Rh5AG109100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
10019681 .. 10021543
1863 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG109100.1

Sequence Viewer

Length: 162 bp
ATGGAGAACAGCAACCCAAAAGCGGACCAGATCGAGGTGGAAGTGTCTGAGTTCGAGAATGATTTTGATGTCGTCTCTTACACCAAGTTCTACGACGAATTCCTCAGAGCAATTTCTTGCACGGAGGAAGCTTCTGGCTGGCTATGTCCTAAAGGTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.04

Weight (kDa)

4.05

Isoelectric Point (pI)

60.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000145)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G08420
fragaria_vesca FvH4_1g11160 FvH4_2g08143 FvH4_3g36450 FvH4_3g36450 FvH4_3g36450 FvH4_3g36450 FvH4_3g36460 FvH4_3g36460 FvH4_3g45301 FvH4_4g27690 FvH4_4g27690 FvH4_4g27690 FvH4_4g27690 FvH4_5g09160 FvH4_5g09161 FvH4_5g09380 FvH4_5g22900 FvH4_6g42520 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550
malus_domestica MD02G1015700.v1.1 MD02G1058900.v1.1 MD02G1059000.v1.1 MD03G1170900.v1.1 MD04G1231500.v1.1 MD13G1044300.v1.1 MD16G1045100.v1.1
prunus_persica Prupe.1G308200_v2.0.a1 Prupe.2G125300_v2.0.a1 Prupe.6G307800_v2.0.a1 Prupe.6G351700_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1
pyrus_communis pycom02g01420 pycom02g04810 pycom03g12790 pycom03g12800 pycom12g17840 pycom12g17850 pycom12g17860 pycom13g03890 pycom16g03970
rosa_chinensis RchiOBHm_Chr2g0090081 RchiOBHm_Chr3g0469061 RchiOBHm_Chr3g0469081 RchiOBHm_Chr4g0435531 RchiOBHm_Chr5g0014021 RchiOBHm_Chr5g0014031 RchiOBHm_Chr5g0014041 RchiOBHm_Chr7g0190151 RchiOBHm_Chr7g0190161 RchiOBHm_Chr7g0190171 RchiOBHm_Chr7g0210441
rosa_laevigata RLG00000003683 RLG00000003687 RLG00000003688 RLG00000004561 RLG00000004643 RLG00000016083 RLG00000021085 RLG00000024381 RLG00000032065 RLG00000032067 RLG00000032071 RLG00000032072 RLG00000032075
rosa_multiflora Rmu_co8284349.1_g000001 Rmu_co8324735.1_g000001 Rmu_co8355915.1_g000001 Rmu_co8388905.1_g000001 Rmu_sc0000302.1_g000041 Rmu_sc0000302.1_g000050 Rmu_sc0001940.1_g000034 Rmu_sc0003807.1_g000011 Rmu_sc0005803.1_g000001 Rmu_sc0005803.1_g000007 Rmu_sc0007139.1_g000007 Rmu_sc0007767.1_g000001 Rmu_sc0007767.1_g000003 Rmu_sc0007767.1_g000006 Rmu_sc0007933.1_g000005 Rmu_sc0008587.1_g000004 Rmu_sc0008968.1_g000004 Rmu_sc0018491.1_g000002 Rmu_sc0022420.1_g000001 Rmu_sc0027700.1_g000001 Rmu_sc0036218.1_g000001
rosa_roxburghii Rroxscaffold_1G00062590 Rroxscaffold_1G00062600 Rroxscaffold_1G00062620 Rroxscaffold_1G00062630 Rroxscaffold_1G00062640 Rroxscaffold_1G00062670 Rroxscaffold_1G00062680 Rroxscaffold_2G00091430 Rroxscaffold_2G00151410 Rroxscaffold_3G00245340 Rroxscaffold_3G00255390 Rroxscaffold_3G00264820 Rroxscaffold_3G00264830 Rroxscaffold_3G00265870 Rroxscaffold_5G00355140 Rroxscaffold_5G00376760 Rroxscaffold_6G00412230
