Rmu_sc0006730.1_g000012

ABC transporter F family member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006730.1
OG0000159
Physical Location & Seq
Forward (+)
55263 .. 57937
2675 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006730.1_g000012.1.cds

Sequence Viewer

Length: 1011 bp
atgaaacacatgactgctttagatactttgggtgtcaatgattgcgagaagattcagttgacgatgagatcaggggaagatcctcaaggtcttcgatcattgattatcgagaaatcaagtttggaggctttgcccccttggcttactgaagattctgcagacactctacagagcatatggcttggtcgatgtgataatctcacgacactttcggagttaataaagttcagattccttgagcaactacaaattgaagaatgctccaaattgtcggctttgccgcaagggttgcattgccttactgagttgagaggattgaagatttcagggtgtcctgaattgagcaaaagctgcaaaaggcaattaaaaggtgaggagtggtcaaagatggcacgtcagatgaagattacactcgacgctgatgatgaagaagatgaatccaacaatcgcttggccgacggtaggatcgcgtacctcactttgagaggacgccgcatttacatagatcattttactggccacctccaattcttttcttggcaagagcagaagctggagaaacttcaggaagaggatcttgttgaaaggctgttccagaggaaacagatgaggatcaggtttcctgaatgggggagaagtggaagatttgttgcaacacttaagaatctggaagctggctttggagataagatgctgtttagcagagcaaatctcacaattgaaagaggagagaaactggccattattcacccaaatggatgtggcaagagtactttgctgaaacatgctgaggcacttgatttaaataaaacagtgcctgagacagtagaagtagcagcaggggattggagacttgatgatataaagggcctccttggttgttgtaatttcaaagctgatatgcttgatggaaaggtttccctcttaagtggtggtgagaagtactatctagagaagaatctagatgctagggaaagagaactcgagcgtgaggcagagattgtggagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005215 GO:0008150 GO:0009605 GO:0009607 GO:0009624 GO:0043207 GO:0050896 GO:0051704 GO:0051707
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ABC_tran ABC_tran_Xtn

Protein Analysis

336

Amino Acids

38.39

Weight (kDa)

5.53

Isoelectric Point (pI)

