Rmu_sc0000229.1_g000003

F-box FBD LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000229.1
OG0000103
Physical Location & Seq
Reverse (-)
11917 .. 13575
1659 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000229.1_g000003.1.cds

Sequence Viewer

Length: 1332 bp
atggagttggatagaattagcagtttaccaaatgatgttacagaaaagattttgtcaggtttgccacttaaggaggcagtaaggacaagtattttatccagaaagtggaggtacaaatcggacatgcttcaagctctagtgtttgatgatgagtgtctcgagactcaaagtcatccaaccttcagctttgtgaatattgttgatcatgtactcttactccataaaggtcccatacacaggttcgagctttctttcaatggtaagctagccactagggatatagatcgatggatttttcacctatccagaaaccctgtcatcaaagagatgatacttgacaatttcgaaggggacatctacaacattccatcatgtttgttttcttttaaagatatcgttcatttagagttattcaggtgtttgctaaaccctccttccacattcaaaggctttggcagcttgaagagccttgatctttggtcggttactttggcccaagatgtgtttgacaacttgattggttgcagtcctctgcttgagatattgaaattgcaaagatgtgatggtttcactaatctcaagattgatgcaccgaagctcctgtttatttacatagtaggggacgttgaagattttaacctcgtggattcctcaaatcttgtggatgcttcctttgatttgcaggtcattgttgatcaaagagggaattgtagtagatttgggaatttgctcaagttttttgatcaccagctgcctcatattcgaaggctcacaataatgtacttgtctattggtgccttgccagagaagctccctaaaccatgcgatatctcatttttctttcaggctcacaataaagaggaactttctaaaagtaatggttttgactgggaatacttgtctattggtgccttgccagagaagctccctaagccatgccaatatctcaattttctttctttagacatgaactttgacaatccggatgaaatttcaactgtcttatgccttctgagaagctctcctgctctacaagaactgaaaattttggtggaccctaaaaaggatcaagctgctgtgggagaagtggaatcttgtttatatgacaactacaactgtgcatatactcaactgcggcttgtggaaataaccaagatctctggtgtaaaagctcaactagatttcatcaaatctctgcttctaagttcacctgtgcttgagagaatgactgttcaacctgcctctctcaacggttcttttaagcttgtaaaagatttacttctgtttaagcgtgattcaaagcgtgcagagataatggttttggacccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

443

Amino Acids

50.53

Weight (kDa)

5.58

Isoelectric Point (pI)

40.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000103)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g03461 FvH4_2g03490 FvH4_2g03500 FvH4_2g03500 FvH4_2g03510 FvH4_2g03510 FvH4_2g03521 FvH4_2g03521 FvH4_2g27100 FvH4_2g27110 FvH4_2g27130 FvH4_2g27150 FvH4_2g40420 FvH4_2g40420 FvH4_2g40420 FvH4_2g40420 FvH4_3g20160 FvH4_3g20160 FvH4_3g33042 FvH4_4g17790 FvH4_5g14272 FvH4_5g14273 FvH4_5g20540
malus_domestica MD00G1039500.v1.1 MD05G1103500.v1.1 MD05G1103900.v1.1 MD05G1104300.v1.1 MD05G1104400.v1.1 MD05G1104600.v1.1 MD05G1157200.v1.1 MD05G1157700.v1.1 MD05G1157800.v1.1 MD08G1037400.v1.1 MD10G1108900.v1.1
prunus_persica Prupe.1G384700_v2.0.a1 Prupe.1G384700_v2.0.a1 Prupe.8G148700_v2.0.a1 Prupe.8G148700_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G149000_v2.0.a1
