pycom11g15380

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
16100964 .. 16101257
294 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 294 bp
ATGGAGACAATGACTGCTTGTTGCCTTACTTTAGGTCTGTGGCTGAAGCTGGTTTGGGAGGGAAAGAAAGCCAAGTTATGTGGGGTTCACACTATGGTTTGGAAGGGAAAGAAAGCTAGGGTAATGTGGGGCACTATGATCGTCACTTTGTTTTGGGTGGTTTGGATGAAGAGGAATAGAAGGATTTTTGAAGATTTCGTGGGAGCTATTGGAAAGCTGCTATCTCTTGGTTCGTTAGCAGTTTTTAGAGTTTGGTTGTTTCTTTTTTGTTTTGTTCGGGCTGTAGCCTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.23

Weight (kDa)

10.15

Isoelectric Point (pI)

25.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000204)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G04625 AT1G27220 AT1G27250 AT1G27870 AT1G47497 AT1G47497 AT1G50160 AT1G52990 AT1G52990 AT1G77815 AT2G02650 AT2G04420 AT2G11205 AT2G13980 AT2G33160 AT2G46460 AT3G09510 AT3G23320 AT3G25270 AT3G32130 AT4G03292 AT4G09775 AT5G26617 AT5G44470 AT5G52115 AT5G65005
fragaria_vesca FvH4_1g25222 FvH4_1g28481 FvH4_3g03751 FvH4_3g24081 FvH4_3g35341 FvH4_5g31961 FvH4_6g20891 FvH4_6g23253 FvH4_6g31361 FvH4_6g53051
malus_domestica MD14G1209300.v1.1
prunus_persica Prupe.1G168800_v2.0.a1 Prupe.1G509200_v2.0.a1 Prupe.2G042000_v2.0.a1 Prupe.2G133200_v2.0.a1 Prupe.2G140300_v2.0.a1 Prupe.3G103800_v2.0.a1 Prupe.4G217300_v2.0.a1 Prupe.4G245300_v2.0.a1 Prupe.5G002600_v2.0.a1 Prupe.5G134600_v2.0.a1 Prupe.6G185900_v2.0.a1 Prupe.6G308300_v2.0.a1 Prupe.7G010700_v2.0.a1 Prupe.8G078100_v2.0.a1 Prupe.8G128400_v2.0.a1
pyrus_communis pycom01g14230 pycom03g12410 pycom08g15160 pycom08g21670 pycom10g25730 pycom10g25740 pycom11g15380 pycom14g10440 pycom14g11510 pycom15g31840 pycom16g02370
rosa_chinensis RchiOBHm_Chr4g0440421 RchiOBHm_Chr5g0005841 RchiOBHm_Chr6g0289481 RchiOBHm_Chr7g0218671
rosa_laevigata RLG00000011653 RLG00000031330 RLG00000031331 RLG00000032722
rosa_multiflora Rmu_co8243061.1_g000001 Rmu_sc0000470.1_g000036 Rmu_sc0000581.1_g000008 Rmu_sc0000666.1_g000017 Rmu_sc0000905.1_g000019 Rmu_sc0000976.1_g000013 Rmu_sc0001066.1_g000001 Rmu_sc0001103.1_g000007 Rmu_sc0001180.1_g000001 Rmu_sc0001643.1_g000034 Rmu_sc0001759.1_g000007 Rmu_sc0001850.1_g000051 Rmu_sc0001910.1_g000008 Rmu_sc0001981.1_g000015 Rmu_sc0001981.1_g000029 Rmu_sc0002209.1_g000015 Rmu_sc0002406.1_g000010 Rmu_sc0003743.1_g000002 Rmu_sc0006416.1_g000026 Rmu_sc0006513.1_g000006 Rmu_sc0006577.1_g000010 Rmu_sc0014652.1_g000001 Rmu_sc0016202.1_g000003
rosa_roxburghii Rroxscaffold_1G00001530 Rroxscaffold_1G00047250 Rroxscaffold_5G00340720 Rroxscaffold_7G00171110 Rroxscaffold_7G00177650
