Rmu_sc0001562.1_g000033

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001562.1
Physical Location & Seq
Forward (+)
161457 .. 162919
1463 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001562.1_g000033.1.cds

Sequence Viewer

Length: 1239 bp
atggagttggatagaattagcagcttaccaaatgatgttacagaaaagattttgtcaggtttgccacttaaggaggcagtaaggacgagtattttatcccgaaagtggaggtacaaatcggacatgcttcaagctctagtgtttgatgatgagtgtctcgagactcaaagtcatccaaggttaaccttcagctttgtgaatattgttgatcatgtactcttactccataaaggtcccatacacaggttcgagctttctttcaatggtaagctagccactagggatatagatcgatggatttttcacctatccagaaaccctgtcatcaaagtgatgatacttgacaattttaaaggggacatctacaacattccatcatgtttgttttcttttcaagatatcgttcgtttagagttattcaggtgtttgctaaaacctccttccgcattcaaaggctttggcagcttgaagagccttgatctttgttgtgctactttggcccatgatgtgtttgacaacttgattggttgcagtcctctgcttgagatattgaaattgcaaagctgtgatggtttcaccaatctcaaaattgatgcaccgaagctccggtttatttgcatagtaggggacttcaaagattttaacctcgtgggttcctcaaatcttgtggatgcttcctttgatttgcaggtcattgttgatcaaagagggaattgtaatagttttgggaatttgctcaagttttttgatcaccagctgcctcaaattcgaaggctcacaataaagagaaactttctaaaatacttgtctattggtgccttgccagagaagctccctaaaccatgccaatatctcatttttctttctttagacatgaacttcgacaatccggatgaaatttcaactgtcttatgccttctgagaagctctcctgctctacaagaactgaaaattttggtggaccctgaaaaggatcacgctgctgtgggagaagtggaatcttgtttatatgacaactacaactgtgcatacactcaactgcggcttgtggaaataaccaagatctctggtgtaaaagctcaactagatttcatcaaatctctgcttctaagttcacctttgcttgagagaatgactgttcaacctgcatctctcaatggttcttttaagctcgtaaaagatttacttctgtttaagcgtgattcaaagcgtgcagagataatggttttggacccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

412

Amino Acids

46.85

Weight (kDa)

7.49

Isoelectric Point (pI)

37.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000103)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g03461 FvH4_2g03490 FvH4_2g03500 FvH4_2g03500 FvH4_2g03510 FvH4_2g03510 FvH4_2g03521 FvH4_2g03521 FvH4_2g27100 FvH4_2g27110 FvH4_2g27130 FvH4_2g27150 FvH4_2g40420 FvH4_2g40420 FvH4_2g40420 FvH4_2g40420 FvH4_3g20160 FvH4_3g20160 FvH4_3g33042 FvH4_4g17790 FvH4_5g14272 FvH4_5g14273 FvH4_5g20540
malus_domestica MD00G1039500.v1.1 MD05G1103500.v1.1 MD05G1103900.v1.1 MD05G1104300.v1.1 MD05G1104400.v1.1 MD05G1104600.v1.1 MD05G1157200.v1.1 MD05G1157700.v1.1 MD05G1157800.v1.1 MD08G1037400.v1.1 MD10G1108900.v1.1
prunus_persica Prupe.1G384700_v2.0.a1 Prupe.1G384700_v2.0.a1 Prupe.8G148700_v2.0.a1 Prupe.8G148700_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G148900_v2.0.a1 Prupe.8G149000_v2.0.a1
pyrus_communis pycom05g10100 pycom05g14980 pycom08g02980 pycom10g09400 pycom15g02910