pyrus_communis pycom05g10100 pycom05g14980 pycom08g02980 pycom10g09400 pycom15g02910
rosa_chinensis RchiOBHm_Chr3g0455511 RchiOBHm_Chr4g0421851 RchiOBHm_Chr4g0421921 RchiOBHm_Chr4g0421931 RchiOBHm_Chr5g0033951 RchiOBHm_Chr5g0033971 RchiOBHm_Chr6g0248641 RchiOBHm_Chr6g0248651 RchiOBHm_Chr6g0248671 RchiOBHm_Chr6g0248681 RchiOBHm_Chr6g0248731 RchiOBHm_Chr6g0248741 RchiOBHm_Chr6g0248771 RchiOBHm_Chr6g0248791 RchiOBHm_Chr6g0248851 RchiOBHm_Chr6g0248871 RchiOBHm_Chr6g0248881 RchiOBHm_Chr6g0248921 RchiOBHm_Chr6g0252081 RchiOBHm_Chr6g0252091 RchiOBHm_Chr6g0252101 RchiOBHm_Chr6g0267131 RchiOBHm_Chr6g0295981 RchiOBHm_Chr6g0295991 RchiOBHm_Chr6g0296021 RchiOBHm_Chr6g0300311 RchiOBHm_Chr7g0182631
rosa_laevigata RLG00000005114 RLG00000007652 RLG00000011348 RLG00000011741 RLG00000011742 RLG00000011743 RLG00000011744 RLG00000011745 RLG00000011747 RLG00000011748 RLG00000011749 RLG00000011750 RLG00000014028 RLG00000014036 RLG00000015111 RLG00000015113 RLG00000015115 RLG00000015117 RLG00000015119 RLG00000015123 RLG00000015124 RLG00000015127 RLG00000015128 RLG00000015129 RLG00000015132 RLG00000033513 RLG00000034608
rosa_multiflora Rmu_co8062356.1_g000001 Rmu_co8494777.1_g000001 Rmu_sc0000229.1_g000003 Rmu_sc0000529.1_g000001 Rmu_sc0000529.1_g000002 Rmu_sc0000529.1_g000003 Rmu_sc0001014.1_g000001 Rmu_sc0001150.1_g000007 Rmu_sc0001562.1_g000002 Rmu_sc0001562.1_g000004 Rmu_sc0001562.1_g000005 Rmu_sc0001562.1_g000017 Rmu_sc0001562.1_g000033 Rmu_sc0001562.1_g000035 Rmu_sc0001670.1_g000022 Rmu_sc0002393.1_g000007 Rmu_sc0002393.1_g000008 Rmu_sc0002393.1_g000009 Rmu_sc0002393.1_g000010 Rmu_sc0002393.1_g000011 Rmu_sc0002393.1_g000021 Rmu_sc0002393.1_g000023 Rmu_sc0002393.1_g000035 Rmu_sc0002393.1_g000037 Rmu_sc0002489.1_g000003 Rmu_sc0002938.1_g000047 Rmu_sc0003139.1_g000013 Rmu_sc0003139.1_g000014 Rmu_sc0003139.1_g000015 Rmu_sc0003139.1_g000017 Rmu_sc0004275.1_g000033 Rmu_sc0004275.1_g000036 Rmu_sc0004703.1_g000001 Rmu_sc0006276.1_g000003 Rmu_sc0010676.1_g000003 Rmu_sc0010676.1_g000004 Rmu_sc0010676.1_g000006 Rmu_sc0010676.1_g000007 Rmu_sc0013953.1_g000004 Rmu_ssc0000388.1_g000016
rosa_roxburghii Rroxscaffold_1G00015220 Rroxscaffold_1G00046270 Rroxscaffold_2G00090150 Rroxscaffold_2G00120650 Rroxscaffold_2G00123380 Rroxscaffold_3G00234080 Rroxscaffold_3G00271110 Rroxscaffold_7G00167900 Rroxscaffold_7G00171950 Rroxscaffold_7G00171970 Rroxscaffold_7G00171980 Rroxscaffold_7G00171990 Rroxscaffold_7G00172000 Rroxscaffold_7G00201050 Rroxscaffold_7G00212860 Rroxscaffold_7G00212880 Rroxscaffold_7G00212920 Rroxscaffold_7G00212940 Rroxscaffold_7G00212990 Rroxscaffold_7G00213060 Rroxscaffold_7G00213070 Rroxscaffold_7G00213080 Rroxscaffold_7G00213100 Rroxscaffold_7G00213110 Rroxscaffold_7G00213120 Rroxscaffold_7G00213130 Rroxscaffold_7G00213140 Rroxscaffold_7G00217950
