FvH4_4g01161

Retrotransposon gag protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0000128
Physical Location & Seq
Reverse (-)
1089093 .. 1090770
1678 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g01161.t1

Sequence Viewer

Length: 1158 bp
ATGGCTTCAAAGATGGTGCAAATCAAATCGAAAAACAAGACCCGCAAGGTAACTACTCTGAAAAGCCGAAGAAACCTTAGCAGTCATAGTGAGTCATTTCAACTCACAACATTCGACCTTCATTCCTCAAAGCAGTTTCAACCGATCGACGCTTGGACAACAAAGGGGGCAAACCTCATGAAGCAAAGACGTCCAACATCGTCAGGTAACTCAAGGAAACATTCTCCTTCGCCCACAACCAACGTTGATTCGAAGATAGGTCCAAACTTGGAATTGCCTCTTCACAATCAAATTGAAGCGATTCTAGAAGACGACTCTTGCGCCATGCAAGTCATGGTGATAGAAGTGATTAACGTGGAAAAACAAGCGGCCCAAATAGCCCAGTTGACTGAAGCGGCGAAGAAGCTCCAAAAGACCATTGAAGAGAAGGATGTAGAAATTGCATCGCTCATGGAGAAGCTAGAAGTTCACCATGACAATGATTCGGAGAATAACTTGCATGGCGATAAAAAAGACACGTCTGGTGGATCATCTTCCGAGCAAAAGGGAGAATCAAATTCCATCCTAGCTTCATTGTCAGTTCAACAGCTTCAAGACATGATTGCTAAGACAATCAAAGCTCAATGTGGTGGTTCCTCTCGAGATACACTGACGTATTCCAAGCCTTACACCAAGCAGCTAGACAATTTGAGAATGCCAACTGGTTACCAACCTCCCAAGTTTCAACAATTTGATGGAAAAGGTAACCCCAAACAACACATCGCACATTTCATCGAAACATGCAACAGCGCTGGCACCGATGGTGATCATCTTATGAAGCAATTTGTTCGCTCACTCCGAGATTCCGATGTTGCTGATATGTTGGAAAACTTGCTTGAAAAAGAAGTAATCAAATTGCCAGACTGCAAGCGTCCAGAAGAGATACATCACGTCAATGATCCAAAATATTGCAAGTACCACCGTGTCATCGGTCATCCGGTGGAGAAGTGCTTCGTCTTGAAAGATCTCATCATGAAGCTCGCACAACAAGGAAAGATATGTTTAGACGTTGAAGATGACGTGGCTCAGTCAAATCATGCTACCTGCATCTATGAACAACTTAAAGTAGTGTCATCGATGTCTTTGCTGGGGGGATGCAACTTGCCGAGCCTCATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotrans_gag

Protein Analysis

386

Amino Acids

43.04

Weight (kDa)

7.62

Isoelectric Point (pI)

