Rmu_sc0002393.1_g000008

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002393.1
Physical Location & Seq
Reverse (-)
35875 .. 37335
1461 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002393.1_g000008.1.cds

Sequence Viewer

Length: 1233 bp
atggagttggatagaattagcagtttaccaaatgatgttacagaaaagattttgtcaggtttgccacttaaggaggcagtaaggacaagtattttatccagaaaatggaggcacaaatcggatatgcttcaagaccttgtgtttactagtaactttgacttgactgaaagtcatccaacctacagctttgcgaatattgttgatcatgtactcttactccataaaggtcccatacgcaagttccagctttctttcattggtaagctagccactagggatatagatcgatggatttttcacctatccagaaaccctgtcatcaaacagatgatacttgacaatttcaaaggggacatctacaacattccatcttgtttgttttcttttaaagatatcgttcatttagagttattcaggtgtttgctaaaccctccttccacattcaaaggctttggcagcttgaagagccttgatctttgctctgttactttggcccaagatgtgtttgacaacttgattggttgcagtcctctgcttgagatattgaaattggaagaatgtgatggtttcaccaatctcaagattgatgcaccgaagctctggtttatttacatagtaggggactttgaagattttaacctcgtggattcttcaaatcttgtggatgctttctttgatttgcaggtcattgttgatcaaagagggaattgtagtagttttgggaatttgctcaagttttttgatcaccagctgcctcatattcgaaggctcacaataacgaggaactttctaaaatacttgtctattggtgccttgccagagaagctccctaaaccatgccaatatctcaattttctttctttagacatgaactttgacaatccggatgaaatttcaactgtcttatgtcttctgagaagctgtcctgctctacaagaactgaaaattttggtggaccctgaaaaggatcacgctgctgtgggagaagtggaatcttgtttatatgacaactacaactgtgcatacactcaactgcggcttgtgaaaataaccaagatctctggtgtaaaagctcaactagatttcatcgaatctctgcttctaagttcacctgttcttgagagaatgactgttcaacctgcttctgtcgatggttttttgaagctagtaaaagatttacttctgtttaagcgtgattcaaagcgtgcagagataatggttttggacccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

410

Amino Acids

46.8

Weight (kDa)

5.89

Isoelectric Point (pI)

40.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000103)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g03461 FvH4_2g03490 FvH4_2g03500 FvH4_2g03500 FvH4_2g03510 FvH4_2g03510 FvH4_2g03521 FvH4_2g03521 FvH4_2g27100 FvH4_2g27110 FvH4_2g27130 FvH4_2g27150 FvH4_2g40420 FvH4_2g40420 FvH4_2g40420 FvH4_2g40420 FvH4_3g20160 FvH4_3g20160 FvH4_3g33042 FvH4_4g17790 FvH4_5g14272 FvH4_5g14273 FvH4_5g20540
malus_domestica MD00G1039500.v1.1 MD05G1103500.v1.1 MD05G1103900.v1.1 MD05G1104300.v1.1 MD05G1104400.v1.1 MD05G1104600.v1.1 MD05G1157200.v1.1 MD05G1157700.v1.1 MD05G1157800.v1.1 MD08G1037400.v1.1 MD10G1108900.v1.1
prunus_persica Prupe.1G384700_v2.0.a1 Prupe.1G384700_v2.0.a1 Prupe.8G148700_v2.0.a1 Prupe.8G148700_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G149000_v2.0.a1
