Rmu_sc0001562.1_g000017

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001562.1
Physical Location & Seq
Forward (+)
87679 .. 89490
1812 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001562.1_g000017.1.cds

Sequence Viewer

Length: 1269 bp
atggagcaaacagaaccacccaagtcccgttcgaaagtggagatagagatggagttggacagaatcagcaacttaccaagtgatgttatagttaaaattctgtcatgtttgactcttaaggatgcagtgaggacaagtgttttttcgagcaggtggagggacaaatgggctaagctttcaggtcttgtatttgatgagaagtgtttctcaactgaaaactgtgcaagctttgtgaacattgtttatcatgtactcttaagtcacattgtcccagtagagaagtttgtgctttctcacacacatcttatacctactaaagatattgatcgatgggttcttcatctatcaagaaactctcttaaagttttcgaacttcatattccttattggcctaaatacaagatgcccatatgtttcttttcttatcaagatatgattgagctgaagttatttaactgcttgctgaaacctccaaccacattcaaaggcttcagaactttgaagagagttatttttcagtatgttaccttggcccaagatgtgttggaaaatatgattattcctctgctggagagtttggaagtgataaactgtgatggctttacacatctcaagattgatgcaccaaatcttcgattcctttcttttgttggtggcttgaaagatgttagtcttcagaataccttaaatcttgctgttgttcaattttatttgacagaactttatgacggacaagatcttgtcagttcttccaatttggcaaaatttttcattgacctgcctcatattcagtggctcaaaattgatggttttgctgtacagtatttggatgttggtgacttgcctggaaggctccccaaaccatgtccagaactaaattttctttctctcctcgtatactttaatgatcttgcggaaattttaactactctgtatcttctgagaagctcccctattctggaagtactacatgttacggttcaccatgaagaacaggtcattgctgttgatgaagaggcaaactcttggttggataacctagatgacgacacgaattggtcattccccaaactgcgacttgttcaattaaccgacttttctggttgcaaagctgaacaagatttcatcaaatttttgcttctaaattcacccgtgcttgagacgatgactattagggctttttctgccgatggtacttcagaagttttaaagaagttgctccagttaaggcgtacctcaagtgcagagatcatatacttggatccctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

422

Amino Acids

48.56

Weight (kDa)

5.52

Isoelectric Point (pI)

44.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000103)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g03461 FvH4_2g03490 FvH4_2g03500 FvH4_2g03500 FvH4_2g03510 FvH4_2g03510 FvH4_2g03521 FvH4_2g03521 FvH4_2g27100 FvH4_2g27110 FvH4_2g27130 FvH4_2g27150 FvH4_2g40420 FvH4_2g40420 FvH4_2g40420 FvH4_2g40420 FvH4_3g20160 FvH4_3g20160 FvH4_3g33042 FvH4_4g17790 FvH4_5g14272 FvH4_5g14273 FvH4_5g20540
malus_domestica MD00G1039500.v1.1 MD05G1103500.v1.1 MD05G1103900.v1.1 MD05G1104300.v1.1 MD05G1104400.v1.1 MD05G1104600.v1.1 MD05G1157200.v1.1 MD05G1157700.v1.1 MD05G1157800.v1.1 MD08G1037400.v1.1 MD10G1108900.v1.1
