Rmu_sc0007767.1_g000001

Required for 40S ribosome biogenesis. Involved in nucleolar processing of pre-18S ribosomal RNA and ribosome assembly

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007767.1
OG0000145
Physical Location & Seq
Reverse (-)
757 .. 3124
2368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007767.1_g000001.1.cds

Sequence Viewer

Length: 672 bp
atgtcggaagattacccaaacgccattgttctgcagctcgaggaggctctgatggtccaagatgaaattgaagtcgtctcttacaccaagttctgcgatcgattccttgacacagatttgctgcaaaaaacttggcctatagtggagtcgtgtttaagcaagcatggcgtcttgtgcacactggatctggttgagggtaatatgaaggtctctaaaactaaaagggctgaagatgaagacataattttcaaggcaattgatattttgcagcttttgtcgagaagtgttccagcacgttgggcaatacgaacgctggattgcagttgccaacatgagatcatcaagattgggaatcaagagggggggatttgcaacatatttgggatcagtaaggagcaatttcttgcacggaggaatcttctcgctggtgtcataaaggggctttttgaactgactggctgtggtgtttttcttaagggaaataccattgctcttattggtccactgcaaggaataaagacgataacaaagattgtggaagactgcatcgctcataatgtgcctcctgcacctcgtgtgcggaggattaaaaagaagactggattgatgaaggatgcgaggattaaaatgacaagtgaagtgatgatgagtcttgaggcttttcatgtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

223

Amino Acids

24.96

Weight (kDa)

7.55

Isoelectric Point (pI)

