Rmu_sc0011969.1_g000003

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011969.1
Physical Location & Seq
Forward (+)
11782 .. 17646
5865 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011969.1_g000003.1.cds

Sequence Viewer

Length: 2847 bp
atggagtttgccagcagcattgcagagaatgtcttggataggctagcttcacatgcttcccaagagatctccttggcatggagtgcccaacttgagctcaccaagctcaacaacaccttatctaccatcaaactagtgcttgaggatgcagagaagaagcaactgagaaatcccctaatcactcgttggttgggaaatctcaaagatgtttgccatgacgttgatgatgtcttggacaaactggagttccaaaagttgcggttgaaagtggaggtcgacaacagtgggaagatcaaaggaaaggtacgccaatttttttcccgatggaatccagtagtgtttaacttcaaaatgggacataaagtgaaagagattagagaaagactagctgaaattgataatgaaaggagagagtttgctctctttgaggttgctaagatagctgaagatcctcatgtgctccaaaggatgcacgataacaaaaaagagaccgactctttggtggaggctttagatgttattggaagagatgatgataaaaaacagattattagtcatctcttaaataacactgatatctctagtaaggagaatgtttctgttatttccatccttgggttaggagggttgggaaagacaactctcgctaaattagtatataacgatagcatggtagaggagaaatttgagatgaaaatgtggatatgtgtctcagatagctttaatatccaaacattaattcgcggcattatcaatgctgcaattaaacaaaaatgtgaggatgaaagcttggaccttatgaaaagaagattgcaagatactttgcaaggtagaaagtttttgttagtgttggatgatgtctgggatacggggctgattggaataacaattgaaaaatggaatgatctaaaatgcttgttaaatgtgggagctaatggaagtaaaatcatcataacaacacgaaatagatcagttgccttacttgtgaatcccttatacttgcattttttagaaggtcttccccacaaagattgcatatcattgtttatcaaaagggcatttaagaaaggagaggagcaacgctatcaacatttgatagaaattggagagaatattgtgaagaagtgtggaggagttcctttagcagttgctactatagggagcatgctctatttgaatacagatgaacaccaatggtctagtatcagagatgatgacatgtggagtatagggaatgacgagattctacctgcactcaaattgagctatgatgcattgccacaacacttgaaaccatgttttgcattttgttcacttttcccaaaggattttgaattcagtagtgcaatgttgattccattgtggatagcacaaggctacctcaagacatctaagaaaaatgaagattttgaacaggtgggtatagactatataaggcaagtttgctctagatctttgtttcaagttgaggtggatctcaaaacaactatattatttaaaatacatgatctcgttcatgatttagcaatttcagtggcacaagtagagtactccacagtcaattttcgtcccactagtgcttttgaaatggttcgacatgtatcaatatctaaaaaggacttgcttggagaagaggcacaagttcccgatttcatgctcaagtcaaagaaattacgaaccattctagtttctgaagatggtcagataagtcaacattttgtgaagacatgcatctcgagattcaaatatatgcgggtgctagatctcagtggttcgcctgttgaggagctaccaagttccattggtagtttgttttatttgagatttctcagcttgtctgaaaataggaagataaaaaggcttcccaattccatcagtaagctgctgaatttggagaccttgtacctttcgggatgtgtcaatcttaaatctttgggcgaagagatccaattcctcaacaaccttcgtatactggcgattagcagttgtaataatttggaatgcttgccaccaaatatgaaacacatgaccgctttacatactttgggtgtcgatgattgcccgatgcttcagttgatgagatcaggggaaggtcctcaacgtcttcgatcattgatgatcggggattcaagtttggaggctttgcccccttggctcattgaagattcttcagacactctacagagcatatggcttggtgaatgtcataatctcacggcacttgcggagttgctgaacttcagattcctcgagcaactacacattgaagaatgctccaaattgtcggctttgccgcaagagttggattgccttactgagttgagagaattggagatcattggttgtcctgaattgagcaaaagctgcaaaaggcaattaaaaggtgaggagtggtcaaagatggcacgtcaggtgaagattacactcgacgctgatgatgaagaagatgaagccgacaatcgcttggccaacggtaggatcgcgtaccacacgcgacgacgccgtcagaggaagaagaaggtcgctggctacaagttgtacgctgtggaggggaagctgaaagggactctcaggaagagcttcaggtggctcaaggagacctgtgatagagtgacatctttccaatgcctattgaacaagcaaggaggaaaactagctgcttgggaatatccatttgttccaatcagggtgcttcaaaatgaagaagtcctgcactgctgtattgttcgagcttggagtagcttggattggtcaaagatggcacgtcaggcgaagattacgctcgactcgtatgcggatactgatgatgaagaagacgaagatgaaggtacaccaatgatcaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

948

Amino Acids

108.33

Weight (kDa)

6.23

Isoelectric Point (pI)

45.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000159)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g22800 FvH4_1g23030 FvH4_2g17621 FvH4_2g17623 FvH4_2g17640 FvH4_3g16170 FvH4_4g15173 FvH4_4g15190 FvH4_5g16900 FvH4_6g51550 FvH4_6g51570 FvH4_6g51610 FvH4_6g51610 FvH4_7g31270 FvH4_7g31321 FvH4_7g31321
malus_domestica MD06G1096400.v1.1 MD14G1231900.v1.1
prunus_persica Prupe.5G111200_v2.0.a1 Prupe.5G227800_v2.0.a1
pyrus_communis pycom06g09270
rosa_chinensis RchiOBHm_Chr2g0116281 RchiOBHm_Chr2g0116321 RchiOBHm_Chr2g0116651 RchiOBHm_Chr2g0116681 RchiOBHm_Chr2g0116691 RchiOBHm_Chr2g0116761 RchiOBHm_Chr2g0116981 RchiOBHm_Chr2g0117271 RchiOBHm_Chr2g0117561 RchiOBHm_Chr2g0117671 RchiOBHm_Chr5g0009011 RchiOBHm_Chr5g0009021 RchiOBHm_Chr5g0009031 RchiOBHm_Chr5g0051501 RchiOBHm_Chr5g0059261 RchiOBHm_Chr7g0179121 RchiOBHm_Chr7g0179151 RchiOBHm_Chr7g0180011 RchiOBHm_Chr7g0180031
rosa_laevigata RLG00000018253 RLG00000018256 RLG00000018298 RLG00000018318 RLG00000018339 RLG00000018341 RLG00000018355 RLG00000018360 RLG00000018363 RLG00000018364 RLG00000021097
