Rmu_sc0007767.1_g000006

Required for 40S ribosome biogenesis. Involved in nucleolar processing of pre-18S ribosomal RNA and ribosome assembly

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007767.1
OG0000145
Physical Location & Seq
Reverse (-)
23390 .. 25594
2205 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007767.1_g000006.1.cds

Sequence Viewer

Length: 687 bp
atgtcggaagattacccaaacgccgattacccaaacgccattgttctgcagctcgaggaggctctgatggtccaagatgaaattgaagtcgtctcttacatcaagttctacgatcgattccttgacacagatttgctgcaaaaaacttggcctctagtggagtcgtgtttaagcaagcatggcgttttgtgcacactggatctggttaagggtaatatgaaggtttttaaaaccaaaggggctgaagatgaagacataattttcaaggcaattgatattttgcagcttttgtcaagaagtgttccagcacgttgggcgatacgaacgctggattgcagttgccaacatgagatcatcaagattgggaatcaagaaggggggatttgcaacatatttgggatcagtaaggagcaatttcttgcacggaggaatcttatcgttggtgtcatgaagggactttttgaacttactggctgtggcgtttttcttaagggaaataccattgctgttattggtccactgcaaggaataaagacgataacaaagattgtggaagactgcatcgctcacaatgtgcctcctgcaccccgtgtgcggaggattaaaaagaagactcaactgatgaaggatgcgaggattaaaatgacaagtgaagtgatgatgagtctcgaggcttttcatgtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

228

Amino Acids

25.66

Weight (kDa)

7.56

Isoelectric Point (pI)