pyrus_communis pycom05g10100 pycom05g14980 pycom08g02980 pycom10g09400 pycom15g02910
rosa_chinensis RchiOBHm_Chr3g0455511 RchiOBHm_Chr4g0421851 RchiOBHm_Chr4g0421921 RchiOBHm_Chr4g0421931 RchiOBHm_Chr5g0033951 RchiOBHm_Chr5g0033971 RchiOBHm_Chr6g0248641 RchiOBHm_Chr6g0248651 RchiOBHm_Chr6g0248671 RchiOBHm_Chr6g0248681 RchiOBHm_Chr6g0248731 RchiOBHm_Chr6g0248741 RchiOBHm_Chr6g0248771 RchiOBHm_Chr6g0248791 RchiOBHm_Chr6g0248851 RchiOBHm_Chr6g0248871 RchiOBHm_Chr6g0248881 RchiOBHm_Chr6g0248921 RchiOBHm_Chr6g0252081 RchiOBHm_Chr6g0252091 RchiOBHm_Chr6g0252101 RchiOBHm_Chr6g0267131 RchiOBHm_Chr6g0295981 RchiOBHm_Chr6g0295991 RchiOBHm_Chr6g0296021 RchiOBHm_Chr6g0300311 RchiOBHm_Chr7g0182631
rosa_laevigata RLG00000005114 RLG00000007652 RLG00000011348 RLG00000011741 RLG00000011742 RLG00000011743 RLG00000011744 RLG00000011745 RLG00000011747 RLG00000011748 RLG00000011749 RLG00000011750 RLG00000014028 RLG00000014036 RLG00000015111 RLG00000015113 RLG00000015115 RLG00000015117 RLG00000015119 RLG00000015123 RLG00000015124 RLG00000015127 RLG00000015128 RLG00000015129 RLG00000015132 RLG00000033513 RLG00000034608
rosa_multiflora Rmu_co8062356.1_g000001 Rmu_co8494777.1_g000001 Rmu_sc0000229.1_g000003 Rmu_sc0000529.1_g000001 Rmu_sc0000529.1_g000002 Rmu_sc0000529.1_g000003 Rmu_sc0001014.1_g000001 Rmu_sc0001150.1_g000007 Rmu_sc0001562.1_g000002 Rmu_sc0001562.1_g000004 Rmu_sc0001562.1_g000005 Rmu_sc0001562.1_g000017 Rmu_sc0001562.1_g000033 Rmu_sc0001562.1_g000035 Rmu_sc0001670.1_g000022 Rmu_sc0002393.1_g000007 Rmu_sc0002393.1_g000008 Rmu_sc0002393.1_g000009 Rmu_sc0002393.1_g000010 Rmu_sc0002393.1_g000011 Rmu_sc0002393.1_g000021 Rmu_sc0002393.1_g000023 Rmu_sc0002393.1_g000035 Rmu_sc0002393.1_g000037 Rmu_sc0002489.1_g000003 Rmu_sc0002938.1_g000047 Rmu_sc0003139.1_g000013 Rmu_sc0003139.1_g000014 Rmu_sc0003139.1_g000015 Rmu_sc0003139.1_g000017 Rmu_sc0004275.1_g000033 Rmu_sc0004275.1_g000036 Rmu_sc0004703.1_g000001 Rmu_sc0006276.1_g000003 Rmu_sc0010676.1_g000003 Rmu_sc0010676.1_g000004 Rmu_sc0010676.1_g000006 Rmu_sc0010676.1_g000007 Rmu_sc0013953.1_g000004 Rmu_ssc0000388.1_g000016