rosa_multiflora Rmu_co8108666.1_g000001 Rmu_co8113786.1_g000001 Rmu_co8303371.1_g000001 Rmu_co8353409.1_g000001 Rmu_sc0000888.1_g000020 Rmu_sc0001035.1_g000046 Rmu_sc0001617.1_g000028 Rmu_sc0001617.1_g000031 Rmu_sc0002009.1_g000005 Rmu_sc0002009.1_g000024 Rmu_sc0002034.1_g000013 Rmu_sc0002191.1_g000001 Rmu_sc0002983.1_g000027 Rmu_sc0003499.1_g000025 Rmu_sc0004602.1_g000012 Rmu_sc0004795.1_g000010 Rmu_sc0004795.1_g000017 Rmu_sc0004888.1_g000050 Rmu_sc0004888.1_g000052 Rmu_sc0004888.1_g000054 Rmu_sc0004942.1_g000014 Rmu_sc0004942.1_g000015 Rmu_sc0004942.1_g000017 Rmu_sc0004942.1_g000020 Rmu_sc0005792.1_g000003 Rmu_sc0006184.1_g000014 Rmu_sc0006730.1_g000011 Rmu_sc0006730.1_g000012 Rmu_sc0011574.1_g000001 Rmu_sc0011574.1_g000002 Rmu_sc0011969.1_g000003 Rmu_sc0016190.1_g000001 Rmu_sc0016190.1_g000002 Rmu_sc0020362.1_g000003 Rmu_sc0020362.1_g000004 Rmu_sc0020362.1_g000005 Rmu_sc0025557.1_g000002 Rmu_sc0031855.1_g000001 Rmu_ssc0000119.1_g000002 Rmu_ssc0000119.1_g000006 Rmu_ssc0000119.1_g000008 Rmu_ssc0000119.1_g000015 Rmu_ssc0000119.1_g000018 Rmu_ssc0000119.1_g000023 Rmu_ssc0000238.1_g000010 Rmu_ssc0000238.1_g000014
rosa_roxburghii Rroxscaffold_1G00067000 Rroxscaffold_1G00067640 Rroxscaffold_2G00126270 Rroxscaffold_2G00126830 Rroxscaffold_2G00126970 Rroxscaffold_2G00127350 Rroxscaffold_3G00273210 Rroxscaffold_3G00273240 Rroxscaffold_3G00274260 Rroxscaffold_3G00274370 Rroxscaffold_4G00321190
rosa_rugosa Rorug02G0205600 Rorug02G0209300 Rorug02G0209500 Rorug02G0211700 Rorug02G0212300 Rorug02G0213200 Rorug02G0213200 Rorug02G0213400 Rorug03G0352400 Rorug03G0352500 Rorug04G0440900 Rorug05G0171300 Rorug05G0322100 Rorug06G0421200 Rorug06G0421400 Rorug06G0421500 Rorug06G0421600 Rorug06G0429800 Rorug06G0430000 Rorug06G0430100
rosa_samantha Rh1DG100600 Rh2AG260900 Rh2AG261000 Rh2AG263400 Rh2AG263600 Rh2AG263900 Rh2AG265300 Rh2AG269300 Rh2AG269700 Rh2BG281000 Rh2CG267300 Rh2CG267500 Rh2CG270600 Rh2CG270700 Rh2CG271100 Rh2DG274100 Rh2DG290500 Rh2DG291600 Rh4DG089700 Rh5CG077900 Rh5CG421700 Rh5DG065900 Rh5DG066000 Rh7BG020200 Rh7BG020700 Rh7BG029700 Rh7BG029800 Rh7BG029900 Rh7BG030100 Rh7CG031400 Rh7CG031900 Rh7DG021300 Rh7DG030600 Rh7DG030900
rosa_wichuraiana Rw0G008860 Rw1G007590 Rw2G020460 Rw2G020740 Rw2G020770 Rw2G020820 Rw2G020920 Rw2G021100 Rw2G021120 Rw2G021260 Rw2G021280 Rw2G021290 Rw5G006520 Rw5G028690 Rw5G036360 Rw5G036370 Rw7G001730 Rw7G002430 Rw7G002450 Rw7G002470 Rw7G002510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 2502