51.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 193
Acc36I ACCTGC 1 cut(s) 1091
AccB1I GGYRCC 1 cut(s) 794
AciI CCGC 3 cut(s) 43, 368, 395
AclI AACGTT 1 cut(s) 243
AclWI GGATC 2 cut(s) 535, 932
AcsI RAATTY 1 cut(s) 556
AcuI CTGAAG 1 cut(s) 411
AcyI GRCGYC 1 cut(s) 190
AfaI GTAC 1 cut(s) 956
AfeI AGCGCT 1 cut(s) 790
AflIII ACRYGT 1 cut(s) 516
AjiI CACGTC 3 cut(s) 519, 931, 1060
AluBI AGCT 7 cut(s) 406, 460, 569, 589, 620, 679, 1018
AluI AGCT 7 cut(s) 406, 460, 569, 589, 620, 679, 1018
AlwI GGATC 2 cut(s) 535, 932
Ama87I CYCGRG 1 cut(s) 639
Aor51HI AGCGCT 1 cut(s) 790
AoxI GGCC 1 cut(s) 369
ApeKI GCWGC 1 cut(s) 676
ApoI RAATTY 1 cut(s) 556
Asp700I GAANNNNTTC 2 cut(s) 300, 989
AspLEI GCGC 2 cut(s) 323, 791
AspS9I GGNCC 2 cut(s) 260, 370
AsuHPI GGTGA 3 cut(s) 349, 461, 815
AsuII TTCGAA 1 cut(s) 251
AvaI CYCGRG 1 cut(s) 639
AvaII GGWCC 1 cut(s) 260
BanI GGYRCC 1 cut(s) 794
BbsI GAAGAC 1 cut(s) 315
BbvI GCAGC 1 cut(s) 688
BccI CCATC 4 cut(s) 7, 569, 728, 794
BcgI CGANNNNNNTGC 4 cut(s) 809, 843, 1105, 1139
BclI TGATCA 1 cut(s) 805
BfaI CTAG 4 cut(s) 305, 461, 566, 680
BfoI RGCGCY 1 cut(s) 792
BfuAI ACCTGC 1 cut(s) 1091
BglII AGATCT 1 cut(s) 1003
BisI GCNGC 3 cut(s) 369, 396, 677
BlsI GCNGC 3 cut(s) 370, 397, 678
Bme18I GGWCC 1 cut(s) 260
BmeT110I CYCGRG 1 cut(s) 639
BmgBI CACGTC 3 cut(s) 519, 931, 1060
BmgT120I GGNCC 2 cut(s) 260, 370
BmiI GGNNCC 2 cut(s) 634, 796
BmrI ACTGGG 1 cut(s) 376
BmsI GCATC 3 cut(s) 452, 1095, 1124
BmuI ACTGGG 1 cut(s) 376
BpiI GAAGAC 1 cut(s) 315
Bpu10I CCTNAGC 1 cut(s) 77
Bpu14I TTCGAA 1 cut(s) 251
BpuEI CTTGAG 1 cut(s) 196
Bsa29I ATCGAT 1 cut(s) 1115
BsaBI GATNNNNATC 1 cut(s) 804
BsaHI GRCGYC 1 cut(s) 190
BsaWI WCCGGW 1 cut(s) 976
Bse1I ACTGG 2 cut(s) 382, 706
Bse8I GATNNNNATC 1 cut(s) 804
BseCI ATCGAT 1 cut(s) 1115
BseGI GGATG 4 cut(s) 436, 561, 973, 1139
BseJI GATNNNNATC 1 cut(s) 804
BseMII CTCAG 1 cut(s) 1079
BseNI ACTGG 2 cut(s) 382, 706
BseXI GCAGC 1 cut(s) 688
BseYI CCCAGC 1 cut(s) 1126
Bsh1285I CGRYCG 1 cut(s) 147
BshFI GGCC 1 cut(s) 371
BshNI GGYRCC 1 cut(s) 794
BshVI ATCGAT 1 cut(s) 1115
BsiEI CGRYCG 1 cut(s) 147
BsiHKCI CYCGRG 1 cut(s) 639
BsiSI CCGG 1 cut(s) 977
BsmI GAATGC 1 cut(s) 699
BsnI GGCC 1 cut(s) 371
BsoBI CYCGRG 1 cut(s) 639
Bsp119I TTCGAA 1 cut(s) 251
Bsp143I GATC 5 cut(s) 144, 527, 805, 937, 1003
BspACI CCGC 3 cut(s) 43, 368, 395
BspANI GGCC 1 cut(s) 371
BspCNI CTCAG 1 cut(s) 1078
BspDI ATCGAT 1 cut(s) 1115
BspHI TCATGA 2 cut(s) 177, 1011
BspLI GGNNCC 2 cut(s) 634, 796
BspMI ACCTGC 1 cut(s) 1091
BspPI GGATC 2 cut(s) 535, 932
BspT104I TTCGAA 1 cut(s) 251
BspT107I GGYRCC 1 cut(s) 794
BsrI ACTGG 2 cut(s) 382, 706
BssMI GATC 5 cut(s) 144, 527, 805, 937, 1003
BssNI GRCGYC 1 cut(s) 190
Bst4CI ACNGT 1 cut(s) 962
Bst6I CTCTTC 3 cut(s) 285, 417, 912
BstACI GRCGYC 1 cut(s) 190
