Rh2AG627500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0000150
Physical Location & Seq
Reverse (-)
85275073 .. 85291980
16908 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG627500.1

Sequence Viewer

Length: 561 bp
ATGCTCAGTCTAATCCCATCGTCCACCCCGTTGACCCACCTCACGGTTCCAGTTCGCCCTCCACTCAATCACCGCGTCGCGTCAACTCCTTCTCCTTCTAGTCCTACTTCCCCTCGTTTACCACCCCTGCAACCTGGTGTCTCCCCGTCCCTACCACACCCACAACCAGTTGGTCCTGCTGCTGCTCCAGATTGCGTCGCTGCCTCCCAAACGCCACCATCGGACTGCAAGGATATTGAACCAGAAGAACAATACTGTCCAACTGCATCAGCTGGAAGTAAAAGTGAAAGTGCATTGACTTCAGAAGAAAAAGGAAATAAAGATCATTGTAGGGACTGCAAGGATATTGAACCAGAAGAACAATACTGTCCAACTGCATCAGCTGGAAGTAAAAGTGAAAGTGCATTGACTTCAGAAGAAAAAGGAAATAAAGATCATTGTAGGTGGGATGTTGCAACTGGAAAACAAGTGGACTTCTTCTCCATTCCAACCAAACCGCTTATTCCAATTTGCCTGGGATTTGAAGGCATTCTGCTGCATTACATCAAATTTGCCTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

186

Amino Acids

19.81

Weight (kDa)

5.47

Isoelectric Point (pI)