Acc36I ACCTGC 1 cut(s) 1258
AccI GTMKAC 2 cut(s) 276, 1969
AccII CGCG 3 cut(s) 744, 2483, 2494
AciI CCGC 7 cut(s) 259, 744, 1753, 2031, 2225, 2294, 2795
AclWI GGATC 4 cut(s) 443, 1482, 1939, 2486
AcoI YGGCCR 1 cut(s) 2466
AcsI RAATTY 3 cut(s) 683, 1334, 1888
AcuI CTGAAG 6 cut(s) 465, 1713, 2054, 2154, 2224, 2566
AcyI GRCGYC 1 cut(s) 2500
AfaI GTAC 6 cut(s) 306, 1550, 1904, 2486, 2540, 2830
AfiI CCNNNNNNNGG 3 cut(s) 78, 615, 2475
AflIII ACRYGT 2 cut(s) 1218, 1597
AhlI ACTAGT 2 cut(s) 133, 1574
AjiI CACGTC 2 cut(s) 2408, 2765
AjuI GAANNNNNNNTTGG 2 cut(s) 723, 755
Alw21I GWGCWC 2 cut(s) 99, 462
Alw26I GTCTC 4 cut(s) 482, 715, 1889, 2591
AlwI GGATC 4 cut(s) 443, 1482, 1939, 2486
Ama87I CYCGRG 2 cut(s) 1735, 2249
AoxI GGCC 1 cut(s) 2466
ApeKI GCWGC 5 cut(s) 15, 758, 1882, 2364, 2657
ApoI RAATTY 3 cut(s) 683, 1334, 1888
ArsI GACNNNNNNTTYG 2 cut(s) 481, 513
AseI ATTAAT 1 cut(s) 737
Asp700I GAANNNNTTC 3 cut(s) 1017, 1590, 2579
AspS9I GGNCC 2 cut(s) 793, 2093
AsuHPI GGTGA 4 cut(s) 91, 2210, 2396, 2425
AsuNHI GCTAGC 1 cut(s) 43
AvaI CYCGRG 2 cut(s) 1735, 2249
AvaII GGWCC 2 cut(s) 793, 2093
BaeGI GKGCMC 1 cut(s) 88
BalI TGGCCA 1 cut(s) 2468
BanII GRGCYC 1 cut(s) 99
BbsI GAAGAC 4 cut(s) 1010, 1730, 2096, 2820
Bbv12I GWGCWC 2 cut(s) 99, 462
BbvI GCAGC 5 cut(s) 27, 745, 1869, 2351, 2644
BccI CCATC 7 cut(s) 134, 318, 617, 1691, 1880, 2395, 2752
BceAI ACGGC 2 cut(s) 2232, 2487
BcgI CGANNNNNNTGC 2 cut(s) 2774, 2808
BciVI GTATCC 2 cut(s) 859, 2791
BclI TGATCA 1 cut(s) 2838
BcoDI GTCTC 4 cut(s) 482, 715, 1889, 2591
BcuI ACTAGT 2 cut(s) 133, 1574
BfmI CTRYAG 2 cut(s) 1155, 2180
BfuAI ACCTGC 1 cut(s) 1258
BfuI GTATCC 2 cut(s) 859, 2791
BglI GCCNNNNNGGC 1 cut(s) 2152
BglII AGATCT 3 cut(s) 66, 1451, 1762
BisI GCNGC 7 cut(s) 16, 745, 759, 1883, 2294, 2365, 2658
BlsI GCNGC 7 cut(s) 17, 746, 760, 1884, 2295, 2366, 2659
BmcAI AGTACT 1 cut(s) 1550
Bme18I GGWCC 2 cut(s) 793, 2093
BmeT110I CYCGRG 2 cut(s) 1735, 2249
BmgBI CACGTC 2 cut(s) 2408, 2765
BmgT120I GGNCC 2 cut(s) 793, 2093
BmsI GCATC 5 cut(s) 136, 459, 1261, 1740, 2055
BmtI GCTAGC 1 cut(s) 47
