Rmu_sc0007961.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007961.1
OG0000128
Physical Location & Seq
Reverse (-)
4869 .. 5405
537 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007961.1_g000003.1.cds

Sequence Viewer

Length: 537 bp
atgaaactcgccaaacaagggacgatacaactagatatcgatgatgtggtagaagccaattgcacctccattgtgttcgaaacatttgaactggttgtattgtccttatcaccaatagagcgattatatcaatcacagaggctgcctcatgaggaggtgaggacagaggtagccaagatggttaggcaaagagaaccgaggccagtcgttgccctgaagaatgagaccaatagcgaagatgaaggatggacgcttgtcactagaagaaaggcacgtaaactggcatcactaagatctaaagtcgctcaagtggaagcgagacaacaaagaatgagtcttcaacctcccaaaagaagtcaaacaaaagaagtgcccaagaggagaactaacattttcgctcgaccaatgtctaccccaaggatattcaccagggatagtcgaggaggccatgacaaggataaaggctttctcaagaattccatgaggcaagaggaaatgggcatcgttcatatatatgacaattggttacgaagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

178

Amino Acids

20.73

Weight (kDa)

10.15

Isoelectric Point (pI)

71.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 410
AcsI RAATTY 1 cut(s) 475
AcuI CTGAAG 1 cut(s) 236
AfiI CCNNNNNNNGG 2 cut(s) 18, 454
AgsI TTSAA 2 cut(s) 89, 341
AjnI CCWGG 1 cut(s) 428
Alw26I GTCTC 2 cut(s) 218, 313
AlwNI CAGNNNCTG 1 cut(s) 142
AoxI GGCC 2 cut(s) 200, 445
ApeKI GCWGC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 475
ArsI GACNNNNNNTTYG 2 cut(s) 319, 351
AsuHPI GGTGA 3 cut(s) 102, 169, 418
AsuII TTCGAA 1 cut(s) 78
BaeGI GKGCMC 1 cut(s) 375
BbsI GAAGAC 1 cut(s) 329
BbvI GCAGC 1 cut(s) 129
BccI CCATC 2 cut(s) 172, 240
BciT130I CCWGG 1 cut(s) 430
BcoDI GTCTC 2 cut(s) 218, 313
BfaI CTAG 2 cut(s) 32, 261
BglII AGATCT 1 cut(s) 293
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 430
BmrFI CCNGG 1 cut(s) 430
BmsI GCATC 2 cut(s) 293, 510
BoxI GACNNNNGTC 2 cut(s) 254, 406
BpiI GAAGAC 1 cut(s) 329
BplI GAGNNNNNCTC 2 cut(s) 130, 162
Bpu14I TTCGAA 1 cut(s) 78
BpuEI CTTGAG 2 cut(s) 291, 455
Bsa29I ATCGAT 1 cut(s) 39
BsaAI YACGTR 1 cut(s) 275
BsaI GGTCTC 1 cut(s) 218
BsaJI CCNNGG 3 cut(s) 197, 416, 429
Bsc4I CCNNNNNNNGG 2 cut(s) 18, 454
Bse1I ACTGG 3 cut(s) 96, 203, 285
BseBI CCWGG 1 cut(s) 430
BseCI ATCGAT 1 cut(s) 39
BseDI CCNNGG 3 cut(s) 197, 416, 429
BseGI GGATG 1 cut(s) 251
BseLI CCNNNNNNNGG 2 cut(s) 18, 454