rosa_roxburghii Rroxscaffold_1G00015220 Rroxscaffold_1G00046270 Rroxscaffold_2G00090150 Rroxscaffold_2G00120650 Rroxscaffold_2G00123380 Rroxscaffold_3G00234080 Rroxscaffold_3G00271110 Rroxscaffold_7G00167900 Rroxscaffold_7G00171950 Rroxscaffold_7G00171970 Rroxscaffold_7G00171980 Rroxscaffold_7G00171990 Rroxscaffold_7G00172000 Rroxscaffold_7G00201050 Rroxscaffold_7G00212860 Rroxscaffold_7G00212880 Rroxscaffold_7G00212920 Rroxscaffold_7G00212940 Rroxscaffold_7G00212990 Rroxscaffold_7G00213060 Rroxscaffold_7G00213070 Rroxscaffold_7G00213080 Rroxscaffold_7G00213100 Rroxscaffold_7G00213110 Rroxscaffold_7G00213120 Rroxscaffold_7G00213130 Rroxscaffold_7G00213140 Rroxscaffold_7G00217950
rosa_rugosa Rorug04G0089100 Rorug04G0176100 Rorug05G0143700 Rorug05G0532600 Rorug05G0532700 Rorug05G0532800 Rorug05G0533100 Rorug05G0533200 Rorug05G0533300 Rorug05G0533400 Rorug05G0533500 Rorug05G0533500 Rorug05G0533700 Rorug05G0533800 Rorug05G0533900 Rorug05G0534000 Rorug05G0534100.1 Rorug05G0534200 Rorug06G0029200 Rorug06G0029300 Rorug06G0029400 Rorug06G0255600 Rorug06G0255800 Rorug06G0255800 Rorug06G0255900 Rorug06G0255900 Rorug06G0255900 Rorug06G0256000 Rorug06G0256100 Rorug06G0256300 Rorug06G0256400 Rorug06G0294900 Rorug06G0448600 Rorug06G0448600 Rorug07G0094000
rosa_samantha Rh3BG070200 Rh3CG325900 Rh5BG235500 Rh6AG049500 Rh6AG049600 Rh6AG049800 Rh6AG049900 Rh6AG050100 Rh6AG050200 Rh6AG050300 Rh6AG050400 Rh6AG050500 Rh6AG050800 Rh6AG051100 Rh6AG051500 Rh6AG151100 Rh6AG369300 Rh6AG369500 Rh6AG369600 Rh6AG369800 Rh6AG369900 Rh6AG407600 Rh6DG038100 Rh7CG053500 Rh7CG053600 Rh7DG051800
rosa_wichuraiana Rw3G005370 Rw3G025850 Rw5G021490 Rw6G004290 Rw6G004300 Rw6G004310 Rw6G004320 Rw6G004330 Rw6G004340 Rw6G004390 Rw6G004410 Rw6G004420 Rw6G004430 Rw6G004450 Rw6G004460 Rw6G004490 Rw6G004510 Rw6G004590 Rw6G013080 Rw6G032210 Rw6G032220 Rw6G032230 Rw6G032250 Rw6G035640 Rw7G004270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 673, 1147
AccB1I GGYRCC 1 cut(s) 809
AccB7I CCANNNNNTGG 1 cut(s) 105
AccIII TCCGGA 1 cut(s) 883
AciI CCGC 1 cut(s) 1036
AclWI GGATC 1 cut(s) 975
AcsI RAATTY 3 cut(s) 724, 891, 945
AfaI GTAC 1 cut(s) 210
AfiI CCNNNNNNNGG 2 cut(s) 105, 964
AflII CTTAAG 1 cut(s) 68
AhdI GACNNNNNGTC 1 cut(s) 168
AhlI ACTAGT 1 cut(s) 146
AlwI GGATC 1 cut(s) 975
Aor13HI TCCGGA 1 cut(s) 883
AoxI GGCC 1 cut(s) 492
ApeKI GCWGC 3 cut(s) 456, 751, 974
ApoI RAATTY 3 cut(s) 724, 891, 945
ArsI GACNNNNNNTTYG 2 cut(s) 857, 889
AspS9I GGNCC 4 cut(s) 227, 493, 955, 1225
AsuHPI GGTGA 4 cut(s) 290, 562, 737, 1101