BpiI GAAGAC 4 cut(s) 1010, 1730, 2096, 2820
BplI GAGNNNNNCTC 2 cut(s) 479, 511
BpmI CTGGAG 1 cut(s) 263
BpuEI CTTGAG 5 cut(s) 113, 161, 1367, 1643, 2576
BsaHI GRCGYC 1 cut(s) 2500
BsaI GGTCTC 3 cut(s) 482, 1889, 2591
BsaJI CCNNGG 3 cut(s) 72, 613, 2150
BsaXI ACNNNNNCTCC 2 cut(s) 1886, 1916
Bsc4I CCNNNNNNNGG 3 cut(s) 78, 615, 2475
Bse1I ACTGG 3 cut(s) 246, 332, 1977
Bse3DI GCAATG 3 cut(s) 18, 1274, 1353
BseDI CCNNGG 3 cut(s) 72, 613, 2150
BseGI GGATG 6 cut(s) 151, 474, 609, 787, 859, 1919
BseLI CCNNNNNNNGG 3 cut(s) 78, 615, 2475
BseMI GCAATG 3 cut(s) 18, 1274, 1353
BseMII CTCAG 6 cut(s) 155, 726, 1780, 1843, 2307, 2584
BseNI ACTGG 3 cut(s) 246, 332, 1977
BseRI GAGGAG 5 cut(s) 692, 1088, 1146, 1799, 2402
BseSI GKGCMC 1 cut(s) 88
BseXI GCAGC 5 cut(s) 27, 745, 1869, 2351, 2644
BsgI GTGCAG 2 cut(s) 1236, 2696
Bsh1236I CGCG 3 cut(s) 744, 2483, 2494
BshFI GGCC 1 cut(s) 2468
BsiHKAI GWGCWC 2 cut(s) 99, 462
BsiHKCI CYCGRG 2 cut(s) 1735, 2249
BslFI GGGAC 3 cut(s) 369, 1554, 2578
BslI CCNNNNNNNGG 3 cut(s) 78, 615, 2475
BsmAI GTCTC 4 cut(s) 482, 715, 1889, 2591
BsmFI GGGAC 3 cut(s) 369, 1554, 2578
BsmI GAATGC 2 cut(s) 2006, 2276
BsnI GGCC 1 cut(s) 2468
Bso31I GGTCTC 3 cut(s) 482, 1889, 2591
BsoBI CYCGRG 2 cut(s) 1735, 2249
Bsp1286I GDGCHC 3 cut(s) 88, 99, 462
BspACI CCGC 7 cut(s) 259, 744, 1753, 2031, 2225, 2294, 2795
BspANI GGCC 1 cut(s) 2468
BspCNI CTCAG 6 cut(s) 156, 725, 1779, 1842, 2308, 2583
BspFNI CGCG 3 cut(s) 744, 2483, 2494
BspHI TCATGA 1 cut(s) 1516
BspMI ACCTGC 1 cut(s) 1258
BspOI GCTAGC 1 cut(s) 47
BspPI GGATC 4 cut(s) 443, 1482, 1939, 2486
BspQI GCTCTTC 1 cut(s) 2570
BspTNI GGTCTC 3 cut(s) 482, 1889, 2591
BsrDI GCAATG 3 cut(s) 18, 1274, 1353
BsrI ACTGG 3 cut(s) 246, 332, 1977
BssECI CCNNGG 3 cut(s) 72, 613, 2150
BssNAI GTATAC 1 cut(s) 1970
BssNI GRCGYC 1 cut(s) 2500
BssT1I CCWWGG 3 cut(s) 72, 613, 2150
Bst1107I GTATAC 1 cut(s) 1970
Bst4CI ACNGT 3 cut(s) 284, 1558, 2474
Bst6I CTCTTC 4 cut(s) 520, 1626, 1935, 2570
BstACI GRCGYC 1 cut(s) 2500
BstAPI GCANNNNNTGC 2 cut(s) 83, 2364
BstC8I GCNNGC 5 cut(s) 13, 45, 1166, 2006, 2527
BstDEI CTNAG 8 cut(s) 164, 435, 712, 1392, 1766, 1829, 2316, 2570
BstF5I GGATG 6 cut(s) 151, 474, 609, 787, 859, 1919
BstFNI CGCG 3 cut(s) 744, 2483, 2494
