Rmu_sc0006730.1_g000011

Belongs to the disease resistance NB-LRR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006730.1
OG0000159
Physical Location & Seq
Forward (+)
53276 .. 55226
1951 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006730.1_g000011.1.cds

Sequence Viewer

Length: 1842 bp
atggagttcgtctataacatagctgagacagtcctgggtaggctagcttcacatgcttcccaagaggtctacttggcatggggtgcccaacttgagcttaccaagctcaacaagactttatctgccatcaaactagtgctcgaggatgcagagaagaagcaagtgagaaatcccccaatcactcgttggttgggaaatctcaaagatgtttgtcatgacgttgatgatgtcttggatgaactagacttccaaaaattgcatttaaaagtggaggccgacaactgtgggatgatcaaaggaaaggtacgccaatttttttcccgctggaatccagtagtgtttaacttcaaaatgggacataaagtgaaagagattagagaaagactagttgaaattgataatgaaaagagacagtttgctctccttgagtttgctaagatagatgaaaatcctcgtgtgctccaaggggtgcacgataataaaagagagactgactctttggtggaggcttcagatgatgaaagtttggaccttatgaaaataagattgcaagatactttgcgaggtagaaagtttttgttagtgttggatgatgtctgggatacgaagctgattggaataacgattgaaaaatggaatgatctaaaaggcttattaaatgtgggagctaatggaagtaaaatcatcataacaacacgaaatagatcagttgctttacttgtgaatcccttatacatgcatactttagaaggtcttccccacaaagactgcatgtcattgtttatcaaaagggcatttaagaaaggagaggagcaacgctatcaacatttgatagaaattggagaggatattgtgaagaagtgtggaggagttcctttagcagttgcgactgttgggagcatgctttatttgaatacagatgaacaccaatggtctagtgtaagagatgatgacatgtggagtatagggaatgacaatattctacctgcactcagactgagctatgatgcattgccacaacacttgaaaccgtgttttgcattttgttcacttttcccaaaggattatgaattcaggagtgcaatgttggttccattgtggatagcacaaggctacctcaaggcatctaagaaaaatgaagatttggaacagatgggtgtagactatattaggcaattttgctctagatctttgtttcaagtcgagggggatatcaaaacagccataatttttaaaatacatgatctcattcatgatttagcaatttcagtggcacaagtagagtactccacagtcaattttcgtccctctagtgctttggaaatgattcgacatgtgtcaatatctaaaaaggacttgattggagaagacgcacaagttcccgaattcatgcttaactcaaagaaattgcgaaccattatagttcttgaagaaggtatgatgagtgaacgttttgtgaagacatgcatctcaagattcaaatgtatgcgggtgctagatctcagtgggtcgcctcttggggagctaccaaattccattggtagtttgtttcatttgagattcctcaacttgtctgataatagaaagataaaaaggcttccgaattccatcagtaagatgctgaatttggagaccttgtccttttggggttgtgaggcacttgaggagatacccaaagacataggaaacctgatcaacctccggagcttggagataactacacaacaaacttatttgccaaaaggaattagacggctcaccttacttcaatatttagattttgagggatgtgtcaatcttaaatctttgggcgaagagatccaattcctcgacaacctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

613

Amino Acids

70.27

Weight (kDa)

6.43

Isoelectric Point (pI)

