Rmu_co8058818.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8058818.1
OG0000150
Physical Location & Seq
Reverse (-)
1 .. 512
512 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8058818.1_g000001.1.cds

Sequence Viewer

Length: 490 bp
atgttaaatgaaatcaagtggccttatcgctcgcccttcagacccaccgatgcatttttctttgacacaagtaacttagactctgatgttcagcagatctctccgcctaaaacacccaagacatggtctgcagttatatctgcatatggaatgctttattatcttgcacaaccaacatgcttcccatatattaatgaacattcgtttgagcgatatgatcccaccagcgattcttgggagtcgttgccttcgtatccaggttattctctagaccagttccaaacgatgatatcaggtcatgctgtttgttatggttatatattaatttcaatgattggtgaagaggaatgtctaatggtggcttttcatattggtacaaaaacatggcataaggtcaagcttagtaaatcggtggaagatttgcatgatggtttctggggtagggctgtggttgtagataatgttatctatgccctatcatctagtttcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

163

Amino Acids

18.69

Weight (kDa)

5.05

Isoelectric Point (pI)

44.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000150)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g02900 FvH4_5g02920 FvH4_5g15972 FvH4_5g25390 FvH4_7g13450 FvH4_7g13450 FvH4_7g27631 FvH4_7g27640 FvH4_7g27660 FvH4_7g27670 FvH4_7g27710 FvH4_7g27720
malus_domestica MD06G1078700.v1.1 MD06G1178900.v1.1 MD06G1179300.v1.1 MD06G1179400.v1.1 MD14G1191500.v1.1 MD14G1191600.v1.1 MD16G1080700.v1.1 MD17G1269500.v1.1
prunus_persica Prupe.1G178900_v2.0.a1 Prupe.2G232100_v2.0.a1 Prupe.3G199300_v2.0.a1 Prupe.3G199700_v2.0.a1 Prupe.3G199700_v2.0.a1 Prupe.3G199800_v2.0.a1 Prupe.5G121900_v2.0.a1 Prupe.5G149900_v2.0.a1 Prupe.5G149900_v2.0.a1 Prupe.5G150200_v2.0.a1 Prupe.5G179400_v2.0.a1 Prupe.5G179400_v2.0.a1 Prupe.5G190200_v2.0.a1 Prupe.5G190300_v2.0.a1 Prupe.5G190500_v2.0.a1 Prupe.5G190600_v2.0.a1 Prupe.5G190700_v2.0.a1 Prupe.5G190800_v2.0.a1 Prupe.5G196400_v2.0.a1 Prupe.5G196500_v2.0.a1 Prupe.5G196600_v2.0.a1 Prupe.5G196700_v2.0.a1 Prupe.5G196800_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.7G215400_v2.0.a1 Prupe.7G215500_v2.0.a1 Prupe.7G215500_v2.0.a1 Prupe.8G014700_v2.0.a1 Prupe.8G014700_v2.0.a1 Prupe.I003600_v2.0.a1
pyrus_communis pycom06g15900 pycom06g15930
rosa_chinensis RchiOBHm_Chr1g0378721 RchiOBHm_Chr1g0379031 RchiOBHm_Chr1g0379041 RchiOBHm_Chr1g0379111 RchiOBHm_Chr1g0379231 RchiOBHm_Chr1g0379381 RchiOBHm_Chr7g0205711 RchiOBHm_Chr7g0219841
rosa_laevigata RLG00000002638 RLG00000002641 RLG00000003360 RLG00000003362 RLG00000003364 RLG00000003972 RLG00000003975 RLG00000003976 RLG00000005302 RLG00000005303 RLG00000026142 RLG00000026318 RLG00000026378 RLG00000026379 RLG00000026396 RLG00000026404 RLG00000026405 RLG00000026412 RLG00000026413 RLG00000026766 RLG00000026768 RLG00000026774 RLG00000026775 RLG00000026776 RLG00000026778 RLG00000026779 RLG00000033034
rosa_multiflora Rmu_co8058818.1_g000001 Rmu_co8428857.1_g000001 Rmu_sc0000556.1_g000004 Rmu_sc0000556.1_g000017 Rmu_sc0000556.1_g000023 Rmu_sc0000556.1_g000038 Rmu_sc0000556.1_g000044 Rmu_sc0000556.1_g000046 Rmu_sc0000634.1_g000002 Rmu_sc0001232.1_g000027 Rmu_sc0003964.1_g000004 Rmu_sc0003964.1_g000013 Rmu_sc0006124.1_g000015 Rmu_sc0006761.1_g000020 Rmu_sc0006761.1_g000023 Rmu_sc0015070.1_g000001 Rmu_sc0017925.1_g000001 Rmu_sc0031430.1_g000005 Rmu_ssc0000119.1_g000014
