Rh1BG399000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0000150
Physical Location & Seq
Reverse (-)
52285877 .. 52286359
483 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG399000.1

Sequence Viewer

Length: 483 bp
ATGCCAAAGCCGTCGTTTGAGTGTTATGATCCAACCACCAATTCTTGGCGATGCTTGCCTCCTTGTCCGTATAAGACAATGCCTGGCCCAAGCAAGGAGATAGTTGGTTTTGCTGTTTGTTATGGCTACATATTGATTTCATTTTACAACCGCCAGGAATCCTCAGCGATAGCTTTTCATATTGATACACAAAAGTGGCATCCAGTCCAAGTCTGCCAGTCCAAAAACGCATATCCTTTCCGAGGGAGGGCTGTGGTTGTAGGTGGTATGGTCTATGCTGTTTCTTGGTGTCAATATATGTGTCCCACCGAATTTCAAATCATTCGCAAAGGAGGAGCAATGGAGGTCAGGACCTTTCATTCAACTGTTTATCAAGTCAACATCAAGGGTGGTTTTTTTTATGTTAACTTCGCCTTTACACCAGATTGTGAGGATATTGAACCAGAAGAAGATGATTGTCCGACTGCACCGGCCAAAGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

160

Amino Acids

18.14

Weight (kDa)

6.28

Isoelectric Point (pI)