38.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000159)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g22800 FvH4_1g23030 FvH4_2g17621 FvH4_2g17623 FvH4_2g17640 FvH4_3g16170 FvH4_4g15173 FvH4_4g15190 FvH4_5g16900 FvH4_6g51550 FvH4_6g51570 FvH4_6g51610 FvH4_6g51610 FvH4_7g31270 FvH4_7g31321 FvH4_7g31321
malus_domestica MD06G1096400.v1.1 MD14G1231900.v1.1
prunus_persica Prupe.5G111200_v2.0.a1 Prupe.5G227800_v2.0.a1
pyrus_communis pycom06g09270
rosa_chinensis RchiOBHm_Chr2g0116281 RchiOBHm_Chr2g0116321 RchiOBHm_Chr2g0116651 RchiOBHm_Chr2g0116681 RchiOBHm_Chr2g0116691 RchiOBHm_Chr2g0116761 RchiOBHm_Chr2g0116981 RchiOBHm_Chr2g0117271 RchiOBHm_Chr2g0117561 RchiOBHm_Chr2g0117671 RchiOBHm_Chr5g0009011 RchiOBHm_Chr5g0009021 RchiOBHm_Chr5g0009031 RchiOBHm_Chr5g0051501 RchiOBHm_Chr5g0059261 RchiOBHm_Chr7g0179121 RchiOBHm_Chr7g0179151 RchiOBHm_Chr7g0180011 RchiOBHm_Chr7g0180031
rosa_laevigata RLG00000018253 RLG00000018256 RLG00000018298 RLG00000018318 RLG00000018339 RLG00000018341 RLG00000018355 RLG00000018360 RLG00000018363 RLG00000018364 RLG00000021097
rosa_multiflora Rmu_co8108666.1_g000001 Rmu_co8113786.1_g000001 Rmu_co8303371.1_g000001 Rmu_co8353409.1_g000001 Rmu_sc0000888.1_g000020 Rmu_sc0001035.1_g000046 Rmu_sc0001617.1_g000028 Rmu_sc0001617.1_g000031 Rmu_sc0002009.1_g000005 Rmu_sc0002009.1_g000024 Rmu_sc0002034.1_g000013 Rmu_sc0002191.1_g000001 Rmu_sc0002983.1_g000027 Rmu_sc0003499.1_g000025 Rmu_sc0004602.1_g000012 Rmu_sc0004795.1_g000010 Rmu_sc0004795.1_g000017 Rmu_sc0004888.1_g000050 Rmu_sc0004888.1_g000052 Rmu_sc0004888.1_g000054 Rmu_sc0004942.1_g000014 Rmu_sc0004942.1_g000015 Rmu_sc0004942.1_g000017 Rmu_sc0004942.1_g000020 Rmu_sc0005792.1_g000003 Rmu_sc0006184.1_g000014 Rmu_sc0006730.1_g000011 Rmu_sc0006730.1_g000012 Rmu_sc0011574.1_g000001 Rmu_sc0011574.1_g000002 Rmu_sc0011969.1_g000003 Rmu_sc0016190.1_g000001 Rmu_sc0016190.1_g000002 Rmu_sc0020362.1_g000003 Rmu_sc0020362.1_g000004 Rmu_sc0020362.1_g000005 Rmu_sc0025557.1_g000002 Rmu_sc0031855.1_g000001 Rmu_ssc0000119.1_g000002 Rmu_ssc0000119.1_g000006 Rmu_ssc0000119.1_g000008 Rmu_ssc0000119.1_g000015 Rmu_ssc0000119.1_g000018 Rmu_ssc0000119.1_g000023 Rmu_ssc0000238.1_g000010 Rmu_ssc0000238.1_g000014