44.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000159)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g22800 FvH4_1g23030 FvH4_2g17621 FvH4_2g17623 FvH4_2g17640 FvH4_3g16170 FvH4_4g15173 FvH4_4g15190 FvH4_5g16900 FvH4_6g51550 FvH4_6g51570 FvH4_6g51610 FvH4_6g51610 FvH4_7g31270 FvH4_7g31321 FvH4_7g31321
malus_domestica MD06G1096400.v1.1 MD14G1231900.v1.1
prunus_persica Prupe.5G111200_v2.0.a1 Prupe.5G227800_v2.0.a1
pyrus_communis pycom06g09270
rosa_chinensis RchiOBHm_Chr2g0116281 RchiOBHm_Chr2g0116321 RchiOBHm_Chr2g0116651 RchiOBHm_Chr2g0116681 RchiOBHm_Chr2g0116691 RchiOBHm_Chr2g0116761 RchiOBHm_Chr2g0116981 RchiOBHm_Chr2g0117271 RchiOBHm_Chr2g0117561 RchiOBHm_Chr2g0117671 RchiOBHm_Chr5g0009011 RchiOBHm_Chr5g0009021 RchiOBHm_Chr5g0009031 RchiOBHm_Chr5g0051501 RchiOBHm_Chr5g0059261 RchiOBHm_Chr7g0179121 RchiOBHm_Chr7g0179151 RchiOBHm_Chr7g0180011 RchiOBHm_Chr7g0180031
rosa_laevigata RLG00000018253 RLG00000018256 RLG00000018298 RLG00000018318 RLG00000018339 RLG00000018341 RLG00000018355 RLG00000018360 RLG00000018363 RLG00000018364 RLG00000021097
rosa_multiflora Rmu_co8108666.1_g000001 Rmu_co8113786.1_g000001 Rmu_co8303371.1_g000001 Rmu_co8353409.1_g000001 Rmu_sc0000888.1_g000020 Rmu_sc0001035.1_g000046 Rmu_sc0001617.1_g000028 Rmu_sc0001617.1_g000031 Rmu_sc0002009.1_g000005 Rmu_sc0002009.1_g000024 Rmu_sc0002034.1_g000013 Rmu_sc0002191.1_g000001 Rmu_sc0002983.1_g000027 Rmu_sc0003499.1_g000025 Rmu_sc0004602.1_g000012 Rmu_sc0004795.1_g000010 Rmu_sc0004795.1_g000017 Rmu_sc0004888.1_g000050 Rmu_sc0004888.1_g000052 Rmu_sc0004888.1_g000054 Rmu_sc0004942.1_g000014 Rmu_sc0004942.1_g000015 Rmu_sc0004942.1_g000017 Rmu_sc0004942.1_g000020 Rmu_sc0005792.1_g000003 Rmu_sc0006184.1_g000014 Rmu_sc0006730.1_g000011 Rmu_sc0006730.1_g000012 Rmu_sc0011574.1_g000001 Rmu_sc0011574.1_g000002 Rmu_sc0011969.1_g000003 Rmu_sc0016190.1_g000001 Rmu_sc0016190.1_g000002 Rmu_sc0020362.1_g000003 Rmu_sc0020362.1_g000004 Rmu_sc0020362.1_g000005 Rmu_sc0025557.1_g000002 Rmu_sc0031855.1_g000001 Rmu_ssc0000119.1_g000002 Rmu_ssc0000119.1_g000006 Rmu_ssc0000119.1_g000008 Rmu_ssc0000119.1_g000015 Rmu_ssc0000119.1_g000018 Rmu_ssc0000119.1_g000023 Rmu_ssc0000238.1_g000010 Rmu_ssc0000238.1_g000014
rosa_roxburghii Rroxscaffold_1G00067000 Rroxscaffold_1G00067640 Rroxscaffold_2G00126270 Rroxscaffold_2G00126830 Rroxscaffold_2G00126970 Rroxscaffold_2G00127350 Rroxscaffold_3G00273210 Rroxscaffold_3G00273240 Rroxscaffold_3G00274260 Rroxscaffold_3G00274370 Rroxscaffold_4G00321190
rosa_rugosa Rorug02G0205600 Rorug02G0209300 Rorug02G0209500 Rorug02G0211700 Rorug02G0212300 Rorug02G0213200 Rorug02G0213200 Rorug02G0213400 Rorug03G0352400 Rorug03G0352500 Rorug04G0440900 Rorug05G0171300 Rorug05G0322100 Rorug06G0421200 Rorug06G0421400 Rorug06G0421500 Rorug06G0421600 Rorug06G0429800 Rorug06G0430000 Rorug06G0430100