prunus_persica Prupe.1G384700_v2.0.a1 Prupe.1G384700_v2.0.a1 Prupe.8G148700_v2.0.a1 Prupe.8G148700_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G149000_v2.0.a1
pyrus_communis pycom05g10100 pycom05g14980 pycom08g02980 pycom10g09400 pycom15g02910
rosa_chinensis RchiOBHm_Chr3g0455511 RchiOBHm_Chr4g0421851 RchiOBHm_Chr4g0421921 RchiOBHm_Chr4g0421931 RchiOBHm_Chr5g0033951 RchiOBHm_Chr5g0033971 RchiOBHm_Chr6g0248641 RchiOBHm_Chr6g0248651 RchiOBHm_Chr6g0248671 RchiOBHm_Chr6g0248681 RchiOBHm_Chr6g0248731 RchiOBHm_Chr6g0248741 RchiOBHm_Chr6g0248771 RchiOBHm_Chr6g0248791 RchiOBHm_Chr6g0248851 RchiOBHm_Chr6g0248871 RchiOBHm_Chr6g0248881 RchiOBHm_Chr6g0248921 RchiOBHm_Chr6g0252081 RchiOBHm_Chr6g0252091 RchiOBHm_Chr6g0252101 RchiOBHm_Chr6g0267131 RchiOBHm_Chr6g0295981 RchiOBHm_Chr6g0295991 RchiOBHm_Chr6g0296021 RchiOBHm_Chr6g0300311 RchiOBHm_Chr7g0182631
rosa_laevigata RLG00000005114 RLG00000007652 RLG00000011348 RLG00000011741 RLG00000011742 RLG00000011743 RLG00000011744 RLG00000011745 RLG00000011747 RLG00000011748 RLG00000011749 RLG00000011750 RLG00000014028 RLG00000014036 RLG00000015111 RLG00000015113 RLG00000015115 RLG00000015117 RLG00000015119 RLG00000015123 RLG00000015124 RLG00000015127 RLG00000015128 RLG00000015129 RLG00000015132 RLG00000033513 RLG00000034608
rosa_multiflora Rmu_co8062356.1_g000001 Rmu_co8494777.1_g000001 Rmu_sc0000229.1_g000003 Rmu_sc0000529.1_g000001 Rmu_sc0000529.1_g000002 Rmu_sc0000529.1_g000003 Rmu_sc0001014.1_g000001 Rmu_sc0001150.1_g000007 Rmu_sc0001562.1_g000002 Rmu_sc0001562.1_g000004 Rmu_sc0001562.1_g000005 Rmu_sc0001562.1_g000017 Rmu_sc0001562.1_g000033 Rmu_sc0001562.1_g000035 Rmu_sc0001670.1_g000022 Rmu_sc0002393.1_g000007 Rmu_sc0002393.1_g000008 Rmu_sc0002393.1_g000009 Rmu_sc0002393.1_g000010 Rmu_sc0002393.1_g000011 Rmu_sc0002393.1_g000021 Rmu_sc0002393.1_g000023 Rmu_sc0002393.1_g000035 Rmu_sc0002393.1_g000037 Rmu_sc0002489.1_g000003 Rmu_sc0002938.1_g000047 Rmu_sc0003139.1_g000013 Rmu_sc0003139.1_g000014 Rmu_sc0003139.1_g000015 Rmu_sc0003139.1_g000017 Rmu_sc0004275.1_g000033 Rmu_sc0004275.1_g000036 Rmu_sc0004703.1_g000001 Rmu_sc0006276.1_g000003 Rmu_sc0010676.1_g000003 Rmu_sc0010676.1_g000004 Rmu_sc0010676.1_g000006 Rmu_sc0010676.1_g000007 Rmu_sc0013953.1_g000004 Rmu_ssc0000388.1_g000016
