
EcoRI GAATTC 1 cut(s) 529
EcoRII CCWGG 1 cut(s) 383
EcoRV GATATC 1 cut(s) 256
EcoT14I CCWWGG 2 cut(s) 78, 307
ErhI CCWWGG 2 cut(s) 78, 307
FaeI CATG 4 cut(s) 234, 296, 311, 410
FaiI YATR 7 cut(s) 232, 294, 309, 408, 426, 507, 515
FalI AAGNNNNNCTT 2 cut(s) 71, 103
FatI CATG 4 cut(s) 230, 292, 307, 406
FbaI TGATCA 1 cut(s) 145
Fnu4HI GCNGC 2 cut(s) 228, 297
FokI GGATG 1 cut(s) 398
Fsp4HI GCNGC 2 cut(s) 228, 297
FspBI CTAG 3 cut(s) 36, 224, 279
GluI GCNGC 2 cut(s) 228, 297
HaeIII GGCC 2 cut(s) 17, 504
Hin1II CATG 4 cut(s) 234, 296, 311, 410
HinfI GANTC 3 cut(s) 166, 312, 338
HphI GGTGA 2 cut(s) 224, 410
Hpy166II GTNNAC 1 cut(s) 8
Hpy188I TCNGA 1 cut(s) 351
Hpy188III TCNNGA 3 cut(s) 62, 143, 451
Hpy8I GTNNAC 1 cut(s) 8
Hpy99I CGWCG 1 cut(s) 445
HpyAV CCTTC 3 cut(s) 263, 269, 326
HpyCH4IV ACGT 2 cut(s) 139, 463
HpyCH4V TGCA 1 cut(s) 424
HpySE526I ACGT 2 cut(s) 139, 463
Hsp92II CATG 4 cut(s) 234, 296, 311, 410
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 4 cut(s) 43, 145, 214, 355
LpnPI CCDG 9 cut(s) 156, 168, 195, 231, 270, 370, 397, 434, 486
Lsp1109I GCAGC 1 cut(s) 239
LweI GCATC 1 cut(s) 475
MaeI CTAG 3 cut(s) 36, 224, 279
MaeII ACGT 2 cut(s) 139, 463
MaeIII GTNAC 1 cut(s) 94
MalI GATC 4 cut(s) 45, 147, 216, 357
MboI GATC 4 cut(s) 43, 145, 214, 355
MboII GAAGA 2 cut(s) 101, 281
MlsI TGGCCA 1 cut(s) 504
MluCI AATT 5 cut(s) 118, 428, 510, 529, 540
MluNI TGGCCA 1 cut(s) 504
MnlI CCTC 3 cut(s) 139, 183, 332
Mox20I TGGCCA 1 cut(s) 504
MscI TGGCCA 1 cut(s) 504
MseI TTAA 7 cut(s) 69, 122, 135, 155, 393, 401, 539
Msp20I TGGCCA 1 cut(s) 504
MspCI CTTAAG 1 cut(s) 392
MspR9I CCNGG 1 cut(s) 385
MvaI CCWGG 1 cut(s) 385
NcoI CCATGG 1 cut(s) 307
NdeII GATC 4 cut(s) 43, 145, 214, 355
NlaIII CATG 4 cut(s) 234, 296, 311, 410
NspI RCATGY 1 cut(s) 234
PaqCI CACCTGC 1 cut(s) 429
PfeI GAWTC 3 cut(s) 166, 312, 338
PkrI GCNGC 2 cut(s) 229, 298
PshAI GACNNNNGTC 2 cut(s) 394, 446
Psp6I CCWGG 1 cut(s) 383
PspGI CCWGG 1 cut(s) 383
SaqAI TTAA 7 cut(s) 69, 122, 135, 155, 393, 401, 539
SatI GCNGC 2 cut(s) 228, 297
Sau3AI GATC 4 cut(s) 43, 145, 214, 355
ScrFI CCNGG 1 cut(s) 385
SetI ASST 9 cut(s) 84, 131, 142, 211, 280, 286, 423, 466, 472
SfaNI GCATC 1 cut(s) 475
SmlI CTYRAG 2 cut(s) 392, 519
SmoI CTYRAG 2 cut(s) 392, 519
Sse9I AATT 5 cut(s) 118, 428, 510, 529, 540
SsiI CCGC 1 cut(s) 296
SspMI CTAG 3 cut(s) 36, 224, 279
StyD4I CCNGG 1 cut(s) 383
StyI CCWWGG 2 cut(s) 78, 307
TaiI ACGT 2 cut(s) 142, 466
TasI AATT 5 cut(s) 118, 428, 510, 529, 540
TauI GCSGC 1 cut(s) 299
TfiI GAWTC 3 cut(s) 166, 312, 338
Tru1I TTAA 7 cut(s) 69, 122, 135, 155, 393, 401, 539
Tru9I TTAA 7 cut(s) 69, 122, 135, 155, 393, 401, 539
TseI GCWGC 1 cut(s) 227
TspDTI ATGAA 2 cut(s) 219, 281
TspGWI ACGGA 2 cut(s) 44, 458
Vha464I CTTAAG 1 cut(s) 392
XapI RAATTY 3 cut(s) 118, 428, 529
XceI RCATGY 1 cut(s) 234
XspI CTAG 3 cut(s) 36, 224, 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.