rosa_chinensis RchiOBHm_Chr3g0455511 RchiOBHm_Chr4g0421851 RchiOBHm_Chr4g0421921 RchiOBHm_Chr4g0421931 RchiOBHm_Chr5g0033951 RchiOBHm_Chr5g0033971 RchiOBHm_Chr6g0248641 RchiOBHm_Chr6g0248651 RchiOBHm_Chr6g0248671 RchiOBHm_Chr6g0248681 RchiOBHm_Chr6g0248731 RchiOBHm_Chr6g0248741 RchiOBHm_Chr6g0248771 RchiOBHm_Chr6g0248791 RchiOBHm_Chr6g0248851 RchiOBHm_Chr6g0248871 RchiOBHm_Chr6g0248881 RchiOBHm_Chr6g0248921 RchiOBHm_Chr6g0252081 RchiOBHm_Chr6g0252091 RchiOBHm_Chr6g0252101 RchiOBHm_Chr6g0267131 RchiOBHm_Chr6g0295981 RchiOBHm_Chr6g0295991 RchiOBHm_Chr6g0296021 RchiOBHm_Chr6g0300311 RchiOBHm_Chr7g0182631
rosa_laevigata RLG00000005114 RLG00000007652 RLG00000011348 RLG00000011741 RLG00000011742 RLG00000011743 RLG00000011744 RLG00000011745 RLG00000011747 RLG00000011748 RLG00000011749 RLG00000011750 RLG00000014028 RLG00000014036 RLG00000015111 RLG00000015113 RLG00000015115 RLG00000015117 RLG00000015119 RLG00000015123 RLG00000015124 RLG00000015127 RLG00000015128 RLG00000015129 RLG00000015132 RLG00000033513 RLG00000034608
rosa_multiflora Rmu_co8062356.1_g000001 Rmu_co8494777.1_g000001 Rmu_sc0000229.1_g000003 Rmu_sc0000529.1_g000001 Rmu_sc0000529.1_g000002 Rmu_sc0000529.1_g000003 Rmu_sc0001014.1_g000001 Rmu_sc0001150.1_g000007 Rmu_sc0001562.1_g000002 Rmu_sc0001562.1_g000004 Rmu_sc0001562.1_g000005 Rmu_sc0001562.1_g000017 Rmu_sc0001562.1_g000033 Rmu_sc0001562.1_g000035 Rmu_sc0001670.1_g000022 Rmu_sc0002393.1_g000007 Rmu_sc0002393.1_g000008 Rmu_sc0002393.1_g000009 Rmu_sc0002393.1_g000010 Rmu_sc0002393.1_g000011 Rmu_sc0002393.1_g000021 Rmu_sc0002393.1_g000023 Rmu_sc0002393.1_g000035 Rmu_sc0002393.1_g000037 Rmu_sc0002489.1_g000003 Rmu_sc0002938.1_g000047 Rmu_sc0003139.1_g000013 Rmu_sc0003139.1_g000014 Rmu_sc0003139.1_g000015 Rmu_sc0003139.1_g000017 Rmu_sc0004275.1_g000033 Rmu_sc0004275.1_g000036 Rmu_sc0004703.1_g000001 Rmu_sc0006276.1_g000003 Rmu_sc0010676.1_g000003 Rmu_sc0010676.1_g000004 Rmu_sc0010676.1_g000006 Rmu_sc0010676.1_g000007 Rmu_sc0013953.1_g000004 Rmu_ssc0000388.1_g000016
rosa_roxburghii Rroxscaffold_1G00015220 Rroxscaffold_1G00046270 Rroxscaffold_2G00090150 Rroxscaffold_2G00120650 Rroxscaffold_2G00123380 Rroxscaffold_3G00234080 Rroxscaffold_3G00271110 Rroxscaffold_7G00167900 Rroxscaffold_7G00171950 Rroxscaffold_7G00171970 Rroxscaffold_7G00171980 Rroxscaffold_7G00171990 Rroxscaffold_7G00172000 Rroxscaffold_7G00201050 Rroxscaffold_7G00212860 Rroxscaffold_7G00212880 Rroxscaffold_7G00212920 Rroxscaffold_7G00212940 Rroxscaffold_7G00212990 Rroxscaffold_7G00213060 Rroxscaffold_7G00213070 Rroxscaffold_7G00213080 Rroxscaffold_7G00213100 Rroxscaffold_7G00213110 Rroxscaffold_7G00213120 Rroxscaffold_7G00213130 Rroxscaffold_7G00213140 Rroxscaffold_7G00217950