rosa_roxburghii Rroxscaffold_1G00015220 Rroxscaffold_1G00046270 Rroxscaffold_2G00090150 Rroxscaffold_2G00120650 Rroxscaffold_2G00123380 Rroxscaffold_3G00234080 Rroxscaffold_3G00271110 Rroxscaffold_7G00167900 Rroxscaffold_7G00171950 Rroxscaffold_7G00171970 Rroxscaffold_7G00171980 Rroxscaffold_7G00171990 Rroxscaffold_7G00172000 Rroxscaffold_7G00201050 Rroxscaffold_7G00212860 Rroxscaffold_7G00212880 Rroxscaffold_7G00212920 Rroxscaffold_7G00212940 Rroxscaffold_7G00212990 Rroxscaffold_7G00213060 Rroxscaffold_7G00213070 Rroxscaffold_7G00213080 Rroxscaffold_7G00213100 Rroxscaffold_7G00213110 Rroxscaffold_7G00213120 Rroxscaffold_7G00213130 Rroxscaffold_7G00213140 Rroxscaffold_7G00217950
rosa_rugosa Rorug04G0089100 Rorug04G0176100 Rorug05G0143700 Rorug05G0532600 Rorug05G0532700 Rorug05G0532800 Rorug05G0533100 Rorug05G0533200 Rorug05G0533300 Rorug05G0533400 Rorug05G0533500 Rorug05G0533500 Rorug05G0533700 Rorug05G0533800 Rorug05G0533900 Rorug05G0534000 Rorug05G0534100.1 Rorug05G0534200 Rorug06G0029200 Rorug06G0029300 Rorug06G0029400 Rorug06G0255600 Rorug06G0255800 Rorug06G0255800 Rorug06G0255900 Rorug06G0255900 Rorug06G0255900 Rorug06G0256000 Rorug06G0256100 Rorug06G0256300 Rorug06G0256400 Rorug06G0294900 Rorug06G0448600 Rorug06G0448600 Rorug07G0094000
rosa_samantha Rh3BG070200 Rh3CG325900 Rh5BG235500 Rh6AG049500 Rh6AG049600 Rh6AG049800 Rh6AG049900 Rh6AG050100 Rh6AG050200 Rh6AG050300 Rh6AG050400 Rh6AG050500 Rh6AG050800 Rh6AG051100 Rh6AG051500 Rh6AG151100 Rh6AG369300 Rh6AG369500 Rh6AG369600 Rh6AG369800 Rh6AG369900 Rh6AG407600 Rh6DG038100 Rh7CG053500 Rh7CG053600 Rh7DG051800
rosa_wichuraiana Rw3G005370 Rw3G025850 Rw5G021490 Rw6G004290 Rw6G004300 Rw6G004310 Rw6G004320 Rw6G004330 Rw6G004340 Rw6G004390 Rw6G004410 Rw6G004420 Rw6G004430 Rw6G004450 Rw6G004460 Rw6G004490 Rw6G004510 Rw6G004590 Rw6G013080 Rw6G032210 Rw6G032220 Rw6G032230 Rw6G032250 Rw6G035640 Rw7G004270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 141
Acc36I ACCTGC 2 cut(s) 141, 786
AccI GTMKAC 1 cut(s) 897
AciI CCGC 1 cut(s) 914
AclWI GGATC 1 cut(s) 1256
AcsI RAATTY 6 cut(s) 96, 764, 877, 918, 1130, 1144
AcuI CTGAAG 4 cut(s) 464, 475, 659, 1182
AfaI GTAC 5 cut(s) 252, 819, 966, 1195, 1234
AfiI CCNNNNNNNGG 1 cut(s) 958
AflII CTTAAG 2 cut(s) 116, 256
AflIII ACRYGT 1 cut(s) 970
AgsI TTSAA 5 cut(s) 484, 502, 661, 704, 1085
AjnI CCWGG 1 cut(s) 844
AluBI AGCT 5 cut(s) 175, 228, 442, 948, 1112
AluI AGCT 5 cut(s) 175, 228, 442, 948, 1112