rosa_rugosa Rorug01G0044800 Rorug01G0204500 Rorug01G0224700 Rorug01G0267800 Rorug02G0038400 Rorug02G0107100 Rorug02G0180700 Rorug02G0363800 Rorug02G0374300 Rorug02G0491400 Rorug02G0491400 Rorug03G0104200 Rorug03G0109800 Rorug03G0334200 Rorug04G0007100 Rorug04G0061400.1 Rorug04G0080000 Rorug05G0152200 Rorug05G0188800 Rorug05G0234800 Rorug05G0239900 Rorug05G0284800 Rorug06G0044700 Rorug06G0205700 Rorug06G0266900 Rorug06G0440700 Rorug07G0037400 Rorug07G0192100 Rorug07G0196900 Rorug07G0237500 Rorug07G0336400.1 RorugPtG0002500.1
rosa_samantha Rh1BG014800 Rh1CG017500 Rh2CG332500 Rh3BG371800 Rh5AG046000 Rh5AG046100 Rh5BG044700 Rh5BG044800 Rh5BG248000 Rh5CG053600 Rh5CG053700 Rh5DG044500 Rh5DG044600 Rh6AG052800 Rh6AG315400 Rh6DG021400 Rh7AG409500
rosa_wichuraiana Rw3G007750 Rw3G018750 Rw4G008820 Rw5G004630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 65
AgsI TTSAA 1 cut(s) 191
AluBI AGCT 4 cut(s) 49, 116, 206, 217
AluI AGCT 4 cut(s) 49, 116, 206, 217
ApeKI GCWGC 1 cut(s) 217
BaeGI GKGCMC 1 cut(s) 134
BbvI GCAGC 1 cut(s) 204
BcgI CGANNNNNNTGC 2 cut(s) 121, 155
BfaI CTAG 2 cut(s) 117, 292
BfmI CTRYAG 1 cut(s) 282
BisI GCNGC 1 cut(s) 218
BlsI GCNGC 1 cut(s) 219
BseGI GGATG 1 cut(s) 171
BseSI GKGCMC 1 cut(s) 134
BseXI GCAGC 1 cut(s) 204
Bsp1286I GDGCHC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 138
BssMI GATC 1 cut(s) 138
Bst6I CTCTTC 1 cut(s) 164
BstC8I GCNNGC 1 cut(s) 289
BstF5I GGATG 1 cut(s) 171
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstSFI CTRYAG 1 cut(s) 282
BstSLI GKGCMC 1 cut(s) 134
BstV1I GCAGC 1 cut(s) 204
BtsCI GGATG 1 cut(s) 171
Cac8I GCNNGC 1 cut(s) 289
CspCI CAANNNNNGTGG 2 cut(s) 61, 96
CviJI RGCY 8 cut(s) 43, 49, 71, 116, 206, 217, 281, 287
CviKI_1 RGCY 8 cut(s) 43, 49, 71, 116, 206, 217, 281, 287
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
Eam1104I CTCTTC 1 cut(s) 164
EarI CTCTTC 1 cut(s) 164
Eco57I CTGAAG 1 cut(s) 65
FaiI YATR 3 cut(s) 79, 95, 137
Fnu4HI GCNGC 1 cut(s) 218
FokI GGATG 1 cut(s) 178
Fsp4HI GCNGC 1 cut(s) 218
FspBI CTAG 2 cut(s) 117, 292
GluI GCNGC 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 88
HpyAV CCTTC 2 cut(s) 97, 174
Kzo9I GATC 1 cut(s) 138
LmnI GCTCC 1 cut(s) 203
LpnPI CCDG 1 cut(s) 35
Lsp1109I GCAGC 1 cut(s) 204
MaeI CTAG 2 cut(s) 117, 292
MaeIII GTNAC 1 cut(s) 142
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MboII GAAGA 2 cut(s) 181, 203
MhlI GDGCHC 1 cut(s) 134
MnlI CCTC 2 cut(s) 52, 165
NdeII GATC 1 cut(s) 138
NmuCI GTSAC 1 cut(s) 142
PkrI GCNGC 1 cut(s) 219
SatI GCNGC 1 cut(s) 218
Sau3AI GATC 1 cut(s) 138
SduI GDGCHC 1 cut(s) 134
SetI ASST 5 cut(s) 37, 51, 118, 208, 219
SfcI CTRYAG 1 cut(s) 282
SgeI CNNG 7 cut(s) 30, 62, 85, 129, 211, 239, 290
SspMI CTAG 2 cut(s) 117, 292
TseFI GTSAC 1 cut(s) 142
TseI GCWGC 1 cut(s) 217
Tsp45I GTSAC 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 182
XspI CTAG 2 cut(s) 117, 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.