rosa_roxburghii Rroxscaffold_1G00067000 Rroxscaffold_1G00067640 Rroxscaffold_2G00126270 Rroxscaffold_2G00126830 Rroxscaffold_2G00126970 Rroxscaffold_2G00127350 Rroxscaffold_3G00273210 Rroxscaffold_3G00273240 Rroxscaffold_3G00274260 Rroxscaffold_3G00274370 Rroxscaffold_4G00321190
rosa_rugosa Rorug02G0205600 Rorug02G0209300 Rorug02G0209500 Rorug02G0211700 Rorug02G0212300 Rorug02G0213200 Rorug02G0213200 Rorug02G0213400 Rorug03G0352400 Rorug03G0352500 Rorug04G0440900 Rorug05G0171300 Rorug05G0322100 Rorug06G0421200 Rorug06G0421400 Rorug06G0421500 Rorug06G0421600 Rorug06G0429800 Rorug06G0430000 Rorug06G0430100
rosa_samantha Rh1DG100600 Rh2AG260900 Rh2AG261000 Rh2AG263400 Rh2AG263600 Rh2AG263900 Rh2AG265300 Rh2AG269300 Rh2AG269700 Rh2BG281000 Rh2CG267300 Rh2CG267500 Rh2CG270600 Rh2CG270700 Rh2CG271100 Rh2DG274100 Rh2DG290500 Rh2DG291600 Rh4DG089700 Rh5CG077900 Rh5CG421700 Rh5DG065900 Rh5DG066000 Rh7BG020200 Rh7BG020700 Rh7BG029700 Rh7BG029800 Rh7BG029900 Rh7BG030100 Rh7CG031400 Rh7CG031900 Rh7DG021300 Rh7DG030600 Rh7DG030900
rosa_wichuraiana Rw0G008860 Rw1G007590 Rw2G020460 Rw2G020740 Rw2G020770 Rw2G020820 Rw2G020920 Rw2G021100 Rw2G021120 Rw2G021260 Rw2G021280 Rw2G021290 Rw5G006520 Rw5G028690 Rw5G036360 Rw5G036370 Rw7G001730 Rw7G002430 Rw7G002450 Rw7G002470 Rw7G002510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 994
AccB1I GGYRCC 1 cut(s) 83
AccI GTMKAC 2 cut(s) 69, 1161
AccIII TCCGGA 1 cut(s) 1701
AciI CCGC 2 cut(s) 322, 1489
AclI AACGTT 1 cut(s) 1450
AclWI GGATC 1 cut(s) 1813
AcsI RAATTY 5 cut(s) 1070, 1385, 1531, 1603, 1624
AcuI CTGAAG 1 cut(s) 495
AfaI GTAC 2 cut(s) 306, 1286
AfiI CCNNNNNNNGG 1 cut(s) 1708
AflIII ACRYGT 2 cut(s) 954, 1333
AgsI TTSAA 9 cut(s) 349, 392, 629, 913, 1027, 1199, 1430, 1480, 1769
AhdI GACNNNNNGTC 1 cut(s) 772
AhlI ACTAGT 2 cut(s) 133, 385
AjnI CCWGG 1 cut(s) 33
AloI GAACNNNNNNTCC 2 cut(s) 231, 263
AluBI AGCT 9 cut(s) 23, 47, 97, 106, 610, 668, 1002, 1525, 1707
AluI AGCT 9 cut(s) 23, 47, 97, 106, 610, 668, 1002, 1525, 1707
Alw21I GWGCWC 3 cut(s) 141, 462, 474
Alw26I GTCTC 4 cut(s) 20, 403, 482, 1625
Alw44I GTGCAC 1 cut(s) 470
AlwI GGATC 1 cut(s) 1813
Ama87I CYCGRG 1 cut(s) 140
Aor13HI TCCGGA 1 cut(s) 1701
AoxI GGCC 1 cut(s) 273
ApaLI GTGCAC 1 cut(s) 470
ApoI RAATTY 5 cut(s) 1070, 1385, 1531, 1603, 1624
ArsI GACNNNNNNTTYG 2 cut(s) 481, 513