74.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000150)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g02900 FvH4_5g02920 FvH4_5g15972 FvH4_5g25390 FvH4_7g13450 FvH4_7g13450 FvH4_7g27631 FvH4_7g27640 FvH4_7g27660 FvH4_7g27670 FvH4_7g27710 FvH4_7g27720
malus_domestica MD06G1078700.v1.1 MD06G1178900.v1.1 MD06G1179300.v1.1 MD06G1179400.v1.1 MD14G1191500.v1.1 MD14G1191600.v1.1 MD16G1080700.v1.1 MD17G1269500.v1.1
prunus_persica Prupe.1G178900_v2.0.a1 Prupe.2G232100_v2.0.a1 Prupe.3G199300_v2.0.a1 Prupe.3G199700_v2.0.a1 Prupe.3G199700_v2.0.a1 Prupe.3G199800_v2.0.a1 Prupe.5G121900_v2.0.a1 Prupe.5G149900_v2.0.a1 Prupe.5G149900_v2.0.a1 Prupe.5G150200_v2.0.a1 Prupe.5G179400_v2.0.a1 Prupe.5G179400_v2.0.a1 Prupe.5G190200_v2.0.a1 Prupe.5G190300_v2.0.a1 Prupe.5G190500_v2.0.a1 Prupe.5G190600_v2.0.a1 Prupe.5G190700_v2.0.a1 Prupe.5G190800_v2.0.a1 Prupe.5G196400_v2.0.a1 Prupe.5G196500_v2.0.a1 Prupe.5G196600_v2.0.a1 Prupe.5G196700_v2.0.a1 Prupe.5G196800_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.5G216900_v2.0.a1 Prupe.7G215400_v2.0.a1 Prupe.7G215500_v2.0.a1 Prupe.7G215500_v2.0.a1 Prupe.8G014700_v2.0.a1 Prupe.8G014700_v2.0.a1 Prupe.I003600_v2.0.a1
pyrus_communis pycom06g15900 pycom06g15930
rosa_chinensis RchiOBHm_Chr1g0378721 RchiOBHm_Chr1g0379031 RchiOBHm_Chr1g0379041 RchiOBHm_Chr1g0379111 RchiOBHm_Chr1g0379231 RchiOBHm_Chr1g0379381 RchiOBHm_Chr7g0205711 RchiOBHm_Chr7g0219841
rosa_laevigata RLG00000002638 RLG00000002641 RLG00000003360 RLG00000003362 RLG00000003364 RLG00000003972 RLG00000003975 RLG00000003976 RLG00000005302 RLG00000005303 RLG00000026142 RLG00000026318 RLG00000026378 RLG00000026379 RLG00000026396 RLG00000026404 RLG00000026405 RLG00000026412 RLG00000026413 RLG00000026766 RLG00000026768 RLG00000026774 RLG00000026775 RLG00000026776 RLG00000026778 RLG00000026779 RLG00000033034
rosa_multiflora Rmu_co8058818.1_g000001 Rmu_co8428857.1_g000001 Rmu_sc0000556.1_g000004 Rmu_sc0000556.1_g000017 Rmu_sc0000556.1_g000023 Rmu_sc0000556.1_g000038 Rmu_sc0000556.1_g000044 Rmu_sc0000556.1_g000046 Rmu_sc0000634.1_g000002 Rmu_sc0001232.1_g000027 Rmu_sc0003964.1_g000004 Rmu_sc0003964.1_g000013 Rmu_sc0006124.1_g000015 Rmu_sc0006761.1_g000020 Rmu_sc0006761.1_g000023 Rmu_sc0015070.1_g000001 Rmu_sc0017925.1_g000001 Rmu_sc0031430.1_g000005 Rmu_ssc0000119.1_g000014
rosa_roxburghii Rroxscaffold_2G00080740 Rroxscaffold_2G00090730 Rroxscaffold_3G00227790 Rroxscaffold_3G00235420 Rroxscaffold_3G00243990 Rroxscaffold_3G00244010 Rroxscaffold_3G00252040 Rroxscaffold_3G00252060 Rroxscaffold_3G00258760 Rroxscaffold_3G00258780 Rroxscaffold_3G00258790 Rroxscaffold_4G00280120 Rroxscaffold_4G00280210 Rroxscaffold_4G00280240 Rroxscaffold_4G00280300 Rroxscaffold_4G00280310 Rroxscaffold_5G00348380 Rroxscaffold_5G00352440 Rroxscaffold_5G00381760 Rroxscaffold_5G00381770 Rroxscaffold_7G00205800 Rroxscaffold_7G00205810 Rroxscaffold_7G00205850