rosa_rugosa Rorug04G0089100 Rorug04G0176100 Rorug05G0143700 Rorug05G0532600 Rorug05G0532700 Rorug05G0532800 Rorug05G0533100 Rorug05G0533200 Rorug05G0533300 Rorug05G0533400 Rorug05G0533500 Rorug05G0533500 Rorug05G0533700 Rorug05G0533800 Rorug05G0533900 Rorug05G0534000 Rorug05G0534100.1 Rorug05G0534200 Rorug06G0029200 Rorug06G0029300 Rorug06G0029400 Rorug06G0255600 Rorug06G0255800 Rorug06G0255800 Rorug06G0255900 Rorug06G0255900 Rorug06G0255900 Rorug06G0256000 Rorug06G0256100 Rorug06G0256300 Rorug06G0256400 Rorug06G0294900 Rorug06G0448600 Rorug06G0448600 Rorug07G0094000
rosa_samantha Rh3BG070200 Rh3CG325900 Rh5BG235500 Rh6AG049500 Rh6AG049600 Rh6AG049800 Rh6AG049900 Rh6AG050100 Rh6AG050200 Rh6AG050300 Rh6AG050400 Rh6AG050500 Rh6AG050800 Rh6AG051100 Rh6AG051500 Rh6AG151100 Rh6AG369300 Rh6AG369500 Rh6AG369600 Rh6AG369800 Rh6AG369900 Rh6AG407600 Rh6DG038100 Rh7CG053500 Rh7CG053600 Rh7DG051800
rosa_wichuraiana Rw3G005370 Rw3G025850 Rw5G021490 Rw6G004290 Rw6G004300 Rw6G004310 Rw6G004320 Rw6G004330 Rw6G004340 Rw6G004390 Rw6G004410 Rw6G004420 Rw6G004430 Rw6G004450 Rw6G004460 Rw6G004490 Rw6G004510 Rw6G004590 Rw6G013080 Rw6G032210 Rw6G032220 Rw6G032230 Rw6G032250 Rw6G035640 Rw7G004270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 679, 1153
AccB1I GGYRCC 1 cut(s) 815
AccIII TCCGGA 1 cut(s) 889
AciI CCGC 2 cut(s) 444, 1042
AclWI GGATC 1 cut(s) 981
AcsI RAATTY 4 cut(s) 730, 765, 897, 951
AcuI CTGAAG 1 cut(s) 172
AfaI GTAC 2 cut(s) 113, 216
AfiI CCNNNNNNNGG 3 cut(s) 105, 243, 970
AflII CTTAAG 1 cut(s) 68
AhdI GACNNNNNGTC 1 cut(s) 168
Alw26I GTCTC 2 cut(s) 155, 161
AlwI GGATC 1 cut(s) 981
Ama87I CYCGRG 1 cut(s) 158
Aor13HI TCCGGA 1 cut(s) 889
AoxI GGCC 1 cut(s) 498
ApeKI GCWGC 4 cut(s) 21, 462, 757, 980
ApoI RAATTY 4 cut(s) 730, 765, 897, 951
ArsI GACNNNNNNTTYG 2 cut(s) 863, 895
AspS9I GGNCC 4 cut(s) 233, 499, 961, 1231
AsuHPI GGTGA 4 cut(s) 296, 568, 743, 1107
AsuII TTCGAA 1 cut(s) 769
AsuNHI GCTAGC 1 cut(s) 271
AvaI CYCGRG 1 cut(s) 158
AvaII GGWCC 3 cut(s) 233, 961, 1231
BanI GGYRCC 1 cut(s) 815
BauI CACGAG 1 cut(s) 647
BbvI GCAGC 4 cut(s) 33, 474, 744, 967
BccI CCATC 3 cut(s) 288, 382, 563
BclI TGATCA 3 cut(s) 208, 700, 748
BcoDI GTCTC 2 cut(s) 155, 161
BfaI CTAG 4 cut(s) 137, 272, 279, 1085
BfrI CTTAAG 1 cut(s) 68
BfuAI ACCTGC 2 cut(s) 679, 1153
BglII AGATCT 1 cut(s) 1062
BisI GCNGC 5 cut(s) 22, 463, 758, 981, 1043