BstBI TTCGAA 1 cut(s) 251
BstC8I GCNNGC 3 cut(s) 793, 908, 1020
BstDEI CTNAG 3 cut(s) 77, 606, 1065
BstEII GGTNACC 2 cut(s) 704, 743
BstF5I GGATG 4 cut(s) 436, 561, 973, 1139
BstH2I RGCGCY 1 cut(s) 792
BstHHI GCGC 2 cut(s) 323, 791
BstKTI GATC 5 cut(s) 147, 530, 808, 940, 1006
BstMBI GATC 5 cut(s) 144, 527, 805, 937, 1003
BstMCI CGRYCG 1 cut(s) 147
BstMWI GCNNNNNNNGC 1 cut(s) 377
BstNSI RCATGY 1 cut(s) 783
BstPI GGTNACC 2 cut(s) 704, 743
BstV1I GCAGC 1 cut(s) 688
BstV2I GAAGAC 1 cut(s) 315
BstX2I RGATCY 1 cut(s) 1003
BstYI RGATCY 1 cut(s) 1003
Bsu15I ATCGAT 1 cut(s) 1115
BsuRI GGCC 1 cut(s) 371
BsuTUI ATCGAT 1 cut(s) 1115
BtgZI GCGATG 2 cut(s) 429, 745
BtrI CACGTC 3 cut(s) 519, 931, 1060
BtsCI GGATG 4 cut(s) 436, 561, 973, 1139
BtsIMutI CAGTG 1 cut(s) 647
BveI ACCTGC 1 cut(s) 1091
Cac8I GCNNGC 3 cut(s) 793, 908, 1020
CciI TCATGA 2 cut(s) 177, 1011
CfoI GCGC 2 cut(s) 323, 791
Cfr13I GGNCC 2 cut(s) 260, 370
ClaI ATCGAT 1 cut(s) 1115
CseI GACGC 2 cut(s) 158, 899
Csp6I GTAC 1 cut(s) 955
CviQI GTAC 1 cut(s) 955
DdeI CTNAG 3 cut(s) 77, 606, 1065
DpnI GATC 5 cut(s) 146, 529, 807, 939, 1005
DpnII GATC 5 cut(s) 144, 527, 805, 937, 1003
Eam1104I CTCTTC 3 cut(s) 285, 417, 912
EarI CTCTTC 3 cut(s) 285, 417, 912
Eco47I GGWCC 1 cut(s) 260
Eco47III AGCGCT 1 cut(s) 790
Eco57I CTGAAG 1 cut(s) 411
Eco88I CYCGRG 1 cut(s) 639
Eco91I GGTNACC 2 cut(s) 704, 743
EcoO65I GGTNACC 2 cut(s) 704, 743
FauI CCCGC 1 cut(s) 50
FbaI TGATCA 1 cut(s) 805
Fnu4HI GCNGC 3 cut(s) 369, 396, 677
FokI GGATG 4 cut(s) 443, 548, 960, 1146
Fsp4HI GCNGC 3 cut(s) 369, 396, 677
FspBI CTAG 4 cut(s) 305, 461, 566, 680
GlaI GCGC 2 cut(s) 322, 790
GluI GCNGC 3 cut(s) 369, 396, 677
GsaI CCCAGC 1 cut(s) 1130
HaeII RGCGCY 1 cut(s) 792
HaeIII GGCC 1 cut(s) 371
HapII CCGG 1 cut(s) 977
HgaI GACGC 2 cut(s) 158, 899
HhaI GCGC 2 cut(s) 323, 791
Hin1I GRCGYC 1 cut(s) 190
Hin6I GCGC 2 cut(s) 321, 789
HinP1I GCGC 2 cut(s) 321, 789
HincII GTYRAC 1 cut(s) 387
HindII GTYRAC 1 cut(s) 387
HinfI GANTC 7 cut(s) 92, 248, 301, 314, 482, 551, 842
HpaII CCGG 1 cut(s) 977
HphI GGTGA 3 cut(s) 349, 461, 815
Hpy166II GTNNAC 2 cut(s) 387, 469
Hpy188I TCNGA 5 cut(s) 60, 487, 538, 839, 847
Hpy188III TCNNGA 8 cut(s) 178, 305, 593, 639, 641, 914, 997, 1012
Hpy8I GTNNAC 2 cut(s) 387, 469
Hpy99I CGWCG 1 cut(s) 152
HpyAV CCTTC 3 cut(s) 128, 237, 421
HpyCH4III ACNGT 1 cut(s) 962
HpyCH4IV ACGT 8 cut(s) 190, 243, 354, 518, 653, 930, 1047, 1059
HpyCH4V TGCA 9 cut(s) 19, 328, 443, 499, 783, 906, 951, 1086, 1137
HpyF10VI GCNNNNNNNGC 1 cut(s) 377
HpyF3I CTNAG 3 cut(s) 77, 606, 1065
HpySE526I ACGT 8 cut(s) 190, 243, 354, 518, 653, 930, 1047, 1059
Hsp92I GRCGYC 1 cut(s) 190
HspAI GCGC 2 cut(s) 321, 789
Ksp22I TGATCA 1 cut(s) 805
Kzo9I GATC 5 cut(s) 144, 527, 805, 937, 1003
LmnI GCTCC 1 cut(s) 411
Lsp1109I GCAGC 1 cut(s) 688