60.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000150)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g02900 FvH4_5g02920 FvH4_5g15972 FvH4_5g25390 FvH4_7g13450 FvH4_7g13450 FvH4_7g27631 FvH4_7g27640 FvH4_7g27660 FvH4_7g27670 FvH4_7g27710 FvH4_7g27720
malus_domestica MD06G1078700.v1.1 MD06G1178900.v1.1 MD06G1179300.v1.1 MD06G1179400.v1.1 MD14G1191500.v1.1 MD14G1191600.v1.1 MD16G1080700.v1.1 MD17G1269500.v1.1
prunus_persica Prupe.1G178900_v2.0.a1 Prupe.2G232100_v2.0.a1 Prupe.3G199300_v2.0.a1 Prupe.3G199700_v2.0.a1 Prupe.3G199700_v2.0.a1 Prupe.3G199800_v2.0.a1 Prupe.5G121900_v2.0.a1 Prupe.5G149900_v2.0.a1 Prupe.5G149900_v2.0.a1 Prupe.5G150200_v2.0.a1 Prupe.5G179400_v2.0.a1 Prupe.5G179400_v2.0.a1 Prupe.5G190200_v2.0.a1 Prupe.5G190300_v2.0.a1 Prupe.5G190500_v2.0.a1 Prupe.5G190600_v2.0.a1 Prupe.5G190700_v2.0.a1 Prupe.5G190800_v2.0.a1 Prupe.5G196400_v2.0.a1 Prupe.5G196500_v2.0.a1 Prupe.5G196600_v2.0.a1 Prupe.5G196700_v2.0.a1 Prupe.5G196800_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.7G215400_v2.0.a1 Prupe.7G215500_v2.0.a1 Prupe.7G215500_v2.0.a1 Prupe.8G014700_v2.0.a1 Prupe.8G014700_v2.0.a1 Prupe.I003600_v2.0.a1
pyrus_communis pycom06g15900 pycom06g15930
rosa_chinensis RchiOBHm_Chr1g0378721 RchiOBHm_Chr1g0379031 RchiOBHm_Chr1g0379041 RchiOBHm_Chr1g0379111 RchiOBHm_Chr1g0379231 RchiOBHm_Chr1g0379381 RchiOBHm_Chr7g0205711 RchiOBHm_Chr7g0219841
rosa_laevigata RLG00000002638 RLG00000002641 RLG00000003360 RLG00000003362 RLG00000003364 RLG00000003972 RLG00000003975 RLG00000003976 RLG00000005302 RLG00000005303 RLG00000026142 RLG00000026318 RLG00000026378 RLG00000026379 RLG00000026396 RLG00000026404 RLG00000026405 RLG00000026412 RLG00000026413 RLG00000026766 RLG00000026768 RLG00000026774 RLG00000026775 RLG00000026776 RLG00000026778 RLG00000026779 RLG00000033034
rosa_multiflora Rmu_co8058818.1_g000001 Rmu_co8428857.1_g000001 Rmu_sc0000556.1_g000004 Rmu_sc0000556.1_g000017 Rmu_sc0000556.1_g000023 Rmu_sc0000556.1_g000038 Rmu_sc0000556.1_g000044 Rmu_sc0000556.1_g000046 Rmu_sc0000634.1_g000002 Rmu_sc0001232.1_g000027 Rmu_sc0003964.1_g000004 Rmu_sc0003964.1_g000013 Rmu_sc0006124.1_g000015 Rmu_sc0006761.1_g000020 Rmu_sc0006761.1_g000023 Rmu_sc0015070.1_g000001 Rmu_sc0017925.1_g000001 Rmu_sc0031430.1_g000005 Rmu_ssc0000119.1_g000014
rosa_roxburghii Rroxscaffold_2G00080740 Rroxscaffold_2G00090730 Rroxscaffold_3G00227790 Rroxscaffold_3G00235420 Rroxscaffold_3G00243990 Rroxscaffold_3G00244010 Rroxscaffold_3G00252040 Rroxscaffold_3G00252060 Rroxscaffold_3G00258760 Rroxscaffold_3G00258780 Rroxscaffold_3G00258790 Rroxscaffold_4G00280120 Rroxscaffold_4G00280210 Rroxscaffold_4G00280240 Rroxscaffold_4G00280300 Rroxscaffold_4G00280310 Rroxscaffold_5G00348380 Rroxscaffold_5G00352440 Rroxscaffold_5G00381760 Rroxscaffold_5G00381770 Rroxscaffold_7G00205800 Rroxscaffold_7G00205810 Rroxscaffold_7G00205850