AsuII TTCGAA 1 cut(s) 763
AsuNHI GCTAGC 1 cut(s) 265
AvaII GGWCC 3 cut(s) 227, 955, 1225
BanI GGYRCC 1 cut(s) 809
BauI CACGAG 1 cut(s) 641
BbsI GAAGAC 1 cut(s) 902
BbvI GCAGC 3 cut(s) 468, 738, 961
BccI CCATC 4 cut(s) 282, 376, 557, 1145
BclI TGATCA 3 cut(s) 202, 694, 742
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 5 cut(s) 147, 266, 273, 1079, 1166
BfmI CTRYAG 1 cut(s) 181
BfrI CTTAAG 1 cut(s) 68
BfuAI ACCTGC 2 cut(s) 673, 1147
BglII AGATCT 1 cut(s) 1056
BisI GCNGC 4 cut(s) 457, 752, 975, 1037
BlsI GCNGC 4 cut(s) 458, 753, 976, 1038
Bme18I GGWCC 3 cut(s) 227, 955, 1225
BmeRI GACNNNNNGTC 1 cut(s) 168
BmgT120I GGNCC 4 cut(s) 227, 493, 955, 1225
BmiI GGNNCC 4 cut(s) 229, 811, 957, 1227
BmsI GCATC 2 cut(s) 577, 655
BmtI GCTAGC 1 cut(s) 269
BpiI GAAGAC 1 cut(s) 902
Bpu14I TTCGAA 1 cut(s) 763
BpuEI CTTGAG 4 cut(s) 557, 563, 716, 1139
Bsa29I ATCGAT 1 cut(s) 286
BsaBI GATNNNNATC 1 cut(s) 282
BsaWI WCCGGW 1 cut(s) 883
BsaXI ACNNNNNCTCC 2 cut(s) 201, 231
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 964
Bse8I GATNNNNATC 1 cut(s) 282
BseAI TCCGGA 1 cut(s) 883
BseCI ATCGAT 1 cut(s) 286
BseGI GGATG 3 cut(s) 172, 670, 892
BseJI GATNNNNATC 1 cut(s) 282
BseLI CCNNNNNNNGG 2 cut(s) 105, 964
BseMII CTCAG 1 cut(s) 905
BseXI GCAGC 3 cut(s) 468, 738, 961
BsgI GTGCAG 1 cut(s) 1227
BshFI GGCC 1 cut(s) 494
BshNI GGYRCC 1 cut(s) 809
BshVI ATCGAT 1 cut(s) 286
BsiSI CCGG 1 cut(s) 884
BslFI GGGAC 3 cut(s) 213, 365, 635
BslI CCNNNNNNNGG 2 cut(s) 105, 964
BsmFI GGGAC 3 cut(s) 213, 365, 635
BsnI GGCC 1 cut(s) 494
Bsp119I TTCGAA 1 cut(s) 763
Bsp13I TCCGGA 1 cut(s) 883
Bsp143I GATC 7 cut(s) 202, 283, 472, 694, 742, 967, 1056
BspACI CCGC 1 cut(s) 1036
BspANI GGCC 1 cut(s) 494
BspCNI CTCAG 1 cut(s) 906
BspDI ATCGAT 1 cut(s) 286
BspEI TCCGGA 1 cut(s) 883
BspLI GGNNCC 4 cut(s) 229, 811, 957, 1227
BspMI ACCTGC 2 cut(s) 673, 1147
BspOI GCTAGC 1 cut(s) 269
BspPI GGATC 1 cut(s) 975
BspQI GCTCTTC 1 cut(s) 458
BspT104I TTCGAA 1 cut(s) 763
BspT107I GGYRCC 1 cut(s) 809
BspTI CTTAAG 1 cut(s) 68
BssMI GATC 7 cut(s) 202, 283, 472, 694, 742, 967, 1056
BssSI CACGAG 1 cut(s) 641
Bst2BI CACGAG 1 cut(s) 641
Bst4CI ACNGT 3 cut(s) 901, 1019, 1132
Bst6I CTCTTC 1 cut(s) 458
BstAFI CTTAAG 1 cut(s) 68
BstBI TTCGAA 1 cut(s) 763
BstC8I GCNNGC 2 cut(s) 267, 1206
BstDEI CTNAG 2 cut(s) 914, 1103
BstF5I GGATG 3 cut(s) 172, 670, 892