Asp700I GAANNNNTTC 2 cut(s) 753, 1326
AspS9I GGNCC 1 cut(s) 529
AsuHPI GGTGA 1 cut(s) 1750
AsuNHI GCTAGC 1 cut(s) 43
AvaI CYCGRG 1 cut(s) 140
AvaII GGWCC 1 cut(s) 529
BaeGI GKGCMC 2 cut(s) 88, 474
BanI GGYRCC 1 cut(s) 83
BarI GAAGNNNNNNTAC 2 cut(s) 31, 63
BauI CACGAG 1 cut(s) 453
BbsI GAAGAC 3 cut(s) 746, 1374, 1466
Bbv12I GWGCWC 3 cut(s) 141, 462, 474
BccI CCATC 3 cut(s) 134, 1147, 1616
BceAI ACGGC 1 cut(s) 1769
BciT130I CCWGG 1 cut(s) 35
BciVI GTATCC 1 cut(s) 595
BclI TGATCA 2 cut(s) 291, 1692
BcoDI GTCTC 4 cut(s) 20, 403, 482, 1625
BcuI ACTAGT 2 cut(s) 133, 385
BfaI CTAG 8 cut(s) 44, 134, 242, 386, 936, 1185, 1311, 1496
BfuAI ACCTGC 1 cut(s) 994
BfuI GTATCC 1 cut(s) 595
BglII AGATCT 2 cut(s) 1187, 1498
BmcAI AGTACT 1 cut(s) 1286
Bme1390I CCNGG 1 cut(s) 35
Bme18I GGWCC 1 cut(s) 529
BmeRI GACNNNNNGTC 1 cut(s) 772
BmeT110I CYCGRG 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 529
BmiI GGNNCC 2 cut(s) 85, 1092
BmrFI CCNGG 1 cut(s) 35
BmsI GCATC 5 cut(s) 136, 997, 1133, 1476, 1608
BmtI GCTAGC 1 cut(s) 47
BoxI GACNNNNGTC 1 cut(s) 1336
BpiI GAAGAC 3 cut(s) 746, 1374, 1466
BplI GAGNNNNNCTC 2 cut(s) 479, 511
BpuEI CTTGAG 5 cut(s) 113, 446, 1103, 1456, 1682
BsaBI GATNNNNATC 1 cut(s) 447
BsaI GGTCTC 1 cut(s) 1625
BsaJI CCNNGG 2 cut(s) 34, 463
BsaWI WCCGGW 1 cut(s) 1701
BsaXI ACNNNNNCTCC 2 cut(s) 1622, 1652
Bsc4I CCNNNNNNNGG 1 cut(s) 1708
Bse1I ACTGG 1 cut(s) 332
Bse3DI GCAATG 2 cut(s) 1010, 1089
Bse8I GATNNNNATC 1 cut(s) 447
BseAI TCCGGA 1 cut(s) 1701
BseBI CCWGG 1 cut(s) 35
BseDI CCNNGG 2 cut(s) 34, 463
BseGI GGATG 5 cut(s) 151, 241, 294, 595, 1793
BseJI GATNNNNATC 1 cut(s) 447
BseLI CCNNNNNNNGG 1 cut(s) 1708
BseMI GCAATG 2 cut(s) 1010, 1089
BseMII CTCAG 4 cut(s) 15, 989, 1006, 1516
BseNI ACTGG 1 cut(s) 332
BseRI GAGGAG 3 cut(s) 824, 882, 1679
BseSI GKGCMC 2 cut(s) 88, 474
BsgI GTGCAG 1 cut(s) 972
BshFI GGCC 1 cut(s) 275
BshNI GGYRCC 1 cut(s) 83
BsiHKAI GWGCWC 3 cut(s) 141, 462, 474
BsiHKCI CYCGRG 1 cut(s) 140
BsiSI CCGG 1 cut(s) 1702
BslFI GGGAC 2 cut(s) 369, 1290
BslI CCNNNNNNNGG 1 cut(s) 1708
BsmAI GTCTC 4 cut(s) 20, 403, 482, 1625
BsmFI GGGAC 2 cut(s) 369, 1290
BsnI GGCC 1 cut(s) 275
Bso31I GGTCTC 1 cut(s) 1625
BsoBI CYCGRG 1 cut(s) 140
Bsp1286I GDGCHC 4 cut(s) 88, 141, 462, 474
Bsp13I TCCGGA 1 cut(s) 1701