BstMAI GTCTC 4 cut(s) 482, 715, 1889, 2591
BstMWI GCNNNNNNNGC 7 cut(s) 53, 83, 103, 440, 2152, 2364, 2768
BstNSI RCATGY 5 cut(s) 56, 1168, 1222, 1601, 1731
BstSFI CTRYAG 2 cut(s) 1155, 2180
BstSLI GKGCMC 1 cut(s) 88
BstUI CGCG 3 cut(s) 744, 2483, 2494
BstV1I GCAGC 5 cut(s) 27, 745, 1869, 2351, 2644
BstV2I GAAGAC 4 cut(s) 1010, 1730, 2096, 2820
BstX2I RGATCY 6 cut(s) 66, 448, 1451, 1474, 1762, 1944
BstYI RGATCY 6 cut(s) 66, 448, 1451, 1474, 1762, 1944
BstZ17I GTATAC 1 cut(s) 1970
BsuI GTATCC 2 cut(s) 859, 2791
BsuRI GGCC 1 cut(s) 2468
BtrI CACGTC 2 cut(s) 2408, 2765
BtsCI GGATG 6 cut(s) 151, 474, 609, 787, 859, 1919
BtsI GCAGTG 1 cut(s) 2713
BtsIMutI CAGTG 5 cut(s) 289, 570, 1539, 1774, 2713
BveI ACCTGC 1 cut(s) 1258
Cac8I GCNNGC 5 cut(s) 13, 45, 1166, 2006, 2527
CciI TCATGA 1 cut(s) 1516
Cfr13I GGNCC 2 cut(s) 793, 2093
CseI GACGC 2 cut(s) 2438, 2508
Csp6I GTAC 6 cut(s) 305, 1549, 1903, 2485, 2539, 2829
CspCI CAANNNNNGTGG 6 cut(s) 1013, 1048, 1269, 1304, 1515, 1550
CviQI GTAC 6 cut(s) 305, 1549, 1903, 2485, 2539, 2829
DdeI CTNAG 8 cut(s) 164, 435, 712, 1392, 1766, 1829, 2316, 2570
DraI TTTAAA 1 cut(s) 1498
DrdI GACNNNNNNGTC 1 cut(s) 2502
DseDI GACNNNNNNGTC 1 cut(s) 2502
EaeI YGGCCR 1 cut(s) 2466
Eam1104I CTCTTC 4 cut(s) 520, 1626, 1935, 2570
EarI CTCTTC 4 cut(s) 520, 1626, 1935, 2570
Ecl136II GAGCTC 1 cut(s) 97
Eco130I CCWWGG 3 cut(s) 72, 613, 2150
Eco24I GRGCYC 1 cut(s) 99
Eco31I GGTCTC 3 cut(s) 482, 1889, 2591
Eco32I GATATC 1 cut(s) 577
Eco47I GGWCC 2 cut(s) 793, 2093
Eco53kI GAGCTC 1 cut(s) 97
Eco57I CTGAAG 6 cut(s) 465, 1713, 2054, 2154, 2224, 2566
Eco88I CYCGRG 2 cut(s) 1735, 2249
EcoICRI GAGCTC 1 cut(s) 97
EcoO109I RGGNCCY 1 cut(s) 2093
EcoRI GAATTC 1 cut(s) 1334
EcoRV GATATC 1 cut(s) 577
EcoT14I CCWWGG 3 cut(s) 72, 613, 2150
EcoT22I ATGCAT 2 cut(s) 1276, 1733
EcoT38I GRGCYC 1 cut(s) 99
ErhI CCWWGG 3 cut(s) 72, 613, 2150
FaqI GGGAC 3 cut(s) 369, 1554, 2578
FauI CCCGC 1 cut(s) 1746
FauNDI CATATG 1 cut(s) 2189
FbaI TGATCA 1 cut(s) 2838
FblI GTMKAC 2 cut(s) 276, 1969
Fnu4HI GCNGC 7 cut(s) 16, 745, 759, 1883, 2294, 2365, 2658
FokI GGATG 6 cut(s) 158, 481, 596, 794, 866, 1926
FriOI GRGCYC 1 cut(s) 99
Fsp4HI GCNGC 7 cut(s) 16, 745, 759, 1883, 2294, 2365, 2658