rosa_rugosa Rorug02G0005200 Rorug02G0468300 Rorug02G0468300 Rorug02G0532400 Rorug03G0098900 Rorug03G0099000 Rorug03G0099400 Rorug04G0286000 Rorug05G0014400 Rorug05G0014500 Rorug05G0014600 Rorug05G0014600 Rorug05G0014600 Rorug05G0014800 Rorug05G0014900 Rorug05G0015000 Rorug05G0015100 Rorug05G0015100 Rorug05G0441300 Rorug06G0495300 Rorug06G0502600 Rorug06G0502700 Rorug07G0062300
rosa_samantha Rh2AG050900 Rh2BG049600 Rh2CG051800 Rh2CG234600 Rh2DG051100 Rh3BG171300 Rh3BG171800 Rh3CG336700 Rh3DG203600 Rh3DG203800 Rh4AG341600 Rh4AG341700 Rh4BG349900 Rh4CG364600 Rh4DG344200 Rh5AG108800 Rh5AG108900 Rh5AG109000 Rh5AG109100 Rh5BG105500 Rh5CG117300 Rh5CG117500 Rh5CG117600 Rh5DG104200 Rh5DG104400 Rh5DG104500 Rh5DG104600 Rh7BG102300 Rh7BG110600 Rh7BG110700 Rh7BG118900 Rh7CG103600 Rh7CG112800 Rh7CG113000 Rh7CG200300 Rh7CG271100 Rh7DG111300 Rh7DG111400 Rh7DG194400 Rh7DG261800 Rh7DG261900
rosa_wichuraiana Rw0G014550 Rw0G014580 Rw2G004580 Rw3G013980 Rw3G013990 Rw3G014000 Rw3G014020 Rw4G029810 Rw5G009500 Rw5G009510 Rw5G009520 Rw5G009530 Rw7G008640 Rw7G009350 Rw7G021680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AcsI RAATTY 1 cut(s) 98
AfiI CCNNNNNNNGG 2 cut(s) 22, 34
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
Alw26I GTCTC 1 cut(s) 79
ApoI RAATTY 1 cut(s) 98
AspS9I GGNCC 1 cut(s) 25
AvaII GGWCC 1 cut(s) 25
BcoDI GTCTC 1 cut(s) 79
Bme18I GGWCC 1 cut(s) 25
BmgT120I GGNCC 1 cut(s) 25
Bsc4I CCNNNNNNNGG 2 cut(s) 22, 34
BseLI CCNNNNNNNGG 2 cut(s) 22, 34
BseMII CTCAG 2 cut(s) 39, 118
BslI CCNNNNNNNGG 2 cut(s) 22, 34
BsmAI GTCTC 1 cut(s) 79
BsmBI CGTCTC 1 cut(s) 79
Bsp143I GATC 1 cut(s) 30
BspACI CCGC 1 cut(s) 23
BspCNI CTCAG 2 cut(s) 40, 117
BssMI GATC 1 cut(s) 30
BstC8I GCNNGC 1 cut(s) 140
BstDEI CTNAG 2 cut(s) 48, 104
BstKTI GATC 1 cut(s) 33
BstMAI GTCTC 1 cut(s) 79
BstMBI GATC 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 140
Cfr13I GGNCC 1 cut(s) 25
CviJI RGCY 3 cut(s) 131, 138, 142
CviKI_1 RGCY 3 cut(s) 131, 138, 142
DdeI CTNAG 2 cut(s) 48, 104
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
Eco47I GGWCC 1 cut(s) 25
EcoRI GAATTC 1 cut(s) 98
Esp3I CGTCTC 1 cut(s) 79
FaiI YATR 2 cut(s) 145, 160
HindIII AAGCTT 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 49, 107
Hpy188III TCNNGA 1 cut(s) 55
Hpy99I CGWCG 1 cut(s) 98
HpyCH4V TGCA 2 cut(s) 120, 158
HpyF3I CTNAG 2 cut(s) 48, 104
Kzo9I GATC 1 cut(s) 30
LpnPI CCDG 3 cut(s) 41, 120, 124
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MluCI AATT 2 cut(s) 98, 111
MnlI CCTC 3 cut(s) 28, 113, 118
NdeII GATC 1 cut(s) 30
PspPI GGNCC 1 cut(s) 25
Sau3AI GATC 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 25
SetI ASST 3 cut(s) 39, 133, 157
SgeI CNNG 8 cut(s) 40, 46, 67, 97, 129, 133, 147, 151
SinI GGWCC 1 cut(s) 25
Sse9I AATT 2 cut(s) 98, 111
SsiI CCGC 1 cut(s) 23
TaqI TCGA 2 cut(s) 33, 54
TasI AATT 2 cut(s) 98, 111
TspGWI ACGGA 1 cut(s) 137
VpaK11BI GGWCC 1 cut(s) 25
XapI RAATTY 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.