rosa_rugosa Rorug01G0410800.1 Rorug01G0411700 Rorug01G0412500 Rorug06G0429700 Rorug07G0155400 Rorug07G0155600
rosa_samantha Rh1AG394500 Rh1AG433000 Rh1AG433600 Rh1AG434900 Rh1AG435200 Rh1BG359100 Rh1BG391200 Rh1BG392000 Rh1BG392700 Rh1BG399000 Rh1BG420100 Rh1BG420200 Rh1CG372200 Rh1CG403900 Rh1CG404800 Rh1CG412400 Rh1DG389700 Rh1DG389800 Rh1DG422400 Rh1DG423000 Rh1DG423500 Rh1DG452800 Rh1DG452900 Rh2AG541500 Rh2AG627500 Rh2BG637600 Rh2BG637700 Rh2CG524200 Rh2DG563600 Rh2DG563700 Rh2DG649200 Rh5CG213000 Rh6DG081900 Rh7AG030200 Rh7AG223700 Rh7AG224100 Rh7BG029600 Rh7BG030900 Rh7BG218800 Rh7BG283400 Rh7BG283700 Rh7BG283900 Rh7BG284100 Rh7BG284500 Rh7CG031200 Rh7CG031300 Rh7CG237000 Rh7CG237600 Rh7CG312000 Rh7DG030500 Rh7DG230800
rosa_wichuraiana Rw1G037920 Rw1G037950 Rw1G040890 Rw7G019300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 45
AciI CCGC 1 cut(s) 151
AclWI GGATC 1 cut(s) 23
AcoI YGGCCR 1 cut(s) 471
AcsI RAATTY 1 cut(s) 311
AfiI CCNNNNNNNGG 4 cut(s) 45, 94, 242, 247
AgsI TTSAA 3 cut(s) 317, 363, 440
AjnI CCWGG 2 cut(s) 82, 153
AjuI GAANNNNNNNTTGG 2 cut(s) 25, 57
AleI CACNNNNGTG 1 cut(s) 193
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
AlwI GGATC 1 cut(s) 23
AoxI GGCC 2 cut(s) 85, 471
ApoI RAATTY 1 cut(s) 311
AspS9I GGNCC 2 cut(s) 86, 351
AvaII GGWCC 1 cut(s) 351
BbvCI CCTCAGC 1 cut(s) 163
BciT130I CCWGG 2 cut(s) 84, 155
BfaI CTAG 1 cut(s) 481
Bme1390I CCNGG 2 cut(s) 84, 155
Bme18I GGWCC 1 cut(s) 351
BmgT120I GGNCC 2 cut(s) 86, 351
BmrFI CCNGG 2 cut(s) 84, 155
BmsI GCATC 2 cut(s) 41, 208
Bpu10I CCTNAGC 1 cut(s) 163
BsaJI CCNNGG 1 cut(s) 241
Bsc4I CCNNNNNNNGG 4 cut(s) 45, 94, 242, 247
Bse118I RCCGGY 1 cut(s) 469
Bse1I ACTGG 2 cut(s) 203, 217
Bse3DI GCAATG 1 cut(s) 345
BseBI CCWGG 2 cut(s) 84, 155
BseDI CCNNGG 1 cut(s) 241
BseGI GGATG 1 cut(s) 199
BseLI CCNNNNNNNGG 4 cut(s) 45, 94, 242, 247
BseMI GCAATG 1 cut(s) 345
BseMII CTCAG 1 cut(s) 177
BseNI ACTGG 2 cut(s) 203, 217
BseRI GAGGAG 1 cut(s) 348
BsgI GTGCAG 1 cut(s) 450
BshFI GGCC 2 cut(s) 87, 473
BsiSI CCGG 1 cut(s) 470
BslFI GGGAC 1 cut(s) 288
BslI CCNNNNNNNGG 4 cut(s) 45, 94, 242, 247
BsmFI GGGAC 1 cut(s) 288
BsnI GGCC 2 cut(s) 87, 473
Bsp143I GATC 1 cut(s) 28
BspACI CCGC 1 cut(s) 151
BspANI GGCC 2 cut(s) 87, 473
BspCNI CTCAG 1 cut(s) 176
BspPI GGATC 1 cut(s) 23
BsrDI GCAATG 1 cut(s) 345
BsrFI RCCGGY 1 cut(s) 469
BsrI ACTGG 2 cut(s) 203, 217
BssAI RCCGGY 1 cut(s) 469
BssECI CCNNGG 1 cut(s) 241
BssMI GATC 1 cut(s) 28
Bst2UI CCWGG 2 cut(s) 84, 155
Bst4CI ACNGT 1 cut(s) 367
BstC8I GCNNGC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 163