rosa_samantha Rh1DG100600 Rh2AG260900 Rh2AG261000 Rh2AG263400 Rh2AG263600 Rh2AG263900 Rh2AG265300 Rh2AG269300 Rh2AG269700 Rh2BG281000 Rh2CG267300 Rh2CG267500 Rh2CG270600 Rh2CG270700 Rh2CG271100 Rh2DG274100 Rh2DG290500 Rh2DG291600 Rh4DG089700 Rh5CG077900 Rh5CG421700 Rh5DG065900 Rh5DG066000 Rh7BG020200 Rh7BG020700 Rh7BG029700 Rh7BG029800 Rh7BG029900 Rh7BG030100 Rh7CG031400 Rh7CG031900 Rh7DG021300 Rh7DG030600 Rh7DG030900
rosa_wichuraiana Rw0G008860 Rw1G007590 Rw2G020460 Rw2G020740 Rw2G020770 Rw2G020820 Rw2G020920 Rw2G021100 Rw2G021120 Rw2G021260 Rw2G021280 Rw2G021290 Rw5G006520 Rw5G028690 Rw5G036360 Rw5G036370 Rw7G001730 Rw7G002430 Rw7G002450 Rw7G002470 Rw7G002510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 470
AciI CCGC 2 cut(s) 281, 493
AclWI GGATC 4 cut(s) 74, 473, 582, 620
AcoI YGGCCR 3 cut(s) 453, 517, 738
AcuI CTGAAG 2 cut(s) 168, 548
AcyI GRCGYC 1 cut(s) 490
AfaI GTAC 3 cut(s) 473, 772, 944
AfiI CCNNNNNNNGG 2 cut(s) 462, 629
AflII CTTAAG 2 cut(s) 659, 925
AgsI TTSAA 5 cut(s) 254, 319, 584, 722, 892
AjiI CACGTC 1 cut(s) 395
AjuI GAANNNNNNNTTGG 4 cut(s) 104, 136, 663, 695
AluBI AGCT 4 cut(s) 351, 553, 674, 896
AluI AGCT 4 cut(s) 351, 553, 674, 896
Alw26I GTCTC 2 cut(s) 815, 844
AlwI GGATC 4 cut(s) 74, 473, 582, 620
AlwNI CAGNNNCTG 2 cut(s) 553, 818
Ama87I CYCGRG 1 cut(s) 983
AoxI GGCC 4 cut(s) 453, 517, 738, 868
ApeKI GCWGC 2 cut(s) 351, 836
Asp700I GAANNNNTTC 1 cut(s) 916
AspS9I GGNCC 1 cut(s) 868
AsuHPI GGTGA 3 cut(s) 383, 740, 947
AvaI CYCGRG 1 cut(s) 983
BalI TGGCCA 2 cut(s) 519, 740
BbsI GAAGAC 1 cut(s) 83
BbvCI CCTCAGC 1 cut(s) 789
BbvI GCAGC 2 cut(s) 338, 848
BccI CCATC 2 cut(s) 382, 902
BcoDI GTCTC 2 cut(s) 815, 844
BfaI CTAG 3 cut(s) 950, 962, 969
BfmI CTRYAG 2 cut(s) 156, 167
BfrI CTTAAG 2 cut(s) 659, 925
BglI GCCNNNNNGGC 1 cut(s) 139
BisI GCNGC 4 cut(s) 281, 352, 493, 837
BlsI GCNGC 4 cut(s) 282, 353, 494, 838
BmcAI AGTACT 2 cut(s) 772, 944
BmeT110I CYCGRG 1 cut(s) 983
BmgBI CACGTC 1 cut(s) 395
BmgT120I GGNCC 1 cut(s) 868
BmsI GCATC 2 cut(s) 681, 955
BpiI GAAGAC 1 cut(s) 83
BplI GAGNNNNNCTC 2 cut(s) 696, 728
BpmI CTGGAG 1 cut(s) 575
Bpu10I CCTNAGC 1 cut(s) 789
BpuEI CTTGAG 2 cut(s) 69, 257
BsaBI GATNNNNATC 1 cut(s) 611
BsaHI GRCGYC 1 cut(s) 490
BsaJI CCNNGG 2 cut(s) 137, 874
Bsc4I CCNNNNNNNGG 2 cut(s) 462, 629
Bse1I ACTGG 2 cut(s) 520, 741
Bse3DI GCAATG 1 cut(s) 292
Bse8I GATNNNNATC 1 cut(s) 611
BseDI CCNNGG 2 cut(s) 137, 874
BseGI GGATG 1 cut(s) 764
BseJI GATNNNNATC 1 cut(s) 611
BseLI CCNNNNNNNGG 2 cut(s) 462, 629
BseMI GCAATG 1 cut(s) 292
BseMII CTCAG 3 cut(s) 294, 780, 810
BseNI ACTGG 2 cut(s) 520, 741
BseRI GAGGAG 2 cut(s) 389, 741
BseXI GCAGC 2 cut(s) 338, 848
Bsh1236I CGCG 1 cut(s) 470
BshFI GGCC 4 cut(s) 455, 519, 740, 870
BsiHKCI CYCGRG 1 cut(s) 983
BslI CCNNNNNNNGG 2 cut(s) 462, 629
BsmAI GTCTC 2 cut(s) 815, 844
BsmI GAATGC 1 cut(s) 263
BsnI GGCC 4 cut(s) 455, 519, 740, 870
BsoBI CYCGRG 1 cut(s) 983