rosa_rugosa Rorug04G0089100 Rorug04G0176100 Rorug05G0143700 Rorug05G0532600 Rorug05G0532700 Rorug05G0532800 Rorug05G0533100 Rorug05G0533200 Rorug05G0533300 Rorug05G0533400 Rorug05G0533500 Rorug05G0533500 Rorug05G0533700 Rorug05G0533800 Rorug05G0533900 Rorug05G0534000 Rorug05G0534100.1 Rorug05G0534200 Rorug06G0029200 Rorug06G0029300 Rorug06G0029400 Rorug06G0255600 Rorug06G0255800 Rorug06G0255800 Rorug06G0255900 Rorug06G0255900 Rorug06G0255900 Rorug06G0256000 Rorug06G0256100 Rorug06G0256300 Rorug06G0256400 Rorug06G0294900 Rorug06G0448600 Rorug06G0448600 Rorug07G0094000
rosa_samantha Rh3BG070200 Rh3CG325900 Rh5BG235500 Rh6AG049500 Rh6AG049600 Rh6AG049800 Rh6AG049900 Rh6AG050100 Rh6AG050200 Rh6AG050300 Rh6AG050400 Rh6AG050500 Rh6AG050800 Rh6AG051100 Rh6AG051500 Rh6AG151100 Rh6AG369300 Rh6AG369500 Rh6AG369600 Rh6AG369800 Rh6AG369900 Rh6AG407600 Rh6DG038100 Rh7CG053500 Rh7CG053600 Rh7DG051800
rosa_wichuraiana Rw3G005370 Rw3G025850 Rw5G021490 Rw6G004290 Rw6G004300 Rw6G004310 Rw6G004320 Rw6G004330 Rw6G004340 Rw6G004390 Rw6G004410 Rw6G004420 Rw6G004430 Rw6G004450 Rw6G004460 Rw6G004490 Rw6G004510 Rw6G004590 Rw6G013080 Rw6G032210 Rw6G032220 Rw6G032230 Rw6G032250 Rw6G035640 Rw7G004270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 673, 1246
AccB1I GGYRCC 2 cut(s) 794, 908
AccB7I CCANNNNNTGG 1 cut(s) 105
AccIII TCCGGA 1 cut(s) 982
AciI CCGC 1 cut(s) 1135
AclWI GGATC 1 cut(s) 1074
AcsI RAATTY 3 cut(s) 724, 990, 1044
AcuI CTGAAG 1 cut(s) 166
AfaI GTAC 3 cut(s) 113, 210, 782
AfiI CCNNNNNNNGG 3 cut(s) 105, 237, 1063
AflII CTTAAG 1 cut(s) 68
AgsI TTSAA 9 cut(s) 131, 256, 445, 463, 547, 629, 996, 1235, 1299
AhdI GACNNNNNGTC 1 cut(s) 168
Alw26I GTCTC 2 cut(s) 155, 161
AlwI GGATC 1 cut(s) 1074
Ama87I CYCGRG 1 cut(s) 158
Aor13HI TCCGGA 1 cut(s) 982
AoxI GGCC 1 cut(s) 492
ApeKI GCWGC 3 cut(s) 456, 751, 1073
ApoI RAATTY 3 cut(s) 724, 990, 1044
ArsI GACNNNNNNTTYG 2 cut(s) 956, 988
AspS9I GGNCC 4 cut(s) 227, 493, 1054, 1324
AsuHPI GGTGA 3 cut(s) 290, 737, 1200
AsuII TTCGAA 2 cut(s) 345, 763
AsuNHI GCTAGC 1 cut(s) 265
AvaI CYCGRG 1 cut(s) 158
AvaII GGWCC 3 cut(s) 227, 1054, 1324
BanI GGYRCC 2 cut(s) 794, 908
BauI CACGAG 1 cut(s) 641
BbvI GCAGC 3 cut(s) 468, 738, 1060
BccI CCATC 3 cut(s) 282, 376, 557
BclI TGATCA 3 cut(s) 202, 694, 742
BcoDI GTCTC 2 cut(s) 155, 161
BfaI CTAG 4 cut(s) 137, 266, 273, 1178
BfrI CTTAAG 1 cut(s) 68