rosa_roxburghii Rroxscaffold_2G00080740 Rroxscaffold_2G00090730 Rroxscaffold_3G00227790 Rroxscaffold_3G00235420 Rroxscaffold_3G00243990 Rroxscaffold_3G00244010 Rroxscaffold_3G00252040 Rroxscaffold_3G00252060 Rroxscaffold_3G00258760 Rroxscaffold_3G00258780 Rroxscaffold_3G00258790 Rroxscaffold_4G00280120 Rroxscaffold_4G00280210 Rroxscaffold_4G00280240 Rroxscaffold_4G00280300 Rroxscaffold_4G00280310 Rroxscaffold_5G00348380 Rroxscaffold_5G00352440 Rroxscaffold_5G00381760 Rroxscaffold_5G00381770 Rroxscaffold_7G00205800 Rroxscaffold_7G00205810 Rroxscaffold_7G00205850
rosa_rugosa Rorug01G0410800.1 Rorug01G0411700 Rorug01G0412500 Rorug06G0429700 Rorug07G0155400 Rorug07G0155600
rosa_samantha Rh1AG394500 Rh1AG433000 Rh1AG433600 Rh1AG434900 Rh1AG435200 Rh1BG359100 Rh1BG391200 Rh1BG392000 Rh1BG392700 Rh1BG399000 Rh1BG420100 Rh1BG420200 Rh1CG372200 Rh1CG403900 Rh1CG404800 Rh1CG412400 Rh1DG389700 Rh1DG389800 Rh1DG422400 Rh1DG423000 Rh1DG423500 Rh1DG452800 Rh1DG452900 Rh2AG541500 Rh2AG627500 Rh2BG637600 Rh2BG637700 Rh2CG524200 Rh2DG563600 Rh2DG563700 Rh2DG649200 Rh5CG213000 Rh6DG081900 Rh7AG030200 Rh7AG223700 Rh7AG224100 Rh7BG029600 Rh7BG030900 Rh7BG218800 Rh7BG283400 Rh7BG283700 Rh7BG283900 Rh7BG284100 Rh7BG284500 Rh7CG031200 Rh7CG031300 Rh7CG237000 Rh7CG237600 Rh7CG312000 Rh7DG030500 Rh7DG230800
rosa_wichuraiana Rw1G037920 Rw1G037950 Rw1G040890 Rw7G019300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 123
AciI CCGC 1 cut(s) 104
AclWI GGATC 1 cut(s) 212
AcuI CTGAAG 1 cut(s) 22
AfaI GTAC 1 cut(s) 376
AfiI CCNNNNNNNGG 1 cut(s) 123
AgsI TTSAA 1 cut(s) 330
AjnI CCWGG 1 cut(s) 256
AluBI AGCT 1 cut(s) 400
AluI AGCT 1 cut(s) 400
AlwI GGATC 1 cut(s) 212
AoxI GGCC 1 cut(s) 20
AseI ATTAAT 2 cut(s) 192, 323
AsuHPI GGTGA 1 cut(s) 350
BccI CCATC 1 cut(s) 422
BciT130I CCWGG 1 cut(s) 258
BciVI GTATCC 1 cut(s) 264
BfaI CTAG 2 cut(s) 269, 483
BfmI CTRYAG 1 cut(s) 129
BfuI GTATCC 1 cut(s) 264
BglII AGATCT 1 cut(s) 96
Bme1390I CCNGG 1 cut(s) 258
BmrFI CCNGG 1 cut(s) 258
BmsI GCATC 1 cut(s) 40
Bsc4I CCNNNNNNNGG 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 274
BseBI CCWGG 1 cut(s) 258
BseLI CCNNNNNNNGG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 274
BshFI GGCC 1 cut(s) 22
BslI CCNNNNNNNGG 1 cut(s) 123
BsmI GAATGC 1 cut(s) 156
BsnI GGCC 1 cut(s) 22
Bsp143I GATC 2 cut(s) 96, 217
BspACI CCGC 1 cut(s) 104
BspANI GGCC 1 cut(s) 22
BspMAI CTGCAG 1 cut(s) 133
BspPI GGATC 1 cut(s) 212
BsrI ACTGG 1 cut(s) 274
BssMI GATC 2 cut(s) 96, 217
Bst2UI CCWGG 1 cut(s) 258
Bst6I CTCTTC 1 cut(s) 336
BstC8I GCNNGC 1 cut(s) 32
BstDEI CTNAG 2 cut(s) 76, 401
BstKTI GATC 2 cut(s) 99, 220
BstMBI GATC 2 cut(s) 96, 217
BstNI CCWGG 1 cut(s) 258