BlsI GCNGC 5 cut(s) 23, 464, 759, 982, 1044
Bme18I GGWCC 3 cut(s) 233, 961, 1231
BmeRI GACNNNNNGTC 1 cut(s) 168
BmeT110I CYCGRG 1 cut(s) 158
BmgT120I GGNCC 4 cut(s) 233, 499, 961, 1231
BmiI GGNNCC 5 cut(s) 235, 655, 817, 963, 1233
BmsI GCATC 3 cut(s) 583, 661, 1157
BmtI GCTAGC 1 cut(s) 275
BplI GAGNNNNNCTC 2 cut(s) 913, 945
Bpu14I TTCGAA 1 cut(s) 769
BpuEI CTTGAG 3 cut(s) 563, 722, 1145
Bsa29I ATCGAT 1 cut(s) 292
BsaBI GATNNNNATC 1 cut(s) 288
BsaJI CCNNGG 1 cut(s) 176
BsaWI WCCGGW 2 cut(s) 606, 889
BsaXI ACNNNNNCTCC 4 cut(s) 207, 237, 588, 618
Bsc4I CCNNNNNNNGG 3 cut(s) 105, 243, 970
Bse8I GATNNNNATC 1 cut(s) 288
BseAI TCCGGA 1 cut(s) 889
BseCI ATCGAT 1 cut(s) 292
BseDI CCNNGG 1 cut(s) 176
BseGI GGATG 3 cut(s) 172, 676, 898
BseJI GATNNNNATC 1 cut(s) 288
BseLI CCNNNNNNNGG 3 cut(s) 105, 243, 970
BseMII CTCAG 1 cut(s) 911
BseXI GCAGC 4 cut(s) 33, 474, 744, 967
BsgI GTGCAG 1 cut(s) 1233
BshFI GGCC 1 cut(s) 500
BshNI GGYRCC 1 cut(s) 815
BshVI ATCGAT 1 cut(s) 292
BsiHKCI CYCGRG 1 cut(s) 158
BsiSI CCGG 2 cut(s) 607, 890
BslFI GGGAC 3 cut(s) 219, 371, 641
BslI CCNNNNNNNGG 3 cut(s) 105, 243, 970
BsmAI GTCTC 2 cut(s) 155, 161
BsmFI GGGAC 3 cut(s) 219, 371, 641
BsmI GAATGC 1 cut(s) 446
BsnI GGCC 1 cut(s) 500
BsoBI CYCGRG 1 cut(s) 158
Bsp119I TTCGAA 1 cut(s) 769
Bsp13I TCCGGA 1 cut(s) 889
Bsp143I GATC 7 cut(s) 208, 289, 478, 700, 748, 973, 1062
BspACI CCGC 2 cut(s) 444, 1042
BspANI GGCC 1 cut(s) 500
BspCNI CTCAG 1 cut(s) 912
BspDI ATCGAT 1 cut(s) 292
BspEI TCCGGA 1 cut(s) 889
BspLI GGNNCC 5 cut(s) 235, 655, 817, 963, 1233
BspMI ACCTGC 2 cut(s) 679, 1153
BspOI GCTAGC 1 cut(s) 275
BspPI GGATC 1 cut(s) 981
BspQI GCTCTTC 1 cut(s) 464
BspT104I TTCGAA 1 cut(s) 769
BspT107I GGYRCC 1 cut(s) 815
BspTI CTTAAG 1 cut(s) 68
BssECI CCNNGG 1 cut(s) 176
BssMI GATC 7 cut(s) 208, 289, 478, 700, 748, 973, 1062
BssSI CACGAG 1 cut(s) 647
BssT1I CCWWGG 1 cut(s) 176
Bst2BI CACGAG 1 cut(s) 647
Bst4CI ACNGT 3 cut(s) 907, 1025, 1138
Bst6I CTCTTC 1 cut(s) 464
BstAFI CTTAAG 1 cut(s) 68
BstBI TTCGAA 1 cut(s) 769
BstC8I GCNNGC 2 cut(s) 273, 1212
BstDEI CTNAG 2 cut(s) 920, 1109
BstF5I GGATG 3 cut(s) 172, 676, 898
BstKTI GATC 7 cut(s) 211, 292, 481, 703, 751, 976, 1065
BstMAI GTCTC 2 cut(s) 155, 161
BstMBI GATC 7 cut(s) 208, 289, 478, 700, 748, 973, 1062
BstMWI GCNNNNNNNGC 4 cut(s) 462, 471, 497, 829
BstNSI RCATGY 1 cut(s) 127
BstV1I GCAGC 4 cut(s) 33, 474, 744, 967
BstX2I RGATCY 1 cut(s) 1062
BstYI RGATCY 1 cut(s) 1062
Bsu15I ATCGAT 1 cut(s) 292
BsuRI GGCC 1 cut(s) 500
BsuTUI ATCGAT 1 cut(s) 292