BfuAI ACCTGC 2 cut(s) 673, 1246
BglII AGATCT 1 cut(s) 1155
BisI GCNGC 4 cut(s) 457, 752, 1074, 1136
BlsI GCNGC 4 cut(s) 458, 753, 1075, 1137
Bme18I GGWCC 3 cut(s) 227, 1054, 1324
BmeRI GACNNNNNGTC 1 cut(s) 168
BmeT110I CYCGRG 1 cut(s) 158
BmgT120I GGNCC 4 cut(s) 227, 493, 1054, 1324
BmiI GGNNCC 5 cut(s) 229, 796, 910, 1056, 1326
BmrI ACTGGG 1 cut(s) 898
BmsI GCATC 2 cut(s) 577, 655
BmtI GCTAGC 1 cut(s) 269
BmuI ACTGGG 1 cut(s) 898
BplI GAGNNNNNCTC 2 cut(s) 1006, 1038
Bpu10I CCTNAGC 1 cut(s) 930
Bpu14I TTCGAA 2 cut(s) 345, 763
BpuEI CTTGAG 4 cut(s) 557, 563, 716, 1238
Bsa29I ATCGAT 1 cut(s) 286
BsaBI GATNNNNATC 1 cut(s) 282
BsaWI WCCGGW 1 cut(s) 982
BsaXI ACNNNNNCTCC 4 cut(s) 201, 231, 582, 612
Bsc4I CCNNNNNNNGG 3 cut(s) 105, 237, 1063
Bse1I ACTGG 1 cut(s) 893
Bse8I GATNNNNATC 1 cut(s) 282
BseAI TCCGGA 1 cut(s) 982
BseCI ATCGAT 1 cut(s) 286
BseGI GGATG 3 cut(s) 172, 670, 991
BseJI GATNNNNATC 1 cut(s) 282
BseLI CCNNNNNNNGG 3 cut(s) 105, 237, 1063
BseMII CTCAG 1 cut(s) 1004
BseNI ACTGG 1 cut(s) 893
BseXI GCAGC 3 cut(s) 468, 738, 1060
BsgI GTGCAG 1 cut(s) 1326
BshFI GGCC 1 cut(s) 494
BshNI GGYRCC 2 cut(s) 794, 908
BshVI ATCGAT 1 cut(s) 286
BsiHKCI CYCGRG 1 cut(s) 158
BsiSI CCGG 1 cut(s) 983
BslFI GGGAC 3 cut(s) 213, 365, 635
BslI CCNNNNNNNGG 3 cut(s) 105, 237, 1063
BsmAI GTCTC 2 cut(s) 155, 161
BsmFI GGGAC 3 cut(s) 213, 365, 635
BsnI GGCC 1 cut(s) 494
BsoBI CYCGRG 1 cut(s) 158
Bsp119I TTCGAA 2 cut(s) 345, 763
Bsp13I TCCGGA 1 cut(s) 982
Bsp143I GATC 7 cut(s) 202, 283, 472, 694, 742, 1066, 1155
BspACI CCGC 1 cut(s) 1135
BspANI GGCC 1 cut(s) 494
BspCNI CTCAG 1 cut(s) 1005
BspDI ATCGAT 1 cut(s) 286
BspEI TCCGGA 1 cut(s) 982
BspLI GGNNCC 5 cut(s) 229, 796, 910, 1056, 1326
BspMI ACCTGC 2 cut(s) 673, 1246
BspOI GCTAGC 1 cut(s) 269
BspPI GGATC 1 cut(s) 1074
BspQI GCTCTTC 1 cut(s) 458
BspT104I TTCGAA 2 cut(s) 345, 763
BspT107I GGYRCC 2 cut(s) 794, 908
BspTI CTTAAG 1 cut(s) 68
BsrI ACTGG 1 cut(s) 893
BssMI GATC 7 cut(s) 202, 283, 472, 694, 742, 1066, 1155
BssSI CACGAG 1 cut(s) 641
Bst2BI CACGAG 1 cut(s) 641
Bst4CI ACNGT 4 cut(s) 1000, 1118, 1231, 1253
Bst6I CTCTTC 1 cut(s) 458
BstAFI CTTAAG 1 cut(s) 68
BstBI TTCGAA 2 cut(s) 345, 763
BstC8I GCNNGC 2 cut(s) 267, 1305
BstDEI CTNAG 3 cut(s) 930, 1013, 1202
BstF5I GGATG 3 cut(s) 172, 670, 991
BstKTI GATC 7 cut(s) 205, 286, 475, 697, 745, 1069, 1158
BstMAI GTCTC 2 cut(s) 155, 161
BstMBI GATC 7 cut(s) 202, 283, 472, 694, 742, 1066, 1155
BstMWI GCNNNNNNNGC 5 cut(s) 456, 465, 808, 922, 931
BstNSI RCATGY 1 cut(s) 127
BstV1I GCAGC 3 cut(s) 468, 738, 1060