BstKTI GATC 7 cut(s) 205, 286, 475, 697, 745, 970, 1059
BstMBI GATC 7 cut(s) 202, 283, 472, 694, 742, 967, 1056
BstMWI GCNNNNNNNGC 3 cut(s) 456, 465, 823
BstSFI CTRYAG 1 cut(s) 181
BstV1I GCAGC 3 cut(s) 468, 738, 961
BstV2I GAAGAC 1 cut(s) 902
BstX2I RGATCY 1 cut(s) 1056
BstYI RGATCY 1 cut(s) 1056
Bsu15I ATCGAT 1 cut(s) 286
BsuRI GGCC 1 cut(s) 494
BsuTUI ATCGAT 1 cut(s) 286
BtsCI GGATG 3 cut(s) 172, 670, 892
BveI ACCTGC 2 cut(s) 673, 1147
Cac8I GCNNGC 2 cut(s) 267, 1206
Cfr13I GGNCC 4 cut(s) 227, 493, 955, 1225
ClaI ATCGAT 1 cut(s) 286
Csp6I GTAC 1 cut(s) 209
CspCI CAANNNNNGTGG 2 cut(s) 642, 677
CviAII CATG 3 cut(s) 206, 837, 868
CviQI GTAC 1 cut(s) 209
DdeI CTNAG 2 cut(s) 914, 1103
DpnI GATC 7 cut(s) 204, 285, 474, 696, 744, 969, 1058
DpnII GATC 7 cut(s) 202, 283, 472, 694, 742, 967, 1056
DraI TTTAAA 1 cut(s) 388
DriI GACNNNNNGTC 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 458
Eam1105I GACNNNNNGTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 458
Eco32I GATATC 1 cut(s) 394
Eco47I GGWCC 3 cut(s) 227, 955, 1225
EcoO109I RGGNCCY 1 cut(s) 227
EcoRV GATATC 1 cut(s) 394
FaeI CATG 3 cut(s) 209, 840, 871
FalI AAGNNNNNCTT 2 cut(s) 1164, 1196
FaqI GGGAC 3 cut(s) 213, 365, 635
FatI CATG 3 cut(s) 205, 836, 867
FbaI TGATCA 3 cut(s) 202, 694, 742
Fnu4HI GCNGC 4 cut(s) 457, 752, 975, 1037
FokI GGATG 3 cut(s) 159, 677, 899
Fsp4HI GCNGC 4 cut(s) 457, 752, 975, 1037
FspBI CTAG 5 cut(s) 147, 266, 273, 1079, 1166
GluI GCNGC 4 cut(s) 457, 752, 975, 1037
HaeIII GGCC 1 cut(s) 494
HapII CCGG 1 cut(s) 884
Hin1II CATG 3 cut(s) 209, 840, 871
HinfI GANTC 4 cut(s) 647, 992, 1091, 1196
HpaII CCGG 1 cut(s) 884
HphI GGTGA 4 cut(s) 290, 562, 737, 1101
Hpy166II GTNNAC 4 cut(s) 26, 144, 955, 1109
Hpy188I TCNGA 2 cut(s) 121, 915
Hpy188III TCNNGA 6 cut(s) 99, 131, 306, 580, 884, 1118
Hpy8I GTNNAC 4 cut(s) 26, 144, 955, 1109
HpyAV CCTTC 2 cut(s) 444, 759
HpyCH4III ACNGT 3 cut(s) 901, 1019, 1132
HpyCH4V TGCA 5 cut(s) 525, 590, 682, 1022, 1208
HpyF10VI GCNNNNNNNGC 3 cut(s) 456, 465, 823
HpyF3I CTNAG 2 cut(s) 914, 1103
Hsp92II CATG 3 cut(s) 209, 840, 871
Kpn2I TCCGGA 1 cut(s) 883
Ksp22I TGATCA 3 cut(s) 202, 694, 742
Kzo9I GATC 7 cut(s) 202, 283, 472, 694, 742, 967, 1056
LguI GCTCTTC 1 cut(s) 458
LmnI GCTCC 1 cut(s) 831
Lsp1109I GCAGC 3 cut(s) 468, 738, 961
LweI GCATC 2 cut(s) 577, 655
MaeI CTAG 5 cut(s) 147, 266, 273, 1079, 1166