Bsp143I GATC 7 cut(s) 68, 79, 95, 465, 505, 574, 612
BspACI CCGC 2 cut(s) 281, 493
BspANI GGCC 4 cut(s) 455, 519, 740, 870
BspCNI CTCAG 3 cut(s) 295, 781, 811
BspFNI CGCG 1 cut(s) 470
BspMAI CTGCAG 1 cut(s) 160
BspPI GGATC 4 cut(s) 74, 473, 582, 620
BspTI CTTAAG 2 cut(s) 659, 925
BsrDI GCAATG 1 cut(s) 292
BsrI ACTGG 2 cut(s) 520, 741
BssECI CCNNGG 2 cut(s) 137, 874
BssMI GATC 7 cut(s) 68, 79, 95, 465, 505, 574, 612
BssNI GRCGYC 1 cut(s) 490
BssT1I CCWWGG 2 cut(s) 137, 874
Bst4CI ACNGT 3 cut(s) 461, 814, 826
Bst6I CTCTTC 1 cut(s) 564
BstACI GRCGYC 1 cut(s) 490
BstAFI CTTAAG 2 cut(s) 659, 925
BstAPI GCANNNNNTGC 2 cut(s) 289, 351
BstC8I GCNNGC 1 cut(s) 676
BstDEI CTNAG 3 cut(s) 303, 789, 819
BstF5I GGATG 1 cut(s) 764
BstFNI CGCG 1 cut(s) 470
BstKTI GATC 7 cut(s) 71, 82, 98, 468, 508, 577, 615
BstMAI GTCTC 2 cut(s) 815, 844
BstMBI GATC 7 cut(s) 68, 79, 95, 465, 505, 574, 612
BstMWI GCNNNNNNNGC 3 cut(s) 139, 289, 351
BstNSI RCATGY 1 cut(s) 788
BstSFI CTRYAG 2 cut(s) 156, 167
BstUI CGCG 1 cut(s) 470
BstV1I GCAGC 2 cut(s) 338, 848
BstV2I GAAGAC 1 cut(s) 83
BstX2I RGATCY 2 cut(s) 79, 574
BstYI RGATCY 2 cut(s) 79, 574
BsuRI GGCC 4 cut(s) 455, 519, 740, 870
BtrI CACGTC 1 cut(s) 395
BtsCI GGATG 1 cut(s) 764
BtsIMutI CAGTG 1 cut(s) 819
Cac8I GCNNGC 1 cut(s) 676
CaiI CAGNNNCTG 2 cut(s) 553, 818
Cfr13I GGNCC 1 cut(s) 868
CseI GACGC 2 cut(s) 425, 498
Csp6I GTAC 3 cut(s) 472, 771, 943
CviAII CATG 2 cut(s) 10, 785
CviQI GTAC 3 cut(s) 472, 771, 943
DdeI CTNAG 3 cut(s) 303, 789, 819
DpnI GATC 7 cut(s) 70, 81, 97, 467, 507, 576, 614
DpnII GATC 7 cut(s) 68, 79, 95, 465, 505, 574, 612
DraI TTTAAA 1 cut(s) 804
EaeI YGGCCR 3 cut(s) 453, 517, 738
Eam1104I CTCTTC 1 cut(s) 564
EarI CTCTTC 1 cut(s) 564
Eco130I CCWWGG 2 cut(s) 137, 874
Eco57I CTGAAG 2 cut(s) 168, 548
Eco88I CYCGRG 1 cut(s) 983
EcoO109I RGGNCCY 1 cut(s) 868
EcoT14I CCWWGG 2 cut(s) 137, 874
ErhI CCWWGG 2 cut(s) 137, 874
FaeI CATG 2 cut(s) 13, 788
FaiI YATR 7 cut(s) 11, 176, 178, 503, 786, 863, 902
FalI AAGNNNNNCTT 2 cut(s) 561, 593
FatI CATG 2 cut(s) 9, 784
FauNDI CATATG 1 cut(s) 176
Fnu4HI GCNGC 4 cut(s) 281, 352, 493, 837
FokI GGATG 1 cut(s) 771
Fsp4HI GCNGC 4 cut(s) 281, 352, 493, 837
FspBI CTAG 3 cut(s) 950, 962, 969
GluI GCNGC 4 cut(s) 281, 352, 493, 837
GsuI CTGGAG 1 cut(s) 575
HaeIII GGCC 4 cut(s) 455, 519, 740, 870
HgaI GACGC 2 cut(s) 425, 498
Hin1I GRCGYC 1 cut(s) 490
Hin1II CATG 2 cut(s) 13, 788
HincII GTYRAC 1 cut(s) 60
HindII GTYRAC 1 cut(s) 60
HinfI GANTC 6 cut(s) 52, 152, 231, 437, 664, 958
HphI GGTGA 3 cut(s) 383, 740, 947
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 3 cut(s) 214, 230, 399
Hpy188III TCNNGA 9 cut(s) 109, 202, 335, 566, 595, 623, 668, 950, 962
Hpy8I GTNNAC 1 cut(s) 60
Hpy99I CGWCG 2 cut(s) 419, 461
HpyCH4III ACNGT 3 cut(s) 461, 814, 826
HpyCH4IV ACGT 1 cut(s) 394
HpyCH4V TGCA 4 cut(s) 158, 292, 354, 653
HpyF10VI GCNNNNNNNGC 3 cut(s) 139, 289, 351