BtsCI GGATG 3 cut(s) 172, 676, 898
BveI ACCTGC 2 cut(s) 679, 1153
Cac8I GCNNGC 2 cut(s) 273, 1212
Cfr13I GGNCC 4 cut(s) 233, 499, 961, 1231
ClaI ATCGAT 1 cut(s) 292
Csp6I GTAC 2 cut(s) 112, 215
CspCI CAANNNNNGTGG 2 cut(s) 648, 683
CviAII CATG 6 cut(s) 124, 212, 378, 503, 843, 874
CviQI GTAC 2 cut(s) 112, 215
DdeI CTNAG 2 cut(s) 920, 1109
DpnI GATC 7 cut(s) 210, 291, 480, 702, 750, 975, 1064
DpnII GATC 7 cut(s) 208, 289, 478, 700, 748, 973, 1062
DraI TTTAAA 1 cut(s) 352
DriI GACNNNNNGTC 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 464
Eam1105I GACNNNNNGTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 464
Eco130I CCWWGG 1 cut(s) 176
Eco32I GATATC 1 cut(s) 400
Eco47I GGWCC 3 cut(s) 233, 961, 1231
Eco57I CTGAAG 1 cut(s) 172
Eco88I CYCGRG 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 233
EcoRV GATATC 1 cut(s) 400
EcoT14I CCWWGG 1 cut(s) 176
ErhI CCWWGG 1 cut(s) 176
FaeI CATG 6 cut(s) 127, 215, 381, 506, 846, 877
FalI AAGNNNNNCTT 6 cut(s) 776, 808, 1102, 1134, 1170, 1202
FaqI GGGAC 3 cut(s) 219, 371, 641
FatI CATG 6 cut(s) 123, 211, 377, 502, 842, 873
FbaI TGATCA 3 cut(s) 208, 700, 748
Fnu4HI GCNGC 5 cut(s) 22, 463, 758, 981, 1043
FokI GGATG 3 cut(s) 159, 683, 905
Fsp4HI GCNGC 5 cut(s) 22, 463, 758, 981, 1043
FspBI CTAG 4 cut(s) 137, 272, 279, 1085
GluI GCNGC 5 cut(s) 22, 463, 758, 981, 1043
HaeIII GGCC 1 cut(s) 500
HapII CCGG 2 cut(s) 607, 890
Hin1II CATG 6 cut(s) 127, 215, 381, 506, 846, 877
HincII GTYRAC 1 cut(s) 183
HindII GTYRAC 1 cut(s) 183
HinfI GANTC 3 cut(s) 163, 998, 1202
HpaI GTTAAC 1 cut(s) 183
HpaII CCGG 2 cut(s) 607, 890
HphI GGTGA 4 cut(s) 296, 568, 743, 1107
Hpy166II GTNNAC 3 cut(s) 183, 961, 1115
Hpy188I TCNGA 2 cut(s) 121, 921
Hpy188III TCNNGA 6 cut(s) 99, 158, 160, 312, 395, 890
Hpy8I GTNNAC 3 cut(s) 183, 961, 1115
HpyAV CCTTC 4 cut(s) 196, 450, 765, 926
HpyCH4III ACNGT 3 cut(s) 907, 1025, 1138
HpyCH4V TGCA 8 cut(s) 531, 559, 596, 618, 688, 1028, 1148, 1214
HpyF10VI GCNNNNNNNGC 4 cut(s) 462, 471, 497, 829
HpyF3I CTNAG 2 cut(s) 920, 1109
Hsp92II CATG 6 cut(s) 127, 215, 381, 506, 846, 877
Kpn2I TCCGGA 1 cut(s) 889
Ksp22I TGATCA 3 cut(s) 208, 700, 748
KspAI GTTAAC 1 cut(s) 183
Kzo9I GATC 7 cut(s) 208, 289, 478, 700, 748, 973, 1062
LguI GCTCTTC 1 cut(s) 464
LmnI GCTCC 2 cut(s) 609, 837
Lsp1109I GCAGC 4 cut(s) 33, 474, 744, 967
LweI GCATC 3 cut(s) 583, 661, 1157
MaeI CTAG 4 cut(s) 137, 272, 279, 1085
MaeIII GTNAC 1 cut(s) 37
MalI GATC 7 cut(s) 210, 291, 480, 702, 750, 975, 1064
MboI GATC 7 cut(s) 208, 289, 478, 700, 748, 973, 1062
MboII GAAGA 1 cut(s) 481