Bsp143I GATC 8 cut(s) 291, 640, 704, 1187, 1243, 1498, 1692, 1818
BspACI CCGC 2 cut(s) 322, 1489
BspANI GGCC 1 cut(s) 275
BspCNI CTCAG 4 cut(s) 16, 990, 1005, 1515
BspEI TCCGGA 1 cut(s) 1701
BspHI TCATGA 2 cut(s) 214, 1252
BspLI GGNNCC 2 cut(s) 85, 1092
BspMI ACCTGC 1 cut(s) 994
BspOI GCTAGC 1 cut(s) 47
BspPI GGATC 1 cut(s) 1813
BspT107I GGYRCC 1 cut(s) 83
BspTNI GGTCTC 1 cut(s) 1625
BsrDI GCAATG 2 cut(s) 1010, 1089
BsrI ACTGG 1 cut(s) 332
BssECI CCNNGG 2 cut(s) 34, 463
BssMI GATC 8 cut(s) 291, 640, 704, 1187, 1243, 1498, 1692, 1818
BssSI CACGAG 1 cut(s) 453
BssT1I CCWWGG 1 cut(s) 463
Bst2BI CACGAG 1 cut(s) 453
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 6 cut(s) 31, 284, 414, 892, 1032, 1294
Bst6I CTCTTC 1 cut(s) 1809
BstAPI GCANNNNNTGC 1 cut(s) 83
BstC8I GCNNGC 2 cut(s) 45, 902
BstDEI CTNAG 6 cut(s) 24, 435, 992, 998, 1128, 1502
BstF5I GGATG 5 cut(s) 151, 241, 294, 595, 1793
BstKTI GATC 8 cut(s) 294, 643, 707, 1190, 1246, 1501, 1695, 1821
BstMAI GTCTC 4 cut(s) 20, 403, 482, 1625
BstMBI GATC 8 cut(s) 291, 640, 704, 1187, 1243, 1498, 1692, 1818
BstMWI GCNNNNNNNGC 3 cut(s) 53, 83, 103
BstNI CCWGG 1 cut(s) 35
BstNSI RCATGY 7 cut(s) 56, 739, 775, 904, 958, 1337, 1467
BstPAI GACNNNNGTC 1 cut(s) 1336
BstSCI CCNGG 1 cut(s) 33
BstSLI GKGCMC 2 cut(s) 88, 474
BstV2I GAAGAC 3 cut(s) 746, 1374, 1466
BstX2I RGATCY 3 cut(s) 1187, 1498, 1818
BstYI RGATCY 3 cut(s) 1187, 1498, 1818
BsuI GTATCC 1 cut(s) 595
BsuRI GGCC 1 cut(s) 275
BtsCI GGATG 5 cut(s) 151, 241, 294, 595, 1793
BtsIMutI CAGTG 2 cut(s) 1275, 1510
BveI ACCTGC 1 cut(s) 994
Cac8I GCNNGC 2 cut(s) 45, 902
CciI TCATGA 2 cut(s) 214, 1252
Cfr13I GGNCC 1 cut(s) 529
CseI GACGC 1 cut(s) 1379
Csp6I GTAC 2 cut(s) 305, 1285
CspCI CAANNNNNGTGG 4 cut(s) 1005, 1040, 1251, 1286
CviQI GTAC 2 cut(s) 305, 1285
DdeI CTNAG 6 cut(s) 24, 435, 992, 998, 1128, 1502
DpnI GATC 8 cut(s) 293, 642, 706, 1189, 1245, 1500, 1694, 1820
DpnII GATC 8 cut(s) 291, 640, 704, 1187, 1243, 1498, 1692, 1818
DraI TTTAAA 2 cut(s) 264, 1234
DriI GACNNNNNGTC 1 cut(s) 772
Eam1104I CTCTTC 1 cut(s) 1809
Eam1105I GACNNNNNGTC 1 cut(s) 772
EarI CTCTTC 1 cut(s) 1809
Eco130I CCWWGG 1 cut(s) 463
Eco31I GGTCTC 1 cut(s) 1625
Eco32I GATATC 1 cut(s) 1213
Eco47I GGWCC 1 cut(s) 529
Eco57I CTGAAG 1 cut(s) 495