49.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000145)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G08420
fragaria_vesca FvH4_1g11160 FvH4_2g08143 FvH4_3g36450 FvH4_3g36450 FvH4_3g36450 FvH4_3g36450 FvH4_3g36460 FvH4_3g36460 FvH4_3g45301 FvH4_4g27690 FvH4_4g27690 FvH4_4g27690 FvH4_4g27690 FvH4_5g09160 FvH4_5g09161 FvH4_5g09380 FvH4_5g22900 FvH4_6g42520 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550
malus_domestica MD02G1015700.v1.1 MD02G1058900.v1.1 MD02G1059000.v1.1 MD03G1170900.v1.1 MD04G1231500.v1.1 MD13G1044300.v1.1 MD16G1045100.v1.1
prunus_persica Prupe.1G308200_v2.0.a1 Prupe.2G125300_v2.0.a1 Prupe.6G307800_v2.0.a1 Prupe.6G351700_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1
pyrus_communis pycom02g01420 pycom02g04810 pycom03g12790 pycom03g12800 pycom12g17840 pycom12g17850 pycom12g17860 pycom13g03890 pycom16g03970
rosa_chinensis RchiOBHm_Chr2g0090081 RchiOBHm_Chr3g0469061 RchiOBHm_Chr3g0469081 RchiOBHm_Chr4g0435531 RchiOBHm_Chr5g0014021 RchiOBHm_Chr5g0014031 RchiOBHm_Chr5g0014041 RchiOBHm_Chr7g0190151 RchiOBHm_Chr7g0190161 RchiOBHm_Chr7g0190171 RchiOBHm_Chr7g0210441
rosa_laevigata RLG00000003683 RLG00000003687 RLG00000003688 RLG00000004561 RLG00000004643 RLG00000016083 RLG00000021085 RLG00000024381 RLG00000032065 RLG00000032067 RLG00000032071 RLG00000032072 RLG00000032075
rosa_multiflora Rmu_co8284349.1_g000001 Rmu_co8324735.1_g000001 Rmu_co8355915.1_g000001 Rmu_co8388905.1_g000001 Rmu_sc0000302.1_g000041 Rmu_sc0000302.1_g000050 Rmu_sc0001940.1_g000034 Rmu_sc0003807.1_g000011 Rmu_sc0005803.1_g000001 Rmu_sc0005803.1_g000007 Rmu_sc0007139.1_g000007 Rmu_sc0007767.1_g000001 Rmu_sc0007767.1_g000003 Rmu_sc0007767.1_g000006 Rmu_sc0007933.1_g000005 Rmu_sc0008587.1_g000004 Rmu_sc0008968.1_g000004 Rmu_sc0018491.1_g000002 Rmu_sc0022420.1_g000001 Rmu_sc0027700.1_g000001 Rmu_sc0036218.1_g000001
rosa_roxburghii Rroxscaffold_1G00062590 Rroxscaffold_1G00062600 Rroxscaffold_1G00062620 Rroxscaffold_1G00062630 Rroxscaffold_1G00062640 Rroxscaffold_1G00062670 Rroxscaffold_1G00062680 Rroxscaffold_2G00091430 Rroxscaffold_2G00151410 Rroxscaffold_3G00245340 Rroxscaffold_3G00255390 Rroxscaffold_3G00264820 Rroxscaffold_3G00264830 Rroxscaffold_3G00265870 Rroxscaffold_5G00355140 Rroxscaffold_5G00376760 Rroxscaffold_6G00412230
rosa_rugosa Rorug02G0005200 Rorug02G0468300 Rorug02G0468300 Rorug02G0532400 Rorug03G0098900 Rorug03G0099000 Rorug03G0099400 Rorug04G0286000 Rorug05G0014400 Rorug05G0014500 Rorug05G0014600 Rorug05G0014600 Rorug05G0014600 Rorug05G0014800 Rorug05G0014900 Rorug05G0015000 Rorug05G0015100 Rorug05G0015100 Rorug05G0441300 Rorug06G0495300 Rorug06G0502600 Rorug06G0502700 Rorug07G0062300
rosa_samantha Rh2AG050900 Rh2BG049600 Rh2CG051800 Rh2CG234600 Rh2DG051100 Rh3BG171300 Rh3BG171800 Rh3CG336700 Rh3DG203600 Rh3DG203800 Rh4AG341600 Rh4AG341700 Rh4BG349900 Rh4CG364600 Rh4DG344200 Rh5AG108800 Rh5AG108900 Rh5AG109000 Rh5AG109100 Rh5BG105500 Rh5CG117300 Rh5CG117500 Rh5CG117600 Rh5DG104200 Rh5DG104400 Rh5DG104500 Rh5DG104600 Rh7BG102300 Rh7BG110600 Rh7BG110700 Rh7BG118900 Rh7CG103600 Rh7CG112800 Rh7CG113000 Rh7CG200300 Rh7CG271100 Rh7DG111300 Rh7DG111400 Rh7DG194400 Rh7DG261800 Rh7DG261900