46.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000145)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G08420
fragaria_vesca FvH4_1g11160 FvH4_2g08143 FvH4_3g36450 FvH4_3g36450 FvH4_3g36450 FvH4_3g36450 FvH4_3g36460 FvH4_3g36460 FvH4_3g45301 FvH4_4g27690 FvH4_4g27690 FvH4_4g27690 FvH4_4g27690 FvH4_5g09160 FvH4_5g09161 FvH4_5g09380 FvH4_5g22900 FvH4_6g42520 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550 FvH4_6g42550
malus_domestica MD02G1015700.v1.1 MD02G1058900.v1.1 MD02G1059000.v1.1 MD03G1170900.v1.1 MD04G1231500.v1.1 MD13G1044300.v1.1 MD16G1045100.v1.1
prunus_persica Prupe.1G308200_v2.0.a1 Prupe.2G125300_v2.0.a1 Prupe.6G307800_v2.0.a1 Prupe.6G351700_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1 Prupe.6G351800_v2.0.a1
pyrus_communis pycom02g01420 pycom02g04810 pycom03g12790 pycom03g12800 pycom12g17840 pycom12g17850 pycom12g17860 pycom13g03890 pycom16g03970
rosa_chinensis RchiOBHm_Chr2g0090081 RchiOBHm_Chr3g0469061 RchiOBHm_Chr3g0469081 RchiOBHm_Chr4g0435531 RchiOBHm_Chr5g0014021 RchiOBHm_Chr5g0014031 RchiOBHm_Chr5g0014041 RchiOBHm_Chr7g0190151 RchiOBHm_Chr7g0190161 RchiOBHm_Chr7g0190171 RchiOBHm_Chr7g0210441
rosa_laevigata RLG00000003683 RLG00000003687 RLG00000003688 RLG00000004561 RLG00000004643 RLG00000016083 RLG00000021085 RLG00000024381 RLG00000032065 RLG00000032067 RLG00000032071 RLG00000032072 RLG00000032075
rosa_multiflora Rmu_co8284349.1_g000001 Rmu_co8324735.1_g000001 Rmu_co8355915.1_g000001 Rmu_co8388905.1_g000001 Rmu_sc0000302.1_g000041 Rmu_sc0000302.1_g000050 Rmu_sc0001940.1_g000034 Rmu_sc0003807.1_g000011 Rmu_sc0005803.1_g000001 Rmu_sc0005803.1_g000007 Rmu_sc0007139.1_g000007 Rmu_sc0007767.1_g000001 Rmu_sc0007767.1_g000003 Rmu_sc0007767.1_g000006 Rmu_sc0007933.1_g000005 Rmu_sc0008587.1_g000004 Rmu_sc0008968.1_g000004 Rmu_sc0018491.1_g000002 Rmu_sc0022420.1_g000001 Rmu_sc0027700.1_g000001 Rmu_sc0036218.1_g000001
rosa_roxburghii Rroxscaffold_1G00062590 Rroxscaffold_1G00062600 Rroxscaffold_1G00062620 Rroxscaffold_1G00062630 Rroxscaffold_1G00062640 Rroxscaffold_1G00062670 Rroxscaffold_1G00062680 Rroxscaffold_2G00091430 Rroxscaffold_2G00151410 Rroxscaffold_3G00245340 Rroxscaffold_3G00255390 Rroxscaffold_3G00264820 Rroxscaffold_3G00264830 Rroxscaffold_3G00265870 Rroxscaffold_5G00355140 Rroxscaffold_5G00376760 Rroxscaffold_6G00412230
rosa_rugosa Rorug02G0005200 Rorug02G0468300 Rorug02G0468300 Rorug02G0532400 Rorug03G0098900 Rorug03G0099000 Rorug03G0099400 Rorug04G0286000 Rorug05G0014400 Rorug05G0014500 Rorug05G0014600 Rorug05G0014600 Rorug05G0014600 Rorug05G0014800 Rorug05G0014900 Rorug05G0015000 Rorug05G0015100 Rorug05G0015100 Rorug05G0441300 Rorug06G0495300 Rorug06G0502600 Rorug06G0502700 Rorug07G0062300
rosa_samantha Rh2AG050900 Rh2BG049600 Rh2CG051800 Rh2CG234600 Rh2DG051100 Rh3BG171300 Rh3BG171800 Rh3CG336700 Rh3DG203600 Rh3DG203800 Rh4AG341600 Rh4AG341700 Rh4BG349900 Rh4CG364600 Rh4DG344200 Rh5AG108800 Rh5AG108900 Rh5AG109000 Rh5AG109100 Rh5BG105500 Rh5CG117300 Rh5CG117500 Rh5CG117600 Rh5DG104200 Rh5DG104400 Rh5DG104500 Rh5DG104600 Rh7BG102300 Rh7BG110600 Rh7BG110700 Rh7BG118900 Rh7CG103600 Rh7CG112800 Rh7CG113000 Rh7CG200300 Rh7CG271100 Rh7DG111300 Rh7DG111400 Rh7DG194400 Rh7DG261800 Rh7DG261900