LweI GCATC 3 cut(s) 452, 1095, 1124
MaeI CTAG 4 cut(s) 305, 461, 566, 680
MaeII ACGT 8 cut(s) 190, 243, 354, 518, 653, 930, 1047, 1059
MaeIII GTNAC 4 cut(s) 49, 206, 704, 743
MalI GATC 5 cut(s) 146, 529, 807, 939, 1005
MboI GATC 5 cut(s) 144, 527, 805, 937, 1003
MboII GAAGA 9 cut(s) 81, 265, 272, 320, 412, 434, 525, 929, 1064
MflI RGATCY 1 cut(s) 1003
MluCI AATT 8 cut(s) 272, 291, 438, 556, 685, 728, 821, 893
MlyI GAGTC 2 cut(s) 101, 308
MmeI TCCRAC 2 cut(s) 218, 843
MnlI CCTC 5 cut(s) 136, 185, 288, 646, 723
MroXI GAANNNNTTC 2 cut(s) 300, 989
MseI TTAA 2 cut(s) 351, 1101
MslI CAYNNNNRTG 2 cut(s) 477, 933
MspI CCGG 1 cut(s) 977
Mva1269I GAATGC 1 cut(s) 699
MwoI GCNNNNNNNGC 1 cut(s) 377
NdeII GATC 5 cut(s) 144, 527, 805, 937, 1003
NlaIV GGNNCC 2 cut(s) 634, 796
NspI RCATGY 1 cut(s) 783
NspV TTCGAA 1 cut(s) 251
PaeR7I CTCGAG 1 cut(s) 639
PagI TCATGA 2 cut(s) 177, 1011
PcsI WCGNNNNNNNCGW 1 cut(s) 835
PctI GAATGC 1 cut(s) 699
PdmI GAANNNNTTC 2 cut(s) 300, 989
PfeI GAWTC 5 cut(s) 248, 301, 482, 551, 842
PkrI GCNGC 3 cut(s) 370, 397, 678
Ple19I CGATCG 1 cut(s) 147
PleI GAGTC 2 cut(s) 100, 308
PpsI GAGTC 2 cut(s) 100, 308
Psp1406I AACGTT 1 cut(s) 243
PspEI GGTNACC 2 cut(s) 704, 743
PspFI CCCAGC 1 cut(s) 1126
PspN4I GGNNCC 2 cut(s) 634, 796
PspPI GGNCC 2 cut(s) 260, 370
PsuI RGATCY 1 cut(s) 1003
PvuI CGATCG 1 cut(s) 147
RsaI GTAC 1 cut(s) 956
RsaNI GTAC 1 cut(s) 955
RseI CAYNNNNRTG 2 cut(s) 477, 933
SaqAI TTAA 2 cut(s) 351, 1101
SatI GCNGC 3 cut(s) 369, 396, 677
Sau3AI GATC 5 cut(s) 144, 527, 805, 937, 1003
Sau96I GGNCC 2 cut(s) 260, 370
SchI GAGTC 2 cut(s) 101, 308
SfaNI GCATC 3 cut(s) 452, 1095, 1124
Sfr274I CTCGAG 1 cut(s) 639
SfuI TTCGAA 1 cut(s) 251
SinI GGWCC 1 cut(s) 260
SlaI CTCGAG 1 cut(s) 639
SmiMI CAYNNNNRTG 2 cut(s) 477, 933
SmlI CTYRAG 2 cut(s) 211, 639
SmoI CTYRAG 2 cut(s) 211, 639
Sse9I AATT 8 cut(s) 272, 291, 438, 556, 685, 728, 821, 893
SsiI CCGC 3 cut(s) 43, 368, 395
SspI AATATT 1 cut(s) 947
SspMI CTAG 4 cut(s) 305, 461, 566, 680
TaaI ACNGT 1 cut(s) 962
TaiI ACGT 8 cut(s) 193, 246, 357, 521, 656, 933, 1050, 1062
TaqI TCGA 7 cut(s) 29, 114, 147, 251, 640, 774, 1115
TaqII GACCGA 1 cut(s) 959
TasI AATT 8 cut(s) 272, 291, 438, 556, 685, 728, 821, 893
TauI GCSGC 2 cut(s) 371, 398
TfiI GAWTC 5 cut(s) 248, 301, 482, 551, 842
Tru1I TTAA 2 cut(s) 351, 1101
Tru9I TTAA 2 cut(s) 351, 1101
TscAI CASTG 1 cut(s) 654
TseI GCWGC 1 cut(s) 676
TspDTI ATGAA 7 cut(s) 110, 194, 561, 760, 830, 1028, 1107
TspRI CASTG 1 cut(s) 654
VpaK11BI GGWCC 1 cut(s) 260
XapI RAATTY 1 cut(s) 556
XbaI TCTAGA 1 cut(s) 304
XceI RCATGY 1 cut(s) 783
XcmI CCANNNNNNNNNTGG 1 cut(s) 331
XhoI CTCGAG 1 cut(s) 639
XmnI GAANNNNTTC 2 cut(s) 300, 989
XspI CTAG 4 cut(s) 305, 461, 566, 680
ZraI GACGTC 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.