BstX2I RGATCY 1 cut(s) 1155
BstYI RGATCY 1 cut(s) 1155
Bsu15I ATCGAT 1 cut(s) 286
BsuRI GGCC 1 cut(s) 494
BsuTUI ATCGAT 1 cut(s) 286
BtsCI GGATG 3 cut(s) 172, 670, 991
BveI ACCTGC 2 cut(s) 673, 1246
Cac8I GCNNGC 2 cut(s) 267, 1305
Cfr13I GGNCC 4 cut(s) 227, 493, 1054, 1324
ClaI ATCGAT 1 cut(s) 286
Csp6I GTAC 3 cut(s) 112, 209, 781
CspCI CAANNNNNGTGG 2 cut(s) 642, 677
CviAII CATG 6 cut(s) 124, 206, 372, 822, 936, 967
CviQI GTAC 3 cut(s) 112, 209, 781
DdeI CTNAG 3 cut(s) 930, 1013, 1202
DpnI GATC 7 cut(s) 204, 285, 474, 696, 744, 1068, 1157
DpnII GATC 7 cut(s) 202, 283, 472, 694, 742, 1066, 1155
DraI TTTAAA 1 cut(s) 388
DriI GACNNNNNGTC 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 458
Eam1105I GACNNNNNGTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 458
Eco32I GATATC 2 cut(s) 394, 829
Eco47I GGWCC 3 cut(s) 227, 1054, 1324
Eco57I CTGAAG 1 cut(s) 166
Eco88I CYCGRG 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 227
EcoRV GATATC 2 cut(s) 394, 829
FaeI CATG 6 cut(s) 127, 209, 375, 825, 939, 970
FalI AAGNNNNNCTT 4 cut(s) 849, 881, 1263, 1295
FaqI GGGAC 3 cut(s) 213, 365, 635
FatI CATG 6 cut(s) 123, 205, 371, 821, 935, 966
FbaI TGATCA 3 cut(s) 202, 694, 742
Fnu4HI GCNGC 4 cut(s) 457, 752, 1074, 1136
FokI GGATG 3 cut(s) 159, 677, 998
Fsp4HI GCNGC 4 cut(s) 457, 752, 1074, 1136
FspBI CTAG 4 cut(s) 137, 266, 273, 1178
GluI GCNGC 4 cut(s) 457, 752, 1074, 1136
HaeIII GGCC 1 cut(s) 494
HapII CCGG 1 cut(s) 983
Hin1II CATG 6 cut(s) 127, 209, 375, 825, 939, 970
HindIII AAGCTT 1 cut(s) 1262
HinfI GANTC 4 cut(s) 163, 647, 1091, 1295
HpaII CCGG 1 cut(s) 983
HphI GGTGA 3 cut(s) 290, 737, 1200
Hpy166II GTNNAC 3 cut(s) 26, 1054, 1208
Hpy188I TCNGA 2 cut(s) 121, 1014
Hpy188III TCNNGA 6 cut(s) 99, 158, 160, 306, 580, 983
Hpy8I GTNNAC 3 cut(s) 26, 1054, 1208
HpyAV CCTTC 5 cut(s) 190, 341, 444, 759, 1019
HpyCH4III ACNGT 4 cut(s) 1000, 1118, 1231, 1253
HpyCH4IV ACGT 1 cut(s) 624
HpyCH4V TGCA 6 cut(s) 525, 553, 590, 682, 1121, 1307
HpyF10VI GCNNNNNNNGC 5 cut(s) 456, 465, 808, 922, 931
HpyF3I CTNAG 3 cut(s) 930, 1013, 1202
HpySE526I ACGT 1 cut(s) 624
Hsp92II CATG 6 cut(s) 127, 209, 375, 825, 939, 970
Kpn2I TCCGGA 1 cut(s) 982
Ksp22I TGATCA 3 cut(s) 202, 694, 742
Kzo9I GATC 7 cut(s) 202, 283, 472, 694, 742, 1066, 1155
LguI GCTCTTC 1 cut(s) 458
LmnI GCTCC 3 cut(s) 603, 816, 930
Lsp1109I GCAGC 3 cut(s) 468, 738, 1060
LweI GCATC 2 cut(s) 577, 655
MaeI CTAG 4 cut(s) 137, 266, 273, 1178
MaeII ACGT 1 cut(s) 624
MaeIII GTNAC 2 cut(s) 37, 484
MalI GATC 7 cut(s) 204, 285, 474, 696, 744, 1068, 1157
MboI GATC 7 cut(s) 202, 283, 472, 694, 742, 1066, 1155