rosa_wichuraiana Rw0G014550 Rw0G014580 Rw2G004580 Rw3G013980 Rw3G013990 Rw3G014000 Rw3G014020 Rw4G029810 Rw5G009500 Rw5G009510 Rw5G009520 Rw5G009530 Rw7G008640 Rw7G009350 Rw7G021680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 580
AclWI GGATC 2 cut(s) 192, 392
AcuI CTGAAG 1 cut(s) 249
AcyI GRCGYC 1 cut(s) 168
AdeI CACNNNGTG 1 cut(s) 575
AfiI CCNNNNNNNGG 1 cut(s) 509
AflII CTTAAG 1 cut(s) 473
AgsI TTSAA 3 cut(s) 71, 250, 449
AluBI AGCT 2 cut(s) 37, 271
AluI AGCT 2 cut(s) 37, 271
Alw21I GWGCWC 1 cut(s) 179
Alw26I GTCTC 2 cut(s) 82, 214
Alw44I GTGCAC 1 cut(s) 175
AlwI GGATC 2 cut(s) 192, 392
Ama87I CYCGRG 1 cut(s) 38
AoxI GGCC 1 cut(s) 134
ApaLI GTGCAC 1 cut(s) 175
ApeKI GCWGC 3 cut(s) 34, 121, 268
AspS9I GGNCC 2 cut(s) 55, 500
AvaI CYCGRG 1 cut(s) 38
AvaII GGWCC 2 cut(s) 55, 500
BaeGI GKGCMC 1 cut(s) 179
BauI CACGAG 1 cut(s) 573
BbsI GAAGAC 3 cut(s) 243, 546, 602
Bbv12I GWGCWC 1 cut(s) 179
BbvI GCAGC 3 cut(s) 46, 108, 280
BccI CCATC 1 cut(s) 46
BcoDI GTCTC 2 cut(s) 82, 214
BfmI CTRYAG 2 cut(s) 32, 138
BfrI CTTAAG 1 cut(s) 473
BisI GCNGC 3 cut(s) 35, 122, 269
BlsI GCNGC 3 cut(s) 36, 123, 270
Bme18I GGWCC 2 cut(s) 55, 500
BmeT110I CYCGRG 1 cut(s) 38
BmgT120I GGNCC 2 cut(s) 55, 500
BmsI GCATC 2 cut(s) 555, 604
BpiI GAAGAC 3 cut(s) 243, 546, 602
Bsa29I ATCGAT 1 cut(s) 100
BsaHI GRCGYC 1 cut(s) 168
BsaI GGTCTC 1 cut(s) 214
Bsc4I CCNNNNNNNGG 1 cut(s) 509
Bse1I ACTGG 3 cut(s) 186, 460, 604
Bse3DI GCAATG 1 cut(s) 486
BseCI ATCGAT 1 cut(s) 100
BseGI GGATG 1 cut(s) 619
BseLI CCNNNNNNNGG 1 cut(s) 509
BseMI GCAATG 1 cut(s) 486
BseNI ACTGG 3 cut(s) 186, 460, 604
BseRI GAGGAG 1 cut(s) 56
BseSI GKGCMC 1 cut(s) 179
BseXI GCAGC 3 cut(s) 46, 108, 280
BsgI GTGCAG 1 cut(s) 552
Bsh1285I CGRYCG 1 cut(s) 100
BshFI GGCC 1 cut(s) 136
BshVI ATCGAT 1 cut(s) 100
BsiEI CGRYCG 1 cut(s) 100
BsiHKAI GWGCWC 1 cut(s) 179
BsiHKCI CYCGRG 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 509
BsmAI GTCTC 2 cut(s) 82, 214
BsmBI CGTCTC 1 cut(s) 82
BsnI GGCC 1 cut(s) 136
Bso31I GGTCTC 1 cut(s) 214
BsoBI CYCGRG 1 cut(s) 38
Bsp1286I GDGCHC 1 cut(s) 179
Bsp143I GATC 4 cut(s) 97, 184, 336, 384
BspACI CCGC 1 cut(s) 580
BspANI GGCC 1 cut(s) 136
BspDI ATCGAT 1 cut(s) 100
BspMAI CTGCAG 1 cut(s) 36
BspPI GGATC 2 cut(s) 192, 392
BspTI CTTAAG 1 cut(s) 473
BspTNI GGTCTC 1 cut(s) 214
BsrDI GCAATG 1 cut(s) 486
BsrI ACTGG 3 cut(s) 186, 460, 604
BssMI GATC 4 cut(s) 97, 184, 336, 384
BssNI GRCGYC 1 cut(s) 168
BssSI CACGAG 1 cut(s) 573
Bst2BI CACGAG 1 cut(s) 573
BstACI GRCGYC 1 cut(s) 168
BstAFI CTTAAG 1 cut(s) 473
BstC8I GCNNGC 1 cut(s) 161
BstF5I GGATG 1 cut(s) 619
BstKTI GATC 4 cut(s) 100, 187, 339, 387
BstMAI GTCTC 2 cut(s) 82, 214
BstMBI GATC 4 cut(s) 97, 184, 336, 384
BstMCI CGRYCG 1 cut(s) 100
BstMWI GCNNNNNNNGC 3 cut(s) 165, 174, 299
BstSFI CTRYAG 2 cut(s) 32, 138
BstSLI GKGCMC 1 cut(s) 179
BstV1I GCAGC 3 cut(s) 46, 108, 280
BstV2I GAAGAC 3 cut(s) 243, 546, 602
BstX2I RGATCY 1 cut(s) 184
BstXI CCANNNNNNTGG 1 cut(s) 297
BstYI RGATCY 1 cut(s) 184
Bsu15I ATCGAT 1 cut(s) 100
BsuRI GGCC 1 cut(s) 136
BsuTUI ATCGAT 1 cut(s) 100
BtgZI GCGATG 1 cut(s) 532
BtsCI GGATG 1 cut(s) 619
BtsI GCAGTG 1 cut(s) 503
BtsIMutI CAGTG 2 cut(s) 179, 503
Cac8I GCNNGC 1 cut(s) 161
Cfr13I GGNCC 2 cut(s) 55, 500
ClaI ATCGAT 1 cut(s) 100