rosa_rugosa Rorug01G0410800.1 Rorug01G0411700 Rorug01G0412500 Rorug06G0429700 Rorug07G0155400 Rorug07G0155600
rosa_samantha Rh1AG394500 Rh1AG433000 Rh1AG433600 Rh1AG434900 Rh1AG435200 Rh1BG359100 Rh1BG391200 Rh1BG392000 Rh1BG392700 Rh1BG399000 Rh1BG420100 Rh1BG420200 Rh1CG372200 Rh1CG403900 Rh1CG404800 Rh1CG412400 Rh1DG389700 Rh1DG389800 Rh1DG422400 Rh1DG423000 Rh1DG423500 Rh1DG452800 Rh1DG452900 Rh2AG541500 Rh2AG627500 Rh2BG637600 Rh2BG637700 Rh2CG524200 Rh2DG563600 Rh2DG563700 Rh2DG649200 Rh5CG213000 Rh6DG081900 Rh7AG030200 Rh7AG223700 Rh7AG224100 Rh7BG029600 Rh7BG030900 Rh7BG218800 Rh7BG283400 Rh7BG283700 Rh7BG283900 Rh7BG284100 Rh7BG284500 Rh7CG031200 Rh7CG031300 Rh7CG237000 Rh7CG237600 Rh7CG312000 Rh7DG030500 Rh7DG230800
rosa_wichuraiana Rw1G037920 Rw1G037950 Rw1G040890 Rw7G019300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 75, 80
AciI CCGC 2 cut(s) 73, 497
AcsI RAATTY 1 cut(s) 548
AcuI CTGAAG 2 cut(s) 285, 396
AfiI CCNNNNNNNGG 1 cut(s) 43
AgsI TTSAA 3 cut(s) 239, 350, 524
AjnI CCWGG 2 cut(s) 133, 513
AluBI AGCT 2 cut(s) 272, 383
AluI AGCT 2 cut(s) 272, 383
Alw26I GTCTC 1 cut(s) 145
ApeKI GCWGC 4 cut(s) 179, 182, 200, 535
ApoI RAATTY 1 cut(s) 548
Asp700I GAANNNNTTC 1 cut(s) 528
AspS9I GGNCC 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 62
AvaII GGWCC 1 cut(s) 173
BbvI GCAGC 4 cut(s) 166, 169, 187, 522
BccI CCATC 2 cut(s) 25, 226
BciT130I CCWGG 2 cut(s) 135, 515
BcoDI GTCTC 1 cut(s) 145
BfaI CTAG 1 cut(s) 99
BisI GCNGC 4 cut(s) 180, 183, 201, 536
BlsI GCNGC 4 cut(s) 181, 184, 202, 537
Bme1390I CCNGG 2 cut(s) 135, 515
Bme18I GGWCC 1 cut(s) 173
BmgT120I GGNCC 1 cut(s) 173
BmiI GGNNCC 1 cut(s) 48
BmrFI CCNGG 2 cut(s) 135, 515
BmsI GCATC 2 cut(s) 275, 386
BpmI CTGGAG 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 514
BsaXI ACNNNNNCTCC 4 cut(s) 76, 106, 464, 494
Bsc4I CCNNNNNNNGG 1 cut(s) 43
Bse1I ACTGG 3 cut(s) 50, 167, 463
BseBI CCWGG 2 cut(s) 135, 515
BseDI CCNNGG 1 cut(s) 514
BseGI GGATG 1 cut(s) 454
BseLI CCNNNNNNNGG 1 cut(s) 43
BseMII CTCAG 1 cut(s) 19
BseNI ACTGG 3 cut(s) 50, 167, 463
BseXI GCAGC 4 cut(s) 166, 169, 187, 522
Bsh1236I CGCG 2 cut(s) 75, 80
BslFI GGGAC 2 cut(s) 133, 347
BslI CCNNNNNNNGG 1 cut(s) 43
BsmAI GTCTC 1 cut(s) 145
BsmFI GGGAC 2 cut(s) 133, 347
BsmI GAATGC 1 cut(s) 528
Bsp143I GATC 2 cut(s) 322, 433
BspACI CCGC 2 cut(s) 73, 497
BspCNI CTCAG 1 cut(s) 18
BspFNI CGCG 2 cut(s) 75, 80
BspLI GGNNCC 1 cut(s) 48
BsrI ACTGG 3 cut(s) 50, 167, 463
BssECI CCNNGG 1 cut(s) 514
BssMI GATC 2 cut(s) 322, 433
Bst2UI CCWGG 2 cut(s) 135, 515
Bst4CI ACNGT 3 cut(s) 46, 257, 368
BstC8I GCNNGC 1 cut(s) 556
BstDEI CTNAG 1 cut(s) 5
BstF5I GGATG 1 cut(s) 454
BstFNI CGCG 2 cut(s) 75, 80