MflI RGATCY 1 cut(s) 1062
MluCI AATT 9 cut(s) 15, 346, 554, 588, 712, 730, 765, 897, 951
MlyI GAGTC 1 cut(s) 157
MnlI CCTC 8 cut(s) 67, 102, 447, 546, 656, 667, 701, 771
MroI TCCGGA 1 cut(s) 889
MseI TTAA 6 cut(s) 69, 182, 351, 642, 1167, 1194
MslI CAYNNNNRTG 1 cut(s) 329
MspA1I CMGCKG 1 cut(s) 757
MspCI CTTAAG 1 cut(s) 68
MspI CCGG 2 cut(s) 607, 890
Mva1269I GAATGC 1 cut(s) 446
MwoI GCNNNNNNNGC 4 cut(s) 462, 471, 497, 829
NdeII GATC 7 cut(s) 208, 289, 478, 700, 748, 973, 1062
NheI GCTAGC 1 cut(s) 271
NlaIII CATG 6 cut(s) 127, 215, 381, 506, 846, 877
NlaIV GGNNCC 5 cut(s) 235, 655, 817, 963, 1233
NspI RCATGY 1 cut(s) 127
NspV TTCGAA 1 cut(s) 769
PaeR7I CTCGAG 1 cut(s) 158
PciSI GCTCTTC 1 cut(s) 464
PctI GAATGC 1 cut(s) 446
PfeI GAWTC 2 cut(s) 998, 1202
PkrI GCNGC 5 cut(s) 23, 464, 759, 982, 1044
PleI GAGTC 1 cut(s) 157
PpsI GAGTC 1 cut(s) 157
PpuMI RGGWCCY 1 cut(s) 233
Psp5II RGGWCCY 1 cut(s) 233
PspN4I GGNNCC 5 cut(s) 235, 655, 817, 963, 1233
PspPI GGNCC 4 cut(s) 233, 499, 961, 1231
PspPPI RGGWCCY 1 cut(s) 233
PsuI RGATCY 1 cut(s) 1062
PvuII CAGCTG 1 cut(s) 757
RsaI GTAC 2 cut(s) 113, 216
RsaNI GTAC 2 cut(s) 112, 215
RseI CAYNNNNRTG 1 cut(s) 329
SapI GCTCTTC 1 cut(s) 464
SaqAI TTAA 6 cut(s) 69, 182, 351, 642, 1167, 1194
SatI GCNGC 5 cut(s) 22, 463, 758, 981, 1043
Sau3AI GATC 7 cut(s) 208, 289, 478, 700, 748, 973, 1062
Sau96I GGNCC 4 cut(s) 233, 499, 961, 1231
SchI GAGTC 1 cut(s) 157
SfaNI GCATC 3 cut(s) 583, 661, 1157
Sfr274I CTCGAG 1 cut(s) 158
SfuI TTCGAA 1 cut(s) 769
SinI GGWCC 3 cut(s) 233, 961, 1231
SlaI CTCGAG 1 cut(s) 158
SmiMI CAYNNNNRTG 1 cut(s) 329
SmlI CTYRAG 5 cut(s) 68, 158, 542, 737, 1124
SmoI CTYRAG 5 cut(s) 68, 158, 542, 737, 1124
Sse9I AATT 9 cut(s) 15, 346, 554, 588, 712, 730, 765, 897, 951
SsiI CCGC 2 cut(s) 444, 1042
SspI AATATT 1 cut(s) 202
SspMI CTAG 4 cut(s) 137, 272, 279, 1085
StyI CCWWGG 1 cut(s) 176
TaaI ACNGT 3 cut(s) 907, 1025, 1138
TaqI TCGA 5 cut(s) 159, 249, 292, 769, 882
TasI AATT 9 cut(s) 15, 346, 554, 588, 712, 730, 765, 897, 951
TatI WGTACW 1 cut(s) 214
TauI GCSGC 1 cut(s) 1045
TfiI GAWTC 2 cut(s) 998, 1202
Tru1I TTAA 6 cut(s) 69, 182, 351, 642, 1167, 1194
Tru9I TTAA 6 cut(s) 69, 182, 351, 642, 1167, 1194
TseI GCWGC 4 cut(s) 21, 462, 757, 980
TspDTI ATGAA 3 cut(s) 890, 909, 1081
Vha464I CTTAAG 1 cut(s) 68
VpaK11BI GGWCC 3 cut(s) 233, 961, 1231
XapI RAATTY 4 cut(s) 730, 765, 897, 951
XceI RCATGY 1 cut(s) 127
XhoI CTCGAG 1 cut(s) 158
XspI CTAG 4 cut(s) 137, 272, 279, 1085
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.