Eco88I CYCGRG 1 cut(s) 140
EcoRI GAATTC 3 cut(s) 1070, 1385, 1603
EcoRII CCWGG 1 cut(s) 33
EcoRV GATATC 1 cut(s) 1213
EcoT14I CCWWGG 1 cut(s) 463
EcoT22I ATGCAT 3 cut(s) 741, 1012, 1469
ErhI CCWWGG 1 cut(s) 463
FaqI GGGAC 2 cut(s) 369, 1290
FauI CCCGC 2 cut(s) 329, 1482
FbaI TGATCA 2 cut(s) 291, 1692
FblI GTMKAC 2 cut(s) 69, 1161
FokI GGATG 5 cut(s) 158, 248, 301, 602, 1800
FspBI CTAG 8 cut(s) 44, 134, 242, 386, 936, 1185, 1311, 1496
HaeIII GGCC 1 cut(s) 275
HapII CCGG 1 cut(s) 1702
HgaI GACGC 1 cut(s) 1379
HinfI GANTC 6 cut(s) 328, 494, 724, 1327, 1476, 1560
HpaII CCGG 1 cut(s) 1702
HphI GGTGA 1 cut(s) 1750
Hpy166II GTNNAC 5 cut(s) 70, 472, 1049, 1162, 1448
Hpy188I TCNGA 4 cut(s) 514, 995, 1576, 1602
Hpy188III TCNNGA 8 cut(s) 215, 1075, 1185, 1253, 1382, 1427, 1473, 1702
Hpy8I GTNNAC 5 cut(s) 70, 472, 1049, 1162, 1448
HpyAV CCTTC 2 cut(s) 743, 1427
HpyCH4III ACNGT 6 cut(s) 31, 284, 414, 892, 1032, 1294
HpyCH4IV ACGT 2 cut(s) 219, 1450
HpyF10VI GCNNNNNNNGC 3 cut(s) 53, 83, 103
HpyF3I CTNAG 6 cut(s) 24, 435, 992, 998, 1128, 1502
HpySE526I ACGT 2 cut(s) 219, 1450
Kpn2I TCCGGA 1 cut(s) 1701
Ksp22I TGATCA 2 cut(s) 291, 1692
Kzo9I GATC 8 cut(s) 291, 640, 704, 1187, 1243, 1498, 1692, 1818
LmnI GCTCC 6 cut(s) 465, 665, 811, 897, 1522, 1704
LpnPI CCDG 9 cut(s) 20, 47, 310, 345, 583, 999, 1060, 1703, 1715
LweI GCATC 5 cut(s) 136, 997, 1133, 1476, 1608
MaeI CTAG 8 cut(s) 44, 134, 242, 386, 936, 1185, 1311, 1496
MaeII ACGT 2 cut(s) 219, 1450
MalI GATC 8 cut(s) 293, 642, 706, 1189, 1245, 1500, 1694, 1820
MboI GATC 8 cut(s) 291, 640, 704, 1187, 1243, 1498, 1692, 1818
MboII GAAGA 8 cut(s) 166, 746, 868, 1151, 1379, 1442, 1471, 1826
MflI RGATCY 3 cut(s) 1187, 1498, 1818
MhlI GDGCHC 4 cut(s) 88, 141, 462, 474
MlyI GAGTC 1 cut(s) 488
MmeI TCCRAC 1 cut(s) 567
Mph1103I ATGCAT 3 cut(s) 741, 1012, 1469
MroI TCCGGA 1 cut(s) 1701
MroXI GAANNNNTTC 2 cut(s) 753, 1326
MseI TTAA 7 cut(s) 263, 342, 656, 798, 1233, 1395, 1800
MspA1I CMGCKG 1 cut(s) 324
MspI CCGG 1 cut(s) 1702
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
MwoI GCNNNNNNNGC 3 cut(s) 53, 83, 103
NdeII GATC 8 cut(s) 291, 640, 704, 1187, 1243, 1498, 1692, 1818
NheI GCTAGC 1 cut(s) 43
NlaIV GGNNCC 2 cut(s) 85, 1092
NsiI ATGCAT 3 cut(s) 741, 1012, 1469
NspI RCATGY 7 cut(s) 56, 739, 775, 904, 958, 1337, 1467