BstENI CCTNNNNNAGG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstNI CCWGG 2 cut(s) 84, 155
BstSCI CCNGG 2 cut(s) 82, 153
BsuRI GGCC 2 cut(s) 87, 473
BtgZI GCGATG 1 cut(s) 64
BtsCI GGATG 1 cut(s) 199
Cac8I GCNNGC 1 cut(s) 56
Cfr10I RCCGGY 1 cut(s) 469
Cfr13I GGNCC 2 cut(s) 86, 351
CviJI RGCY 7 cut(s) 10, 87, 126, 173, 251, 473, 479
CviKI_1 RGCY 7 cut(s) 10, 87, 126, 173, 251, 473, 479
DdeI CTNAG 1 cut(s) 163
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
EaeI YGGCCR 1 cut(s) 471
Eco47I GGWCC 1 cut(s) 351
EcoNI CCTNNNNNAGG 1 cut(s) 240
EcoO109I RGGNCCY 1 cut(s) 351
EcoRII CCWGG 2 cut(s) 82, 153
FaqI GGGAC 1 cut(s) 288
FokI GGATG 1 cut(s) 186
FspBI CTAG 1 cut(s) 481
HaeIII GGCC 2 cut(s) 87, 473
HapII CCGG 1 cut(s) 470
HincII GTYRAC 2 cut(s) 379, 406
HindII GTYRAC 2 cut(s) 379, 406
HinfI GANTC 1 cut(s) 158
HpaI GTTAAC 1 cut(s) 406
HpaII CCGG 1 cut(s) 470
Hpy166II GTNNAC 2 cut(s) 379, 406
Hpy188I TCNGA 2 cut(s) 242, 462
Hpy188III TCNNGA 1 cut(s) 349
Hpy8I GTNNAC 2 cut(s) 379, 406
Hpy99I CGWCG 1 cut(s) 16
HpyCH4III ACNGT 1 cut(s) 367
HpyCH4V TGCA 1 cut(s) 467
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
HpyF3I CTNAG 1 cut(s) 163
KspAI GTTAAC 1 cut(s) 406
Kzo9I GATC 1 cut(s) 28
LmnI GCTCC 1 cut(s) 335
LpnPI CCDG 9 cut(s) 69, 96, 140, 167, 216, 230, 334, 435, 456
LweI GCATC 2 cut(s) 41, 208
MaeI CTAG 1 cut(s) 481
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MboII GAAGA 2 cut(s) 458, 461
MluCI AATT 2 cut(s) 40, 311
MmeI TCCRAC 1 cut(s) 56
MnlI CCTC 7 cut(s) 69, 172, 236, 240, 326, 337, 424
MseI TTAA 1 cut(s) 405
MslI CAYNNNNRTG 1 cut(s) 193
MspI CCGG 1 cut(s) 470
MspR9I CCNGG 2 cut(s) 84, 155
MvaI CCWGG 2 cut(s) 84, 155
MwoI GCNNNNNNNGC 1 cut(s) 55
NdeII GATC 1 cut(s) 28
OliI CACNNNNGTG 1 cut(s) 193
PfeI GAWTC 1 cut(s) 158
PflMI CCANNNNNTGG 1 cut(s) 45
PpuMI RGGWCCY 1 cut(s) 351
Psp5II RGGWCCY 1 cut(s) 351
Psp6I CCWGG 2 cut(s) 82, 153
PspGI CCWGG 2 cut(s) 82, 153
PspPI GGNCC 2 cut(s) 86, 351
PspPPI RGGWCCY 1 cut(s) 351
RseI CAYNNNNRTG 1 cut(s) 193
SaqAI TTAA 1 cut(s) 405
Sau3AI GATC 1 cut(s) 28
Sau96I GGNCC 2 cut(s) 86, 351
ScrFI CCNGG 2 cut(s) 84, 155
SetI ASST 4 cut(s) 175, 265, 348, 356
SfaNI GCATC 2 cut(s) 41, 208
SinI GGWCC 1 cut(s) 351
SmiMI CAYNNNNRTG 1 cut(s) 193
Sse9I AATT 2 cut(s) 40, 311
SsiI CCGC 1 cut(s) 151
SspMI CTAG 1 cut(s) 481
StyD4I CCNGG 2 cut(s) 82, 153
TaaI ACNGT 1 cut(s) 367
TasI AATT 2 cut(s) 40, 311
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 405
Tru9I TTAA 1 cut(s) 405
TspDTI ATGAA 3 cut(s) 129, 167, 347
TspGWI ACGGA 1 cut(s) 57
Van91I CCANNNNNTGG 1 cut(s) 45
VpaK11BI GGWCC 1 cut(s) 351
XagI CCTNNNNNAGG 1 cut(s) 240
XapI RAATTY 1 cut(s) 311
XspI CTAG 1 cut(s) 481
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.