rosa_wichuraiana Rw0G014550 Rw0G014580 Rw2G004580 Rw3G013980 Rw3G013990 Rw3G014000 Rw3G014020 Rw4G029810 Rw5G009500 Rw5G009510 Rw5G009520 Rw5G009530 Rw7G008640 Rw7G009350 Rw7G021680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 595
AclWI GGATC 2 cut(s) 207, 407
AcuI CTGAAG 1 cut(s) 264
AdeI CACNNNGTG 2 cut(s) 574, 590
AfiI CCNNNNNNNGG 2 cut(s) 524, 594
AflII CTTAAG 1 cut(s) 488
AgsI TTSAA 3 cut(s) 86, 265, 464
AluBI AGCT 2 cut(s) 52, 286
AluI AGCT 2 cut(s) 52, 286
Alw21I GWGCWC 1 cut(s) 194
Alw26I GTCTC 2 cut(s) 97, 671
Alw44I GTGCAC 1 cut(s) 190
AlwI GGATC 2 cut(s) 207, 407
Ama87I CYCGRG 2 cut(s) 53, 668
AoxI GGCC 1 cut(s) 149
ApaLI GTGCAC 1 cut(s) 190
ApeKI GCWGC 3 cut(s) 49, 136, 283
AspS9I GGNCC 2 cut(s) 70, 515
AvaI CYCGRG 2 cut(s) 53, 668
AvaII GGWCC 2 cut(s) 70, 515
BaeGI GKGCMC 1 cut(s) 194
BbsI GAAGAC 3 cut(s) 258, 561, 617
Bbv12I GWGCWC 1 cut(s) 194
BbvI GCAGC 3 cut(s) 61, 123, 295
BccI CCATC 1 cut(s) 61
BcoDI GTCTC 2 cut(s) 97, 671
BfaI CTAG 1 cut(s) 155
BfmI CTRYAG 1 cut(s) 47
BfrI CTTAAG 1 cut(s) 488
BisI GCNGC 3 cut(s) 50, 137, 284
BlsI GCNGC 3 cut(s) 51, 138, 285
Bme18I GGWCC 2 cut(s) 70, 515
BmeT110I CYCGRG 2 cut(s) 53, 668
BmgT120I GGNCC 2 cut(s) 70, 515
BmsI GCATC 2 cut(s) 570, 619
BpiI GAAGAC 3 cut(s) 258, 561, 617
Bsa29I ATCGAT 1 cut(s) 115
Bsc4I CCNNNNNNNGG 2 cut(s) 524, 594
Bse1I ACTGG 2 cut(s) 201, 475
Bse3DI GCAATG 1 cut(s) 501
BseCI ATCGAT 1 cut(s) 115
BseGI GGATG 1 cut(s) 634
BseLI CCNNNNNNNGG 2 cut(s) 524, 594
BseMI GCAATG 1 cut(s) 501
BseNI ACTGG 2 cut(s) 201, 475
BseRI GAGGAG 1 cut(s) 71
BseSI GKGCMC 1 cut(s) 194
BseXI GCAGC 3 cut(s) 61, 123, 295
BsgI GTGCAG 1 cut(s) 567
Bsh1285I CGRYCG 1 cut(s) 115
BshFI GGCC 1 cut(s) 151
BshVI ATCGAT 1 cut(s) 115
BsiEI CGRYCG 1 cut(s) 115
BsiHKAI GWGCWC 1 cut(s) 194
BsiHKCI CYCGRG 2 cut(s) 53, 668
BslFI GGGAC 1 cut(s) 468
BslI CCNNNNNNNGG 2 cut(s) 524, 594
BsmAI GTCTC 2 cut(s) 97, 671
BsmBI CGTCTC 1 cut(s) 97
BsmFI GGGAC 1 cut(s) 468
BsnI GGCC 1 cut(s) 151
BsoBI CYCGRG 2 cut(s) 53, 668
Bsp1286I GDGCHC 1 cut(s) 194
Bsp143I GATC 4 cut(s) 112, 199, 351, 399
BspACI CCGC 1 cut(s) 595
BspANI GGCC 1 cut(s) 151
BspDI ATCGAT 1 cut(s) 115
BspHI TCATGA 1 cut(s) 447
BspMAI CTGCAG 1 cut(s) 51
BspPI GGATC 2 cut(s) 207, 407
BspTI CTTAAG 1 cut(s) 488
BsrDI GCAATG 1 cut(s) 501
BsrI ACTGG 2 cut(s) 201, 475
BssMI GATC 4 cut(s) 112, 199, 351, 399
BstAFI CTTAAG 1 cut(s) 488
BstC8I GCNNGC 1 cut(s) 176
BstF5I GGATG 1 cut(s) 634
BstKTI GATC 4 cut(s) 115, 202, 354, 402
BstMAI GTCTC 2 cut(s) 97, 671
BstMBI GATC 4 cut(s) 112, 199, 351, 399
BstMCI CGRYCG 1 cut(s) 115
BstMWI GCNNNNNNNGC 3 cut(s) 180, 189, 314
BstSFI CTRYAG 1 cut(s) 47
BstSLI GKGCMC 1 cut(s) 194
BstV1I GCAGC 3 cut(s) 61, 123, 295
BstV2I GAAGAC 3 cut(s) 258, 561, 617
BstX2I RGATCY 1 cut(s) 199
BstXI CCANNNNNNTGG 1 cut(s) 312
BstYI RGATCY 1 cut(s) 199
Bsu15I ATCGAT 1 cut(s) 115
BsuRI GGCC 1 cut(s) 151
BsuTUI ATCGAT 1 cut(s) 115
BtgZI GCGATG 1 cut(s) 547
BtsCI GGATG 1 cut(s) 634
BtsI GCAGTG 1 cut(s) 518
BtsIMutI CAGTG 2 cut(s) 194, 518
Cac8I GCNNGC 1 cut(s) 176
CciI TCATGA 1 cut(s) 447
Cfr13I GGNCC 2 cut(s) 70, 515
ClaI ATCGAT 1 cut(s) 115
CspCI CAANNNNNGTGG 2 cut(s) 531, 566
CviAII CATG 4 cut(s) 179, 347, 448, 680
CviJI RGCY 7 cut(s) 52, 62, 151, 242, 286, 474, 674
CviKI_1 RGCY 7 cut(s) 52, 62, 151, 242, 286, 474, 674