PaeI GCATGC 1 cut(s) 904
PaeR7I CTCGAG 1 cut(s) 140
PagI TCATGA 2 cut(s) 214, 1252
PciI ACATGT 2 cut(s) 954, 1333
PdmI GAANNNNTTC 2 cut(s) 753, 1326
PfeI GAWTC 5 cut(s) 328, 724, 1327, 1476, 1560
PflFI GACNNNGTC 1 cut(s) 1636
PleI GAGTC 1 cut(s) 488
PpsI GAGTC 1 cut(s) 488
PscI ACATGT 2 cut(s) 954, 1333
PshAI GACNNNNGTC 1 cut(s) 1336
Psp1406I AACGTT 1 cut(s) 1450
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
PspN4I GGNNCC 2 cut(s) 85, 1092
PspPI GGNCC 1 cut(s) 529
PspXI VCTCGAGB 1 cut(s) 140
PsuI RGATCY 3 cut(s) 1187, 1498, 1818
PsyI GACNNNGTC 1 cut(s) 1636
RsaI GTAC 2 cut(s) 306, 1286
RsaNI GTAC 2 cut(s) 305, 1285
SaqAI TTAA 7 cut(s) 263, 342, 656, 798, 1233, 1395, 1800
Sau3AI GATC 8 cut(s) 291, 640, 704, 1187, 1243, 1498, 1692, 1818
Sau96I GGNCC 1 cut(s) 529
ScaI AGTACT 1 cut(s) 1286
SchI GAGTC 1 cut(s) 488
ScrFI CCNGG 1 cut(s) 35
SduI GDGCHC 4 cut(s) 88, 141, 462, 474
SfaNI GCATC 5 cut(s) 136, 997, 1133, 1476, 1608
Sfr274I CTCGAG 1 cut(s) 140
SinI GGWCC 1 cut(s) 529
SlaI CTCGAG 1 cut(s) 140
SmlI CTYRAG 6 cut(s) 92, 140, 425, 1118, 1471, 1661
SmoI CTYRAG 6 cut(s) 92, 140, 425, 1118, 1471, 1661
SpeI ACTAGT 2 cut(s) 133, 385
SphI GCATGC 1 cut(s) 904
SsiI CCGC 2 cut(s) 322, 1489
SspI AATATT 2 cut(s) 979, 1772
SspMI CTAG 8 cut(s) 44, 134, 242, 386, 936, 1185, 1311, 1496
StyD4I CCNGG 1 cut(s) 33
StyI CCWWGG 1 cut(s) 463
TaaI ACNGT 6 cut(s) 31, 284, 414, 892, 1032, 1294
TaiI ACGT 2 cut(s) 222, 1453
TaqI TCGA 4 cut(s) 141, 1203, 1330, 1830
TatI WGTACW 1 cut(s) 1284
TfiI GAWTC 5 cut(s) 328, 724, 1327, 1476, 1560
Tru1I TTAA 7 cut(s) 263, 342, 656, 798, 1233, 1395, 1800
Tru9I TTAA 7 cut(s) 263, 342, 656, 798, 1233, 1395, 1800
TscAI CASTG 2 cut(s) 1275, 1510
TspRI CASTG 2 cut(s) 1275, 1510
Tth111I GACNNNGTC 1 cut(s) 1636
VneI GTGCAC 1 cut(s) 470
VpaK11BI GGWCC 1 cut(s) 529
XapI RAATTY 5 cut(s) 1070, 1385, 1531, 1603, 1624
XbaI TCTAGA 1 cut(s) 1184
XceI RCATGY 7 cut(s) 56, 739, 775, 904, 958, 1337, 1467
XcmI CCANNNNNNNNNTGG 1 cut(s) 183
XhoI CTCGAG 1 cut(s) 140
XmiI GTMKAC 2 cut(s) 69, 1161
XmnI GAANNNNTTC 2 cut(s) 753, 1326
XspI CTAG 8 cut(s) 44, 134, 242, 386, 936, 1185, 1311, 1496
ZrmI AGTACT 1 cut(s) 1286
Zsp2I ATGCAT 3 cut(s) 741, 1012, 1469
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.