Alw26I GTCTC 1 cut(s) 1154
AlwI GGATC 1 cut(s) 1256
AoxI GGCC 2 cut(s) 389, 531
ApoI RAATTY 6 cut(s) 96, 764, 877, 918, 1130, 1144
Asp700I GAANNNNTTC 1 cut(s) 203
AspS9I GGNCC 1 cut(s) 532
AsuHPI GGTGA 3 cut(s) 848, 974, 1140
AsuII TTCGAA 2 cut(s) 32, 369
BamHI GGATCC 1 cut(s) 1261
BbsI GAAGAC 1 cut(s) 665
BccI CCATC 5 cut(s) 43, 324, 590, 800, 1184
BciT130I CCWGG 1 cut(s) 846
BcoDI GTCTC 1 cut(s) 1154
BfaI CTAG 1 cut(s) 1040
BfrI CTTAAG 2 cut(s) 116, 256
BfuAI ACCTGC 2 cut(s) 141, 786
BglI GCCNNNNNGGC 1 cut(s) 850
BglII AGATCT 1 cut(s) 736
BlpI GCTNAGC 1 cut(s) 171
BmcAI AGTACT 1 cut(s) 966
Bme1390I CCNGG 1 cut(s) 846
BmgT120I GGNCC 1 cut(s) 532
BmiI GGNNCC 2 cut(s) 854, 1263
BmrFI CCNGG 1 cut(s) 846
BmrI ACTGGG 1 cut(s) 266
BmsI GCATC 3 cut(s) 112, 393, 610
BmuI ACTGGG 1 cut(s) 266
BpiI GAAGAC 1 cut(s) 665
BplI GAGNNNNNCTC 2 cut(s) 1007, 1039
BpmI CTGGAG 2 cut(s) 590, 1205
Bpu1102I GCTNAGC 1 cut(s) 171
Bpu14I TTCGAA 2 cut(s) 32, 369
BpuEI CTTGAG 3 cut(s) 596, 1178, 1222
Bsa29I ATCGAT 1 cut(s) 328
BsaBI GATNNNNATC 1 cut(s) 324
BsaJI CCNNGG 1 cut(s) 528
Bsc4I CCNNNNNNNGG 1 cut(s) 958
Bse1I ACTGG 2 cut(s) 272, 1222
Bse3DI GCAATG 1 cut(s) 999
Bse8I GATNNNNATC 1 cut(s) 324
BseBI CCWGG 1 cut(s) 846
BseCI ATCGAT 1 cut(s) 328
BseDI CCNNGG 1 cut(s) 528
BseGI GGATG 2 cut(s) 127, 835
BseJI GATNNNNATC 1 cut(s) 324
BseLI CCNNNNNNNGG 1 cut(s) 958
BseMI GCAATG 1 cut(s) 999
BseMII CTCAG 1 cut(s) 932
BseNI ACTGG 2 cut(s) 272, 1222
BseRI GAGGAG 1 cut(s) 881
BsgI GTGCAG 1 cut(s) 1263
BshFI GGCC 2 cut(s) 391, 533
BshVI ATCGAT 1 cut(s) 328
BslFI GGGAC 3 cut(s) 10, 173, 254
BslI CCNNNNNNNGG 1 cut(s) 958
BsmAI GTCTC 1 cut(s) 1154
BsmBI CGTCTC 1 cut(s) 1154
BsmFI GGGAC 3 cut(s) 10, 173, 254
BsnI GGCC 2 cut(s) 391, 533
Bsp119I TTCGAA 2 cut(s) 32, 369
Bsp1407I TGTACA 1 cut(s) 817
Bsp143I GATC 5 cut(s) 325, 736, 907, 1248, 1261
Bsp1720I GCTNAGC 1 cut(s) 171
BspACI CCGC 1 cut(s) 914
BspANI GGCC 2 cut(s) 391, 533
BspCNI CTCAG 1 cut(s) 933
BspDI ATCGAT 1 cut(s) 328
BspLI GGNNCC 2 cut(s) 854, 1263
BspMI ACCTGC 2 cut(s) 141, 786
BspPI GGATC 1 cut(s) 1256
BspT104I TTCGAA 2 cut(s) 32, 369
BspTI CTTAAG 2 cut(s) 116, 256
BsrDI GCAATG 1 cut(s) 999
BsrGI TGTACA 1 cut(s) 817
BsrI ACTGG 2 cut(s) 272, 1222
BssECI CCNNGG 1 cut(s) 528
BssMI GATC 5 cut(s) 325, 736, 907, 1248, 1261
BssNAI GTATAC 1 cut(s) 898
BssT1I CCWWGG 1 cut(s) 528