MaeIII GTNAC 3 cut(s) 37, 149, 484
MalI GATC 7 cut(s) 204, 285, 474, 696, 744, 969, 1058
MboI GATC 7 cut(s) 202, 283, 472, 694, 742, 967, 1056
MboII GAAGA 5 cut(s) 475, 566, 641, 642, 902
MflI RGATCY 1 cut(s) 1056
MluCI AATT 8 cut(s) 15, 340, 548, 706, 724, 850, 891, 945
MmeI TCCRAC 1 cut(s) 200
MnlI CCTC 8 cut(s) 67, 102, 441, 540, 650, 695, 765, 774
MroI TCCGGA 1 cut(s) 883
MseI TTAA 4 cut(s) 69, 387, 636, 1188
MspA1I CMGCKG 1 cut(s) 751
MspCI CTTAAG 1 cut(s) 68
MspI CCGG 1 cut(s) 884
MwoI GCNNNNNNNGC 3 cut(s) 456, 465, 823
NdeII GATC 7 cut(s) 202, 283, 472, 694, 742, 967, 1056
NheI GCTAGC 1 cut(s) 265
NlaIII CATG 3 cut(s) 209, 840, 871
NlaIV GGNNCC 4 cut(s) 229, 811, 957, 1227
NspV TTCGAA 1 cut(s) 763
PciSI GCTCTTC 1 cut(s) 458
PfeI GAWTC 4 cut(s) 647, 992, 1091, 1196
PflMI CCANNNNNTGG 1 cut(s) 105
PkrI GCNGC 4 cut(s) 458, 753, 976, 1038
PpuMI RGGWCCY 1 cut(s) 227
Psp5II RGGWCCY 1 cut(s) 227
PspN4I GGNNCC 4 cut(s) 229, 811, 957, 1227
PspPI GGNCC 4 cut(s) 227, 493, 955, 1225
PspPPI RGGWCCY 1 cut(s) 227
PsuI RGATCY 1 cut(s) 1056
PvuII CAGCTG 1 cut(s) 751
RsaI GTAC 1 cut(s) 210
RsaNI GTAC 1 cut(s) 209
SapI GCTCTTC 1 cut(s) 458
SaqAI TTAA 4 cut(s) 69, 387, 636, 1188
SatI GCNGC 4 cut(s) 457, 752, 975, 1037
Sau3AI GATC 7 cut(s) 202, 283, 472, 694, 742, 967, 1056
Sau96I GGNCC 4 cut(s) 227, 493, 955, 1225
SfaNI GCATC 2 cut(s) 577, 655
SfcI CTRYAG 1 cut(s) 181
SfuI TTCGAA 1 cut(s) 763
SinI GGWCC 3 cut(s) 227, 955, 1225
SmlI CTYRAG 5 cut(s) 68, 536, 578, 731, 1118
SmoI CTYRAG 5 cut(s) 68, 536, 578, 731, 1118
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 8 cut(s) 15, 340, 548, 706, 724, 850, 891, 945
SsiI CCGC 1 cut(s) 1036
SspI AATATT 1 cut(s) 196
SspMI CTAG 5 cut(s) 147, 266, 273, 1079, 1166
TaaI ACNGT 3 cut(s) 901, 1019, 1132
TaqI TCGA 4 cut(s) 286, 763, 1089, 1149
TasI AATT 8 cut(s) 15, 340, 548, 706, 724, 850, 891, 945
TatI WGTACW 1 cut(s) 208
TauI GCSGC 1 cut(s) 1039
TfiI GAWTC 4 cut(s) 647, 992, 1091, 1196
Tru1I TTAA 4 cut(s) 69, 387, 636, 1188
Tru9I TTAA 4 cut(s) 69, 387, 636, 1188
TseI GCWGC 3 cut(s) 456, 751, 974
TspDTI ATGAA 5 cut(s) 244, 389, 884, 903, 1075
Van91I CCANNNNNTGG 1 cut(s) 105
Vha464I CTTAAG 1 cut(s) 68
VpaK11BI GGWCC 3 cut(s) 227, 955, 1225
XapI RAATTY 3 cut(s) 724, 891, 945
XspI CTAG 5 cut(s) 147, 266, 273, 1079, 1166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.