BstKTI GATC 2 cut(s) 325, 436
BstMAI GTCTC 1 cut(s) 145
BstMBI GATC 2 cut(s) 322, 433
BstNI CCWGG 2 cut(s) 135, 515
BstSCI CCNGG 2 cut(s) 133, 513
BstUI CGCG 2 cut(s) 75, 80
BstV1I GCAGC 4 cut(s) 166, 169, 187, 522
BtsCI GGATG 1 cut(s) 454
Cac8I GCNNGC 1 cut(s) 556
Cfr13I GGNCC 1 cut(s) 173
CseI GACGC 3 cut(s) 64, 69, 184
CsiI ACCWGGT 1 cut(s) 133
CviJI RGCY 2 cut(s) 272, 383
CviKI_1 RGCY 2 cut(s) 272, 383
DdeI CTNAG 1 cut(s) 5
DpnI GATC 2 cut(s) 324, 435
DpnII GATC 2 cut(s) 322, 433
Eco47I GGWCC 1 cut(s) 173
Eco57I CTGAAG 2 cut(s) 285, 396
EcoRII CCWGG 2 cut(s) 133, 513
FaqI GGGAC 2 cut(s) 133, 347
Fnu4HI GCNGC 4 cut(s) 180, 183, 201, 536
FokI GGATG 1 cut(s) 461
Fsp4HI GCNGC 4 cut(s) 180, 183, 201, 536
FspBI CTAG 1 cut(s) 99
GluI GCNGC 4 cut(s) 180, 183, 201, 536
GsuI CTGGAG 1 cut(s) 171
HgaI GACGC 3 cut(s) 64, 69, 184
HincII GTYRAC 2 cut(s) 33, 84
HindII GTYRAC 2 cut(s) 33, 84
HphI GGTGA 1 cut(s) 62
Hpy166II GTNNAC 5 cut(s) 24, 33, 84, 119, 472
Hpy188I TCNGA 3 cut(s) 223, 304, 415
Hpy188III TCNNGA 1 cut(s) 188
Hpy8I GTNNAC 5 cut(s) 24, 33, 84, 119, 472
Hpy99I CGWCG 2 cut(s) 80, 200
HpyAV CCTTC 3 cut(s) 99, 105, 518
HpyCH4III ACNGT 3 cut(s) 46, 257, 368
HpyCH4V TGCA 9 cut(s) 130, 228, 266, 293, 339, 377, 404, 455, 538
HpyF3I CTNAG 1 cut(s) 5
Kzo9I GATC 2 cut(s) 322, 433
LmnI GCTCC 1 cut(s) 190
Lsp1109I GCAGC 4 cut(s) 166, 169, 187, 522
LweI GCATC 2 cut(s) 275, 386
MabI ACCWGGT 1 cut(s) 133
MaeI CTAG 1 cut(s) 99
MalI GATC 2 cut(s) 324, 435
MboI GATC 2 cut(s) 322, 433
MboII GAAGA 5 cut(s) 257, 317, 368, 428, 469
MluCI AATT 2 cut(s) 507, 548
MmeI TCCRAC 3 cut(s) 284, 395, 512
MnlI CCTC 4 cut(s) 50, 69, 123, 214
MroXI GAANNNNTTC 1 cut(s) 528
MspA1I CMGCKG 2 cut(s) 272, 383
MspR9I CCNGG 2 cut(s) 135, 515
Mva1269I GAATGC 1 cut(s) 528
MvaI CCWGG 2 cut(s) 135, 515
MvnI CGCG 2 cut(s) 75, 80
NdeII GATC 2 cut(s) 322, 433
NlaIV GGNNCC 1 cut(s) 48
PcsI WCGNNNNNNNCGW 1 cut(s) 26
PctI GAATGC 1 cut(s) 528
PdmI GAANNNNTTC 1 cut(s) 528
PkrI GCNGC 4 cut(s) 181, 184, 202, 537
Psp6I CCWGG 2 cut(s) 133, 513
PspGI CCWGG 2 cut(s) 133, 513
PspN4I GGNNCC 1 cut(s) 48
PspPI GGNCC 1 cut(s) 173
PvuII CAGCTG 2 cut(s) 272, 383
SatI GCNGC 4 cut(s) 180, 183, 201, 536
Sau3AI GATC 2 cut(s) 322, 433
Sau96I GGNCC 1 cut(s) 173
ScrFI CCNGG 2 cut(s) 135, 515
SetI ASST 5 cut(s) 42, 136, 274, 385, 446
SexAI ACCWGGT 1 cut(s) 133
SfaNI GCATC 2 cut(s) 275, 386
SinI GGWCC 1 cut(s) 173
Sse9I AATT 2 cut(s) 507, 548
SsiI CCGC 2 cut(s) 73, 497
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 2 cut(s) 133, 513
TaaI ACNGT 3 cut(s) 46, 257, 368
TasI AATT 2 cut(s) 507, 548
TseI GCWGC 4 cut(s) 179, 182, 200, 535
VpaK11BI GGWCC 1 cut(s) 173
XapI RAATTY 1 cut(s) 548
XmnI GAANNNNTTC 1 cut(s) 528
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.