BstNSI RCATGY 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 256
BstSFI CTRYAG 1 cut(s) 129
BstX2I RGATCY 1 cut(s) 96
BstYI RGATCY 1 cut(s) 96
BsuI GTATCC 1 cut(s) 264
BsuRI GGCC 1 cut(s) 22
Cac8I GCNNGC 1 cut(s) 32
Csp6I GTAC 1 cut(s) 375
CviAII CATG 5 cut(s) 123, 177, 299, 384, 425
CviJI RGCY 4 cut(s) 22, 362, 400, 446
CviKI_1 RGCY 4 cut(s) 22, 362, 400, 446
CviQI GTAC 1 cut(s) 375
DdeI CTNAG 2 cut(s) 76, 401
DpnI GATC 2 cut(s) 98, 219
DpnII GATC 2 cut(s) 96, 217
Eam1104I CTCTTC 1 cut(s) 336
EarI CTCTTC 1 cut(s) 336
EciI GGCGGA 1 cut(s) 93
Eco32I GATATC 1 cut(s) 291
Eco57I CTGAAG 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 256
EcoRV GATATC 1 cut(s) 291
EcoT22I ATGCAT 1 cut(s) 55
FaeI CATG 5 cut(s) 126, 180, 302, 387, 428
FatI CATG 5 cut(s) 122, 176, 298, 383, 424
FauNDI CATATG 1 cut(s) 145
FspBI CTAG 2 cut(s) 269, 483
HaeIII GGCC 1 cut(s) 22
Hin1II CATG 5 cut(s) 126, 180, 302, 387, 428
HindIII AAGCTT 1 cut(s) 398
HinfI GANTC 3 cut(s) 80, 230, 239
HphI GGTGA 1 cut(s) 350
Hpy188I TCNGA 2 cut(s) 41, 85
Hpy188III TCNNGA 1 cut(s) 269
HpyAV CCTTC 2 cut(s) 46, 258
HpyCH4V TGCA 5 cut(s) 53, 131, 143, 167, 424
HpyF3I CTNAG 2 cut(s) 76, 401
Hsp92II CATG 5 cut(s) 126, 180, 302, 387, 428
Kzo9I GATC 2 cut(s) 96, 217
LpnPI CCDG 6 cut(s) 238, 243, 270, 279, 287, 421
LweI GCATC 1 cut(s) 40
MaeI CTAG 2 cut(s) 269, 483
MaeIII GTNAC 1 cut(s) 71
MalI GATC 2 cut(s) 98, 219
MboI GATC 2 cut(s) 96, 217
MboII GAAGA 2 cut(s) 353, 428
MflI RGATCY 1 cut(s) 96
MluCI AATT 1 cut(s) 324
MlyI GAGTC 2 cut(s) 74, 248
MnlI CCTC 1 cut(s) 337
Mph1103I ATGCAT 1 cut(s) 55
MseI TTAA 3 cut(s) 5, 192, 323
MspR9I CCNGG 1 cut(s) 258
Mva1269I GAATGC 1 cut(s) 156
MvaI CCWGG 1 cut(s) 258
NdeI CATATG 1 cut(s) 145
NdeII GATC 2 cut(s) 96, 217
NlaIII CATG 5 cut(s) 126, 180, 302, 387, 428
NsiI ATGCAT 1 cut(s) 55
NspI RCATGY 1 cut(s) 180
PcsI WCGNNNNNNNCGW 1 cut(s) 248
PctI GAATGC 1 cut(s) 156
PfeI GAWTC 1 cut(s) 230
PflFI GACNNNGTC 1 cut(s) 124
PflMI CCANNNNNTGG 1 cut(s) 123
PleI GAGTC 2 cut(s) 74, 247
PpsI GAGTC 2 cut(s) 74, 247
PshBI ATTAAT 2 cut(s) 192, 323
Psp6I CCWGG 1 cut(s) 256
PspGI CCWGG 1 cut(s) 256
PstI CTGCAG 1 cut(s) 133
PsuI RGATCY 1 cut(s) 96
PsyI GACNNNGTC 1 cut(s) 124
RsaI GTAC 1 cut(s) 376
RsaNI GTAC 1 cut(s) 375
SaqAI TTAA 3 cut(s) 5, 192, 323
Sau3AI GATC 2 cut(s) 96, 217
SchI GAGTC 2 cut(s) 74, 248
ScrFI CCNGG 1 cut(s) 258
SetI ASST 4 cut(s) 262, 298, 396, 402
SfaNI GCATC 1 cut(s) 40
SfcI CTRYAG 1 cut(s) 129
Sse9I AATT 1 cut(s) 324
SsiI CCGC 1 cut(s) 104
SspMI CTAG 2 cut(s) 269, 483
StyD4I CCNGG 1 cut(s) 256
TasI AATT 1 cut(s) 324
TfiI GAWTC 1 cut(s) 230
Tru1I TTAA 3 cut(s) 5, 192, 323
Tru9I TTAA 3 cut(s) 5, 192, 323
TspDTI ATGAA 3 cut(s) 24, 210, 356
Tth111I GACNNNGTC 1 cut(s) 124
Van91I CCANNNNNTGG 1 cut(s) 123
VspI ATTAAT 2 cut(s) 192, 323
XbaI TCTAGA 1 cut(s) 268
XceI RCATGY 1 cut(s) 180
XspI CTAG 2 cut(s) 269, 483
Zsp2I ATGCAT 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.