BseNI ACTGG 3 cut(s) 96, 203, 285
BseRI GAGGAG 3 cut(s) 167, 394, 456
BseSI GKGCMC 1 cut(s) 375
BseXI GCAGC 1 cut(s) 129
BshFI GGCC 2 cut(s) 202, 447
BshVI ATCGAT 1 cut(s) 39
BslFI GGGAC 1 cut(s) 34
BslI CCNNNNNNNGG 2 cut(s) 18, 454
BsmAI GTCTC 2 cut(s) 218, 313
BsmFI GGGAC 1 cut(s) 34
BsnI GGCC 2 cut(s) 202, 447
Bso31I GGTCTC 1 cut(s) 218
Bsp119I TTCGAA 1 cut(s) 78
Bsp1286I GDGCHC 1 cut(s) 375
Bsp143I GATC 1 cut(s) 293
BspANI GGCC 2 cut(s) 202, 447
BspDI ATCGAT 1 cut(s) 39
BspHI TCATGA 1 cut(s) 148
BspT104I TTCGAA 1 cut(s) 78
BspTNI GGTCTC 1 cut(s) 218
BsrI ACTGG 3 cut(s) 96, 203, 285
BssECI CCNNGG 3 cut(s) 197, 416, 429
BssMI GATC 1 cut(s) 293
BssT1I CCWWGG 1 cut(s) 416
Bst2UI CCWGG 1 cut(s) 430
BstBAI YACGTR 1 cut(s) 275
BstBI TTCGAA 1 cut(s) 78
BstDEI CTNAG 1 cut(s) 290
BstF5I GGATG 1 cut(s) 251
BstKTI GATC 1 cut(s) 296
BstMAI GTCTC 2 cut(s) 218, 313
BstMBI GATC 1 cut(s) 293
BstNI CCWGG 1 cut(s) 430
BstPAI GACNNNNGTC 2 cut(s) 254, 406
BstSCI CCNGG 1 cut(s) 428
BstSLI GKGCMC 1 cut(s) 375
BstV1I GCAGC 1 cut(s) 129
BstV2I GAAGAC 1 cut(s) 329
BstX2I RGATCY 1 cut(s) 293
BstYI RGATCY 1 cut(s) 293
Bsu15I ATCGAT 1 cut(s) 39
BsuRI GGCC 2 cut(s) 202, 447
BsuTUI ATCGAT 1 cut(s) 39
BtsCI GGATG 1 cut(s) 251
CaiI CAGNNNCTG 1 cut(s) 142
CciI TCATGA 1 cut(s) 148
ClaI ATCGAT 1 cut(s) 39
CseI GACGC 1 cut(s) 259
CviAII CATG 3 cut(s) 149, 449, 481
CviJI RGCY 6 cut(s) 56, 142, 173, 202, 447, 465
CviKI_1 RGCY 6 cut(s) 56, 142, 173, 202, 447, 465
DdeI CTNAG 1 cut(s) 290
DpnI GATC 1 cut(s) 295
DpnII GATC 1 cut(s) 293
Eco130I CCWWGG 1 cut(s) 416
Eco31I GGTCTC 1 cut(s) 218
Eco32I GATATC 1 cut(s) 37
Eco57I CTGAAG 1 cut(s) 236
EcoRI GAATTC 1 cut(s) 475
EcoRII CCWGG 1 cut(s) 428
EcoRV GATATC 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 416
ErhI CCWWGG 1 cut(s) 416
FaeI CATG 3 cut(s) 152, 452, 484
FaiI YATR 8 cut(s) 127, 150, 450, 482, 510, 512, 514, 516
FaqI GGGAC 1 cut(s) 34
FatI CATG 3 cut(s) 148, 448, 480
FblI GTMKAC 1 cut(s) 410
Fnu4HI GCNGC 1 cut(s) 143
FokI GGATG 1 cut(s) 258
Fsp4HI GCNGC 1 cut(s) 143
FspBI CTAG 2 cut(s) 32, 261
GluI GCNGC 1 cut(s) 143
HaeIII GGCC 2 cut(s) 202, 447
HgaI GACGC 1 cut(s) 259