CseI GACGC 1 cut(s) 157
CspCI CAANNNNNGTGG 2 cut(s) 516, 551
CviAII CATG 3 cut(s) 164, 332, 665
CviJI RGCY 8 cut(s) 37, 47, 136, 227, 271, 442, 459, 659
CviKI_1 RGCY 8 cut(s) 37, 47, 136, 227, 271, 442, 459, 659
DpnI GATC 4 cut(s) 99, 186, 338, 386
DpnII GATC 4 cut(s) 97, 184, 336, 384
DraIII CACNNNGTG 1 cut(s) 575
Eco31I GGTCTC 1 cut(s) 214
Eco47I GGWCC 2 cut(s) 55, 500
Eco57I CTGAAG 1 cut(s) 249
Eco88I CYCGRG 1 cut(s) 38
Esp3I CGTCTC 1 cut(s) 82
FaeI CATG 3 cut(s) 167, 335, 668
FaiI YATR 9 cut(s) 140, 165, 203, 242, 333, 377, 434, 555, 666
FatI CATG 3 cut(s) 163, 331, 664
Fnu4HI GCNGC 3 cut(s) 35, 122, 269
FokI GGATG 1 cut(s) 626
Fsp4HI GCNGC 3 cut(s) 35, 122, 269
GluI GCNGC 3 cut(s) 35, 122, 269
HaeIII GGCC 1 cut(s) 136
HgaI GACGC 1 cut(s) 157
Hin1I GRCGYC 1 cut(s) 168
Hin1II CATG 3 cut(s) 167, 335, 668
HinfI GANTC 5 cut(s) 102, 146, 352, 415, 649
Hpy166II GTNNAC 2 cut(s) 177, 503
Hpy188I TCNGA 3 cut(s) 7, 51, 671
Hpy188III TCNNGA 4 cut(s) 279, 343, 356, 653
Hpy8I GTNNAC 2 cut(s) 177, 503
HpyAV CCTTC 2 cut(s) 199, 604
HpyCH4IV ACGT 1 cut(s) 295
HpyF10VI GCNNNNNNNGC 3 cut(s) 165, 174, 299
HpySE526I ACGT 1 cut(s) 295
Hsp92I GRCGYC 1 cut(s) 168
Hsp92II CATG 3 cut(s) 167, 335, 668
Kzo9I GATC 4 cut(s) 97, 184, 336, 384
LmnI GCTCC 1 cut(s) 394
LpnPI CCDG 8 cut(s) 167, 173, 299, 303, 411, 441, 579, 585
Lsp1109I GCAGC 3 cut(s) 46, 108, 280
LweI GCATC 2 cut(s) 555, 604
MaeII ACGT 1 cut(s) 295
MalI GATC 4 cut(s) 99, 186, 338, 386
MboI GATC 4 cut(s) 97, 184, 336, 384
MboII GAAGA 6 cut(s) 20, 242, 248, 410, 551, 607
MfeI CAATTG 1 cut(s) 255
MflI RGATCY 1 cut(s) 184
MhlI GDGCHC 1 cut(s) 179
MluCI AATT 4 cut(s) 66, 243, 255, 398
MlyI GAGTC 2 cut(s) 155, 658
MseI TTAA 4 cut(s) 155, 474, 588, 624
MspCI CTTAAG 1 cut(s) 473
MunI CAATTG 1 cut(s) 255
MwoI GCNNNNNNNGC 3 cut(s) 165, 174, 299
NdeII GATC 4 cut(s) 97, 184, 336, 384
NlaIII CATG 3 cut(s) 167, 335, 668
PaeR7I CTCGAG 1 cut(s) 38
PfeI GAWTC 3 cut(s) 102, 352, 415
PkrI GCNGC 3 cut(s) 36, 123, 270
Ple19I CGATCG 1 cut(s) 100
PleI GAGTC 2 cut(s) 154, 657
PpsI GAGTC 2 cut(s) 154, 657
PspPI GGNCC 2 cut(s) 55, 500
PspXI VCTCGAGB 1 cut(s) 38
PstI CTGCAG 1 cut(s) 36
PsuI RGATCY 1 cut(s) 184
PvuI CGATCG 1 cut(s) 100
SaqAI TTAA 4 cut(s) 155, 474, 588, 624
SatI GCNGC 3 cut(s) 35, 122, 269
Sau3AI GATC 4 cut(s) 97, 184, 336, 384
Sau96I GGNCC 2 cut(s) 55, 500
SchI GAGTC 2 cut(s) 155, 658
SduI GDGCHC 1 cut(s) 179
SetI ASST 5 cut(s) 39, 210, 273, 298, 574
SfaNI GCATC 2 cut(s) 555, 604
SfcI CTRYAG 2 cut(s) 32, 138
Sfr274I CTCGAG 1 cut(s) 38
SinI GGWCC 2 cut(s) 55, 500
SlaI CTCGAG 1 cut(s) 38
SmlI CTYRAG 3 cut(s) 38, 473, 653
SmoI CTYRAG 3 cut(s) 38, 473, 653
Sse9I AATT 4 cut(s) 66, 243, 255, 398
SsiI CCGC 1 cut(s) 580
TaiI ACGT 1 cut(s) 298
TaqI TCGA 3 cut(s) 39, 100, 278
TasI AATT 4 cut(s) 66, 243, 255, 398
TfiI GAWTC 3 cut(s) 102, 352, 415
Tru1I TTAA 4 cut(s) 155, 474, 588, 624
Tru9I TTAA 4 cut(s) 155, 474, 588, 624
TscAI CASTG 2 cut(s) 186, 510
TseI GCWGC 3 cut(s) 34, 121, 268
TspDTI ATGAA 5 cut(s) 78, 218, 249, 623, 653
TspGWI ACGGA 1 cut(s) 424
TspRI CASTG 2 cut(s) 186, 510
Vha464I CTTAAG 1 cut(s) 473
VneI GTGCAC 1 cut(s) 175
VpaK11BI GGWCC 2 cut(s) 55, 500
XhoI CTCGAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.