GluI GCNGC 7 cut(s) 16, 745, 759, 1883, 2294, 2365, 2658
GsuI CTGGAG 1 cut(s) 263
HaeIII GGCC 1 cut(s) 2468
HgaI GACGC 2 cut(s) 2438, 2508
Hin1I GRCGYC 1 cut(s) 2500
HincII GTYRAC 2 cut(s) 277, 1712
HindII GTYRAC 2 cut(s) 277, 1712
HindIII AAGCTT 1 cut(s) 787
HphI GGTGA 4 cut(s) 91, 2210, 2396, 2425
Hpy166II GTNNAC 5 cut(s) 277, 1313, 1712, 1970, 2831
Hpy188I TCNGA 8 cut(s) 715, 1208, 1693, 1704, 1840, 2173, 2243, 2508
Hpy8I GTNNAC 5 cut(s) 277, 1313, 1712, 1970, 2831
Hpy99I CGWCG 3 cut(s) 2432, 2499, 2502
HpyAV CCTTC 5 cut(s) 1007, 1973, 2084, 2512, 2819
HpyCH4III ACNGT 3 cut(s) 284, 1558, 2474
HpyCH4IV ACGT 4 cut(s) 219, 2101, 2407, 2764
HpyF10VI GCNNNNNNNGC 7 cut(s) 53, 83, 103, 440, 2152, 2364, 2768
HpyF3I CTNAG 8 cut(s) 164, 435, 712, 1392, 1766, 1829, 2316, 2570
HpySE526I ACGT 4 cut(s) 219, 2101, 2407, 2764
Hsp92I GRCGYC 1 cut(s) 2500
Ksp22I TGATCA 1 cut(s) 2838
LguI GCTCTTC 1 cut(s) 2570
LmnI GCTCC 6 cut(s) 465, 929, 1075, 1161, 1786, 2279
Lsp1109I GCAGC 5 cut(s) 27, 745, 1869, 2351, 2644
LweI GCATC 5 cut(s) 136, 459, 1261, 1740, 2055
MaeII ACGT 4 cut(s) 219, 2101, 2407, 2764
MaeIII GTNAC 1 cut(s) 2611
MfeI CAATTG 1 cut(s) 888
MflI RGATCY 6 cut(s) 66, 448, 1451, 1474, 1762, 1944
MhlI GDGCHC 3 cut(s) 88, 99, 462
MlsI TGGCCA 1 cut(s) 2468
MluNI TGGCCA 1 cut(s) 2468
MlyI GAGTC 3 cut(s) 488, 2560, 2780
MmeI TCCRAC 2 cut(s) 831, 2283
Mox20I TGGCCA 1 cut(s) 2468
Mph1103I ATGCAT 2 cut(s) 1276, 1733
MroXI GAANNNNTTC 3 cut(s) 1017, 1590, 2579
MscI TGGCCA 1 cut(s) 2468
Msp20I TGGCCA 1 cut(s) 2468
MunI CAATTG 1 cut(s) 888
Mva1269I GAATGC 2 cut(s) 2006, 2276
MvnI CGCG 3 cut(s) 744, 2483, 2494
MwoI GCNNNNNNNGC 7 cut(s) 53, 83, 103, 440, 2152, 2364, 2768
NdeI CATATG 1 cut(s) 2189
NheI GCTAGC 1 cut(s) 43
NmuCI GTSAC 1 cut(s) 2611
NsiI ATGCAT 2 cut(s) 1276, 1733
NspI RCATGY 5 cut(s) 56, 1168, 1222, 1601, 1731
PaeI GCATGC 1 cut(s) 1168
PaeR7I CTCGAG 2 cut(s) 1735, 2249
PagI TCATGA 1 cut(s) 1516
PciI ACATGT 2 cut(s) 1218, 1597
PciSI GCTCTTC 1 cut(s) 2570
PcsI WCGNNNNNNNCGW 1 cut(s) 2786
PctI GAATGC 2 cut(s) 2006, 2276
PdmI GAANNNNTTC 3 cut(s) 1017, 1590, 2579
PfeI GAWTC 8 cut(s) 328, 988, 1243, 1354, 1740, 2126, 2165, 2244
PflFI GACNNNGTC 1 cut(s) 2502