DpnI GATC 4 cut(s) 114, 201, 353, 401
DpnII GATC 4 cut(s) 112, 199, 351, 399
DraI TTTAAA 1 cut(s) 229
DraIII CACNNNGTG 2 cut(s) 574, 590
Eco47I GGWCC 2 cut(s) 70, 515
Eco57I CTGAAG 1 cut(s) 264
Eco88I CYCGRG 2 cut(s) 53, 668
Esp3I CGTCTC 1 cut(s) 97
FaeI CATG 4 cut(s) 182, 350, 451, 683
FaiI YATR 7 cut(s) 180, 218, 257, 348, 392, 449, 681
FaqI GGGAC 1 cut(s) 468
FatI CATG 4 cut(s) 178, 346, 447, 679
Fnu4HI GCNGC 3 cut(s) 50, 137, 284
FokI GGATG 1 cut(s) 641
Fsp4HI GCNGC 3 cut(s) 50, 137, 284
FspBI CTAG 1 cut(s) 155
GluI GCNGC 3 cut(s) 50, 137, 284
HaeIII GGCC 1 cut(s) 151
Hin1II CATG 4 cut(s) 182, 350, 451, 683
HinfI GANTC 6 cut(s) 117, 161, 367, 430, 613, 664
Hpy166II GTNNAC 2 cut(s) 192, 518
Hpy188I TCNGA 3 cut(s) 7, 66, 686
Hpy188III TCNNGA 5 cut(s) 294, 358, 371, 448, 668
Hpy8I GTNNAC 2 cut(s) 192, 518
HpyAV CCTTC 4 cut(s) 214, 368, 445, 619
HpyCH4IV ACGT 1 cut(s) 310
HpyF10VI GCNNNNNNNGC 3 cut(s) 180, 189, 314
HpySE526I ACGT 1 cut(s) 310
Hsp92II CATG 4 cut(s) 182, 350, 451, 683
Kzo9I GATC 4 cut(s) 112, 199, 351, 399
LmnI GCTCC 1 cut(s) 409
LpnPI CCDG 6 cut(s) 182, 188, 314, 318, 456, 594
Lsp1109I GCAGC 3 cut(s) 61, 123, 295
LweI GCATC 2 cut(s) 570, 619
MaeI CTAG 1 cut(s) 155
MaeII ACGT 1 cut(s) 310
MalI GATC 4 cut(s) 114, 201, 353, 401
MboI GATC 4 cut(s) 112, 199, 351, 399
MboII GAAGA 5 cut(s) 20, 257, 263, 566, 622
MfeI CAATTG 1 cut(s) 270
MflI RGATCY 1 cut(s) 199
MhlI GDGCHC 1 cut(s) 194
MluCI AATT 4 cut(s) 81, 258, 270, 413
MlyI GAGTC 3 cut(s) 170, 607, 673
MnlI CCTC 8 cut(s) 49, 52, 162, 420, 588, 591, 627, 664
MseI TTAA 6 cut(s) 170, 207, 228, 489, 603, 639
MspCI CTTAAG 1 cut(s) 488
MunI CAATTG 1 cut(s) 270
MwoI GCNNNNNNNGC 3 cut(s) 180, 189, 314
NdeII GATC 4 cut(s) 112, 199, 351, 399
NlaIII CATG 4 cut(s) 182, 350, 451, 683
PaeR7I CTCGAG 2 cut(s) 53, 668
PagI TCATGA 1 cut(s) 447
PfeI GAWTC 3 cut(s) 117, 367, 430
PkrI GCNGC 3 cut(s) 51, 138, 285
Ple19I CGATCG 1 cut(s) 115
PleI GAGTC 3 cut(s) 169, 607, 672
PpsI GAGTC 3 cut(s) 169, 607, 672
PspPI GGNCC 2 cut(s) 70, 515
PspXI VCTCGAGB 1 cut(s) 53
PstI CTGCAG 1 cut(s) 51
PsuI RGATCY 1 cut(s) 199
PvuI CGATCG 1 cut(s) 115
SaqAI TTAA 6 cut(s) 170, 207, 228, 489, 603, 639
SatI GCNGC 3 cut(s) 50, 137, 284
Sau3AI GATC 4 cut(s) 112, 199, 351, 399
Sau96I GGNCC 2 cut(s) 70, 515
SchI GAGTC 3 cut(s) 170, 607, 673
SduI GDGCHC 1 cut(s) 194
SetI ASST 4 cut(s) 54, 225, 288, 313
SfaNI GCATC 2 cut(s) 570, 619
SfcI CTRYAG 1 cut(s) 47
Sfr274I CTCGAG 2 cut(s) 53, 668
SinI GGWCC 2 cut(s) 70, 515
SlaI CTCGAG 2 cut(s) 53, 668
SmlI CTYRAG 3 cut(s) 53, 488, 668
SmoI CTYRAG 3 cut(s) 53, 488, 668
Sse9I AATT 4 cut(s) 81, 258, 270, 413
SsiI CCGC 1 cut(s) 595
SspMI CTAG 1 cut(s) 155
TaiI ACGT 1 cut(s) 313
TaqI TCGA 3 cut(s) 54, 115, 669
TasI AATT 4 cut(s) 81, 258, 270, 413
TfiI GAWTC 3 cut(s) 117, 367, 430
Tru1I TTAA 6 cut(s) 170, 207, 228, 489, 603, 639
Tru9I TTAA 6 cut(s) 170, 207, 228, 489, 603, 639
TscAI CASTG 2 cut(s) 201, 525
TseI GCWGC 3 cut(s) 49, 136, 283
TspDTI ATGAA 6 cut(s) 93, 233, 264, 464, 638, 668
TspGWI ACGGA 1 cut(s) 439
TspRI CASTG 2 cut(s) 201, 525
Vha464I CTTAAG 1 cut(s) 488
VneI GTGCAC 1 cut(s) 190
VpaK11BI GGWCC 2 cut(s) 70, 515
XhoI CTCGAG 2 cut(s) 53, 668
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.