MboII GAAGA 2 cut(s) 475, 641
MflI RGATCY 1 cut(s) 1155
MluCI AATT 8 cut(s) 15, 340, 548, 706, 724, 949, 990, 1044
MlyI GAGTC 1 cut(s) 157
MmeI TCCRAC 1 cut(s) 200
MroI TCCGGA 1 cut(s) 982
MseI TTAA 5 cut(s) 69, 387, 636, 1260, 1287
MslI CAYNNNNRTG 1 cut(s) 776
MspA1I CMGCKG 1 cut(s) 751
MspCI CTTAAG 1 cut(s) 68
MspI CCGG 1 cut(s) 983
MwoI GCNNNNNNNGC 5 cut(s) 456, 465, 808, 922, 931
NdeII GATC 7 cut(s) 202, 283, 472, 694, 742, 1066, 1155
NheI GCTAGC 1 cut(s) 265
NlaIII CATG 6 cut(s) 127, 209, 375, 825, 939, 970
NlaIV GGNNCC 5 cut(s) 229, 796, 910, 1056, 1326
NspI RCATGY 1 cut(s) 127
NspV TTCGAA 2 cut(s) 345, 763
PaeR7I CTCGAG 1 cut(s) 158
PciSI GCTCTTC 1 cut(s) 458
PfeI GAWTC 3 cut(s) 647, 1091, 1295
PflMI CCANNNNNTGG 1 cut(s) 105
PkrI GCNGC 4 cut(s) 458, 753, 1075, 1137
PleI GAGTC 1 cut(s) 157
PpsI GAGTC 1 cut(s) 157
PpuMI RGGWCCY 1 cut(s) 227
Psp5II RGGWCCY 1 cut(s) 227
PspN4I GGNNCC 5 cut(s) 229, 796, 910, 1056, 1326
PspPI GGNCC 4 cut(s) 227, 493, 1054, 1324
PspPPI RGGWCCY 1 cut(s) 227
PsuI RGATCY 1 cut(s) 1155
PvuII CAGCTG 1 cut(s) 751
RsaI GTAC 3 cut(s) 113, 210, 782
RsaNI GTAC 3 cut(s) 112, 209, 781
RseI CAYNNNNRTG 1 cut(s) 776
SapI GCTCTTC 1 cut(s) 458
SaqAI TTAA 5 cut(s) 69, 387, 636, 1260, 1287
SatI GCNGC 4 cut(s) 457, 752, 1074, 1136
Sau3AI GATC 7 cut(s) 202, 283, 472, 694, 742, 1066, 1155
Sau96I GGNCC 4 cut(s) 227, 493, 1054, 1324
SchI GAGTC 1 cut(s) 157
SfaNI GCATC 2 cut(s) 577, 655
Sfr274I CTCGAG 1 cut(s) 158
SfuI TTCGAA 2 cut(s) 345, 763
SinI GGWCC 3 cut(s) 227, 1054, 1324
SlaI CTCGAG 1 cut(s) 158
SmiMI CAYNNNNRTG 1 cut(s) 776
SmlI CTYRAG 6 cut(s) 68, 158, 536, 578, 731, 1217
SmoI CTYRAG 6 cut(s) 68, 158, 536, 578, 731, 1217
Sse9I AATT 8 cut(s) 15, 340, 548, 706, 724, 949, 990, 1044
SsiI CCGC 1 cut(s) 1135
SspI AATATT 1 cut(s) 196
SspMI CTAG 4 cut(s) 137, 266, 273, 1178
TaaI ACNGT 4 cut(s) 1000, 1118, 1231, 1253
TaiI ACGT 1 cut(s) 627
TaqI TCGA 5 cut(s) 159, 243, 286, 345, 763
TasI AATT 8 cut(s) 15, 340, 548, 706, 724, 949, 990, 1044
TatI WGTACW 2 cut(s) 208, 780
TauI GCSGC 1 cut(s) 1138
TfiI GAWTC 3 cut(s) 647, 1091, 1295
Tru1I TTAA 5 cut(s) 69, 387, 636, 1260, 1287
Tru9I TTAA 5 cut(s) 69, 387, 636, 1260, 1287
TseI GCWGC 3 cut(s) 456, 751, 1073
TspDTI ATGAA 4 cut(s) 389, 983, 1002, 1174
Van91I CCANNNNNTGG 1 cut(s) 105
Vha464I CTTAAG 1 cut(s) 68
VpaK11BI GGWCC 3 cut(s) 227, 1054, 1324
XapI RAATTY 3 cut(s) 724, 990, 1044
XceI RCATGY 1 cut(s) 127
XhoI CTCGAG 1 cut(s) 158
XspI CTAG 4 cut(s) 137, 266, 273, 1178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.