Hin1II CATG 3 cut(s) 152, 452, 484
HinfI GANTC 1 cut(s) 334
HphI GGTGA 3 cut(s) 102, 169, 418
Hpy166II GTNNAC 2 cut(s) 278, 411
Hpy188III TCNNGA 2 cut(s) 149, 472
Hpy8I GTNNAC 2 cut(s) 278, 411
HpyAV CCTTC 1 cut(s) 236
HpyCH4IV ACGT 1 cut(s) 274
HpyCH4V TGCA 1 cut(s) 63
HpyF3I CTNAG 1 cut(s) 290
HpySE526I ACGT 1 cut(s) 274
Hsp92II CATG 3 cut(s) 152, 452, 484
Kzo9I GATC 1 cut(s) 293
LpnPI CCDG 6 cut(s) 77, 216, 227, 266, 415, 442
Lsp1109I GCAGC 1 cut(s) 129
LweI GCATC 2 cut(s) 293, 510
MaeI CTAG 2 cut(s) 32, 261
MaeII ACGT 1 cut(s) 274
MaeIII GTNAC 2 cut(s) 256, 525
MalI GATC 1 cut(s) 295
MboI GATC 1 cut(s) 293
MboII GAAGA 4 cut(s) 229, 248, 276, 329
MfeI CAATTG 2 cut(s) 58, 520
MflI RGATCY 1 cut(s) 293
MhlI GDGCHC 1 cut(s) 375
MluCI AATT 3 cut(s) 58, 475, 520
MlyI GAGTC 1 cut(s) 343
MseI TTAA 1 cut(s) 535
MslI CAYNNNNRTG 1 cut(s) 513
MspR9I CCNGG 1 cut(s) 430
MunI CAATTG 2 cut(s) 58, 520
MvaI CCWGG 1 cut(s) 430
NdeII GATC 1 cut(s) 293
NlaIII CATG 3 cut(s) 152, 452, 484
NmuCI GTSAC 1 cut(s) 256
NspV TTCGAA 1 cut(s) 78
PagI TCATGA 1 cut(s) 148
PkrI GCNGC 1 cut(s) 144
PleI GAGTC 1 cut(s) 342
PpsI GAGTC 1 cut(s) 342
Ppu21I YACGTR 1 cut(s) 275
PshAI GACNNNNGTC 2 cut(s) 254, 406
Psp6I CCWGG 1 cut(s) 428
PspGI CCWGG 1 cut(s) 428
PstNI CAGNNNCTG 1 cut(s) 142
PsuI RGATCY 1 cut(s) 293
RseI CAYNNNNRTG 1 cut(s) 513
SaqAI TTAA 1 cut(s) 535
SatI GCNGC 1 cut(s) 143
Sau3AI GATC 1 cut(s) 293
SchI GAGTC 1 cut(s) 343
ScrFI CCNGG 1 cut(s) 430
SduI GDGCHC 1 cut(s) 375
SetI ASST 5 cut(s) 68, 159, 171, 277, 346
SfaNI GCATC 2 cut(s) 293, 510
SfuI TTCGAA 1 cut(s) 78
SmiMI CAYNNNNRTG 1 cut(s) 513
SmlI CTYRAG 2 cut(s) 306, 470
SmoI CTYRAG 2 cut(s) 306, 470
Sse9I AATT 3 cut(s) 58, 475, 520
SspMI CTAG 2 cut(s) 32, 261
StyD4I CCNGG 1 cut(s) 428
StyI CCWWGG 1 cut(s) 416
TaiI ACGT 1 cut(s) 277
TaqI TCGA 4 cut(s) 39, 78, 400, 439
TasI AATT 3 cut(s) 58, 475, 520
Tru1I TTAA 1 cut(s) 535
Tru9I TTAA 1 cut(s) 535
TseFI GTSAC 1 cut(s) 256
TseI GCWGC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 256
TspDTI ATGAA 3 cut(s) 17, 255, 497
XapI RAATTY 1 cut(s) 475
XmiI GTMKAC 1 cut(s) 410
XspI CTAG 2 cut(s) 32, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.