PkrI GCNGC 7 cut(s) 17, 746, 760, 1884, 2295, 2366, 2659
PleI GAGTC 3 cut(s) 488, 2560, 2780
PpsI GAGTC 3 cut(s) 488, 2560, 2780
PpuMI RGGWCCY 1 cut(s) 2093
PscI ACATGT 2 cut(s) 1218, 1597
PshBI ATTAAT 1 cut(s) 737
Psp124BI GAGCTC 1 cut(s) 99
Psp5II RGGWCCY 1 cut(s) 2093
PspPI GGNCC 2 cut(s) 793, 2093
PspPPI RGGWCCY 1 cut(s) 2093
PspXI VCTCGAGB 1 cut(s) 2249
PsuI RGATCY 6 cut(s) 66, 448, 1451, 1474, 1762, 1944
PsyI GACNNNGTC 1 cut(s) 2502
RsaI GTAC 6 cut(s) 306, 1550, 1904, 2486, 2540, 2830
RsaNI GTAC 6 cut(s) 305, 1549, 1903, 2485, 2539, 2829
SacI GAGCTC 1 cut(s) 99
SalI GTCGAC 1 cut(s) 275
SapI GCTCTTC 1 cut(s) 2570
SatI GCNGC 7 cut(s) 16, 745, 759, 1883, 2294, 2365, 2658
Sau96I GGNCC 2 cut(s) 793, 2093
ScaI AGTACT 1 cut(s) 1550
SchI GAGTC 3 cut(s) 488, 2560, 2780
SduI GDGCHC 3 cut(s) 88, 99, 462
SfaNI GCATC 5 cut(s) 136, 459, 1261, 1740, 2055
SfcI CTRYAG 2 cut(s) 1155, 2180
Sfr274I CTCGAG 2 cut(s) 1735, 2249
SinI GGWCC 2 cut(s) 793, 2093
SlaI CTCGAG 2 cut(s) 1735, 2249
SmlI CTYRAG 7 cut(s) 92, 140, 1382, 1658, 1735, 2249, 2591
SmoI CTYRAG 7 cut(s) 92, 140, 1382, 1658, 1735, 2249, 2591
SpeI ACTAGT 2 cut(s) 133, 1574
SphI GCATGC 1 cut(s) 1168
SsiI CCGC 7 cut(s) 259, 744, 1753, 2031, 2225, 2294, 2795
SspI AATATT 1 cut(s) 1114
SstI GAGCTC 1 cut(s) 99
StyI CCWWGG 3 cut(s) 72, 613, 2150
TaaI ACNGT 3 cut(s) 284, 1558, 2474
TaiI ACGT 4 cut(s) 222, 2104, 2410, 2767
TaqI TCGA 9 cut(s) 276, 1594, 1736, 2052, 2107, 2250, 2427, 2728, 2784
TaqII GACCGA 1 cut(s) 506
TatI WGTACW 1 cut(s) 1548
TauI GCSGC 2 cut(s) 747, 2296
TfiI GAWTC 8 cut(s) 328, 988, 1243, 1354, 1740, 2126, 2165, 2244
TscAI CASTG 5 cut(s) 289, 577, 1539, 1774, 2720
TseFI GTSAC 1 cut(s) 2611
TseI GCWGC 5 cut(s) 15, 758, 1882, 2364, 2657
Tsp45I GTSAC 1 cut(s) 2611
TspRI CASTG 5 cut(s) 289, 577, 1539, 1774, 2720
Tth111I GACNNNGTC 1 cut(s) 2502
VpaK11BI GGWCC 2 cut(s) 793, 2093
VspI ATTAAT 1 cut(s) 737
XapI RAATTY 3 cut(s) 683, 1334, 1888
XbaI TCTAGA 1 cut(s) 1448
XceI RCATGY 5 cut(s) 56, 1168, 1222, 1601, 1731
XhoI CTCGAG 2 cut(s) 1735, 2249
XmiI GTMKAC 2 cut(s) 276, 1969
XmnI GAANNNNTTC 3 cut(s) 1017, 1590, 2579
ZrmI AGTACT 1 cut(s) 1550
Zsp2I ATGCAT 2 cut(s) 1276, 1733
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.