Bst1107I GTATAC 1 cut(s) 898
Bst2UI CCWGG 1 cut(s) 846
Bst4CI ACNGT 4 cut(s) 221, 593, 822, 979
Bst6I CTCTTC 2 cut(s) 497, 1008
BstAFI CTTAAG 2 cut(s) 116, 256
BstAUI TGTACA 1 cut(s) 817
BstBI TTCGAA 2 cut(s) 32, 369
BstC8I GCNNGC 2 cut(s) 226, 461
BstDEI CTNAG 2 cut(s) 171, 941
BstF5I GGATG 2 cut(s) 127, 835
BstKTI GATC 5 cut(s) 328, 739, 910, 1251, 1264
BstMAI GTCTC 1 cut(s) 1154
BstMBI GATC 5 cut(s) 325, 736, 907, 1248, 1261
BstMWI GCNNNNNNNGC 2 cut(s) 850, 1184
BstNI CCWGG 1 cut(s) 846
BstNSI RCATGY 1 cut(s) 974
BstSCI CCNGG 1 cut(s) 844
BstV2I GAAGAC 1 cut(s) 665
BstX2I RGATCY 2 cut(s) 736, 1261
BstYI RGATCY 2 cut(s) 736, 1261
BstZ17I GTATAC 1 cut(s) 898
Bsu15I ATCGAT 1 cut(s) 328
BsuRI GGCC 2 cut(s) 391, 533
BsuTUI ATCGAT 1 cut(s) 328
BtsCI GGATG 2 cut(s) 127, 835
BtsI GCAGTG 1 cut(s) 132
BtsIMutI CAGTG 2 cut(s) 132, 797
BveI ACCTGC 2 cut(s) 141, 786
Cac8I GCNNGC 2 cut(s) 226, 461
Cfr13I GGNCC 1 cut(s) 532
ClaI ATCGAT 1 cut(s) 328
Csp6I GTAC 5 cut(s) 251, 818, 965, 1194, 1233
CviAII CATG 5 cut(s) 105, 248, 864, 971, 986
CviQI GTAC 5 cut(s) 251, 818, 965, 1194, 1233
DdeI CTNAG 2 cut(s) 171, 941
DpnI GATC 5 cut(s) 327, 738, 909, 1250, 1263
DpnII GATC 5 cut(s) 325, 736, 907, 1248, 1261
DraI TTTAAA 1 cut(s) 1209
Eam1104I CTCTTC 2 cut(s) 497, 1008
EarI CTCTTC 2 cut(s) 497, 1008
Eco130I CCWWGG 1 cut(s) 528
Eco57I CTGAAG 4 cut(s) 464, 475, 659, 1182
EcoRII CCWGG 1 cut(s) 844
EcoT14I CCWWGG 1 cut(s) 528
ErhI CCWWGG 1 cut(s) 528
Esp3I CGTCTC 1 cut(s) 1154
FaeI CATG 5 cut(s) 108, 251, 867, 974, 989
FaqI GGGAC 3 cut(s) 10, 173, 254
FatI CATG 5 cut(s) 104, 247, 863, 970, 985
FauNDI CATATG 1 cut(s) 410
FblI GTMKAC 1 cut(s) 897
FokI GGATG 2 cut(s) 134, 842
FspBI CTAG 1 cut(s) 1040
GsuI CTGGAG 2 cut(s) 590, 1205
HaeIII GGCC 2 cut(s) 391, 533
Hin1II CATG 5 cut(s) 108, 251, 867, 974, 989
HindIII AAGCTT 2 cut(s) 173, 226
HinfI GANTC 3 cut(s) 63, 112, 636
HphI GGTGA 3 cut(s) 848, 974, 1140
Hpy166II GTNNAC 3 cut(s) 235, 898, 982
Hpy188I TCNGA 4 cut(s) 494, 678, 942, 1201
Hpy188III TCNNGA 5 cut(s) 348, 428, 613, 869, 959
Hpy8I GTNNAC 3 cut(s) 235, 898, 982
HpyAV CCTTC 1 cut(s) 843
HpyCH4III ACNGT 4 cut(s) 221, 593, 822, 979
HpyCH4V TGCA 5 cut(s) 125, 224, 623, 1107, 1244
HpyF10VI GCNNNNNNNGC 2 cut(s) 850, 1184
HpyF3I CTNAG 2 cut(s) 171, 941
Hsp92II CATG 5 cut(s) 108, 251, 867, 974, 989