HpyF3I CTNAG 3 cut(s) 303, 789, 819
HpySE526I ACGT 1 cut(s) 394
Hsp92I GRCGYC 1 cut(s) 490
Hsp92II CATG 2 cut(s) 13, 788
Kzo9I GATC 7 cut(s) 68, 79, 95, 465, 505, 574, 612
LmnI GCTCC 1 cut(s) 266
Lsp1109I GCAGC 2 cut(s) 338, 848
LweI GCATC 2 cut(s) 681, 955
MaeI CTAG 3 cut(s) 950, 962, 969
MaeII ACGT 1 cut(s) 394
MalI GATC 7 cut(s) 70, 81, 97, 467, 507, 576, 614
MboI GATC 7 cut(s) 68, 79, 95, 465, 505, 574, 612
MfeI CAATTG 1 cut(s) 717
MflI RGATCY 2 cut(s) 79, 574
MlsI TGGCCA 2 cut(s) 519, 740
MluCI AATT 7 cut(s) 249, 266, 338, 362, 527, 717, 886
MluNI TGGCCA 2 cut(s) 519, 740
MmeI TCCRAC 1 cut(s) 465
Mox20I TGGCCA 2 cut(s) 519, 740
MroXI GAANNNNTTC 1 cut(s) 916
MscI TGGCCA 2 cut(s) 519, 740
MseI TTAA 5 cut(s) 218, 365, 660, 803, 926
MslI CAYNNNNRTG 1 cut(s) 753
Msp20I TGGCCA 2 cut(s) 519, 740
MspCI CTTAAG 2 cut(s) 659, 925
MunI CAATTG 1 cut(s) 717
Mva1269I GAATGC 1 cut(s) 263
MvnI CGCG 1 cut(s) 470
MwoI GCNNNNNNNGC 3 cut(s) 139, 289, 351
NdeI CATATG 1 cut(s) 176
NdeII GATC 7 cut(s) 68, 79, 95, 465, 505, 574, 612
NlaIII CATG 2 cut(s) 13, 788
NspI RCATGY 1 cut(s) 788
PaeR7I CTCGAG 1 cut(s) 983
PctI GAATGC 1 cut(s) 263
PdmI GAANNNNTTC 1 cut(s) 916
PfeI GAWTC 6 cut(s) 52, 152, 231, 437, 664, 958
PkrI GCNGC 4 cut(s) 282, 353, 494, 838
PspPI GGNCC 1 cut(s) 868
PspXI VCTCGAGB 1 cut(s) 983
PstI CTGCAG 1 cut(s) 160
PstNI CAGNNNCTG 2 cut(s) 553, 818
PsuI RGATCY 2 cut(s) 79, 574
RsaI GTAC 3 cut(s) 473, 772, 944
RsaNI GTAC 3 cut(s) 472, 771, 943
RseI CAYNNNNRTG 1 cut(s) 753
SaqAI TTAA 5 cut(s) 218, 365, 660, 803, 926
SatI GCNGC 4 cut(s) 281, 352, 493, 837
Sau3AI GATC 7 cut(s) 68, 79, 95, 465, 505, 574, 612
Sau96I GGNCC 1 cut(s) 868
ScaI AGTACT 2 cut(s) 772, 944
SfaNI GCATC 2 cut(s) 681, 955
SfcI CTRYAG 2 cut(s) 156, 167
Sfr274I CTCGAG 1 cut(s) 983
SlaI CTCGAG 1 cut(s) 983
SmiI ATTTAAAT 1 cut(s) 804
SmiMI CAYNNNNRTG 1 cut(s) 753
SmlI CTYRAG 5 cut(s) 84, 236, 659, 925, 983
SmoI CTYRAG 5 cut(s) 84, 236, 659, 925, 983
Sse9I AATT 7 cut(s) 249, 266, 338, 362, 527, 717, 886
SsiI CCGC 2 cut(s) 281, 493
SspMI CTAG 3 cut(s) 950, 962, 969
StyI CCWWGG 2 cut(s) 137, 874
SwaI ATTTAAAT 1 cut(s) 804
TaaI ACNGT 3 cut(s) 461, 814, 826
TaiI ACGT 1 cut(s) 397
TaqI TCGA 5 cut(s) 94, 108, 187, 414, 984
TasI AATT 7 cut(s) 249, 266, 338, 362, 527, 717, 886
TatI WGTACW 2 cut(s) 770, 942
TauI GCSGC 2 cut(s) 283, 495
TfiI GAWTC 6 cut(s) 52, 152, 231, 437, 664, 958
Tru1I TTAA 5 cut(s) 218, 365, 660, 803, 926
Tru9I TTAA 5 cut(s) 218, 365, 660, 803, 926
TscAI CASTG 1 cut(s) 819
TseI GCWGC 2 cut(s) 351, 836
TspDTI ATGAA 4 cut(s) 17, 416, 441, 450
TspRI CASTG 1 cut(s) 819
Vha464I CTTAAG 2 cut(s) 659, 925
XbaI TCTAGA 2 cut(s) 949, 961
XceI RCATGY 1 cut(s) 788
XcmI CCANNNNNNNNNTGG 1 cut(s) 448
XhoI CTCGAG 1 cut(s) 983
XmnI GAANNNNTTC 1 cut(s) 916
XspI CTAG 3 cut(s) 950, 962, 969
ZrmI AGTACT 2 cut(s) 772, 944
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.