Kzo9I GATC 5 cut(s) 325, 736, 907, 1248, 1261
LmnI GCTCC 4 cut(s) 4, 858, 953, 1224
LweI GCATC 3 cut(s) 112, 393, 610
MaeI CTAG 1 cut(s) 1040
MaeIII GTNAC 4 cut(s) 260, 523, 836, 973
MalI GATC 5 cut(s) 327, 738, 909, 1250, 1263
MboI GATC 5 cut(s) 325, 736, 907, 1248, 1261
MboII GAAGA 8 cut(s) 329, 514, 623, 665, 741, 929, 1001, 1025
MflI RGATCY 2 cut(s) 736, 1261
MlyI GAGTC 1 cut(s) 106
MmeI TCCRAC 4 cut(s) 36, 497, 525, 1011
MnlI CCTC 8 cut(s) 123, 150, 480, 573, 792, 902, 1009, 1246
MroXI GAANNNNTTC 1 cut(s) 203
MspCI CTTAAG 2 cut(s) 116, 256
MspR9I CCNGG 1 cut(s) 846
MvaI CCWGG 1 cut(s) 846
MwoI GCNNNNNNNGC 2 cut(s) 850, 1184
NdeI CATATG 1 cut(s) 410
NdeII GATC 5 cut(s) 325, 736, 907, 1248, 1261
NlaIII CATG 5 cut(s) 108, 251, 867, 974, 989
NlaIV GGNNCC 2 cut(s) 854, 1263
NmuCI GTSAC 2 cut(s) 260, 836
NspI RCATGY 1 cut(s) 974
NspV TTCGAA 2 cut(s) 32, 369
PaqCI CACCTGC 1 cut(s) 141
PciI ACATGT 1 cut(s) 970
PdmI GAANNNNTTC 1 cut(s) 203
PfeI GAWTC 2 cut(s) 63, 636
PleI GAGTC 1 cut(s) 106
PpsI GAGTC 1 cut(s) 106
PscI ACATGT 1 cut(s) 970
Psp6I CCWGG 1 cut(s) 844
PspGI CCWGG 1 cut(s) 844
PspN4I GGNNCC 2 cut(s) 854, 1263
PspPI GGNCC 1 cut(s) 532
PsuI RGATCY 2 cut(s) 736, 1261
RsaI GTAC 5 cut(s) 252, 819, 966, 1195, 1234
RsaNI GTAC 5 cut(s) 251, 818, 965, 1194, 1233
Sau3AI GATC 5 cut(s) 325, 736, 907, 1248, 1261
Sau96I GGNCC 1 cut(s) 532
ScaI AGTACT 1 cut(s) 966
SchI GAGTC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 846
SfaNI GCATC 3 cut(s) 112, 393, 610
SfuI TTCGAA 2 cut(s) 32, 369
SmlI CTYRAG 5 cut(s) 116, 256, 611, 1157, 1237
SmoI CTYRAG 5 cut(s) 116, 256, 611, 1157, 1237
SsiI CCGC 1 cut(s) 914
SspMI CTAG 1 cut(s) 1040
StyD4I CCNGG 1 cut(s) 844
StyI CCWWGG 1 cut(s) 528
TaaI ACNGT 4 cut(s) 221, 593, 822, 979
TaqI TCGA 5 cut(s) 32, 146, 328, 369, 634
TatI WGTACW 3 cut(s) 250, 817, 964
TfiI GAWTC 2 cut(s) 63, 636
TscAI CASTG 2 cut(s) 132, 797
TseFI GTSAC 2 cut(s) 260, 836
Tsp45I GTSAC 2 cut(s) 260, 836
TspDTI ATGAA 6 cut(s) 329, 365, 760, 1002, 1026, 1114
TspGWI ACGGA 1 cut(s) 744
TspRI CASTG 2 cut(s) 132, 797
Vha464I CTTAAG 2 cut(s) 116, 256
XapI RAATTY 6 cut(s) 96, 764, 877, 918, 1130, 1144
XceI RCATGY 1 cut(s) 974
XmiI GTMKAC 1 cut(s) 897
XmnI GAANNNNTTC 1 cut(s) 203
XspI CTAG 1 cut(s) 1040
ZrmI AGTACT 1 cut(s) 966
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.