Rmu_co8282359.1_g000001

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8282359.1
OG0000128
Physical Location & Seq
Forward (+)
135 .. 851
717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8282359.1_g000001.1.cds

Sequence Viewer

Length: 717 bp
atgcagagagcattcttggtgcagtttgttagttccaagaaaaaggtctcaatcattgacttggctgatgtaagacaaaaggtgggggtaaacaccaatgactttatcacaaggtggagaagcttgaacgtccaatgccctgagaagctgactgaacagtctgccgttcaaatgtgcaccaacaacttgcttccggatattgagacatttcttggcaccgtagagcctcaaacttttgatgcattggtttcaaaggcaagcaatgaggaaagacagatagctcgccagaagactctaactccaaaggttcagactgcggaaaagaaaaatgaccccaagaaaccaacagtgaagaagggagagtcaatggccaccttcatcaaaacagaaaagaacagtgtgggcagcagtaatcgaggaagggatgatagaccgcgggggctcacatggaaagaaagaagacaggtcaagtattcatttgatgacgatgatgtagactcgatctttgatgaacttgcagcgaaagccataaaactctcaggactgaaactccctgctgaaatgaacaggaccaacgaccccaggtattgcaggtactatcgcttggtcagtcacatgctaaaaggctgctacatccttaaagatttaattcaagagatgattaataatcatgaaatagagattgattcatctccaaacaaaactgcatatgcaaat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 Retrotrans_gag rve

Protein Analysis

239

Amino Acids

27.35

Weight (kDa)

9.24

Isoelectric Point (pI)

37.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 157
Acc36I ACCTGC 1 cut(s) 582
AccB1I GGYRCC 1 cut(s) 215
AccI GTMKAC 1 cut(s) 495
AccII CGCG 1 cut(s) 436
AccIII TCCGGA 1 cut(s) 193
AciI CCGC 3 cut(s) 317, 434, 436
AcoI YGGCCR 1 cut(s) 369
AdeI CACNNNGTG 1 cut(s) 114
AfaI GTAC 1 cut(s) 596
AgsI TTSAA 4 cut(s) 127, 170, 252, 653
AjnI CCWGG 1 cut(s) 581
AluBI AGCT 3 cut(s) 123, 148, 281
AluI AGCT 3 cut(s) 123, 148, 281
Alw21I GWGCWC 1 cut(s) 179
Alw26I GTCTC 2 cut(s) 52, 197
Alw44I GTGCAC 1 cut(s) 175
Aor13HI TCCGGA 1 cut(s) 193
AoxI GGCC 1 cut(s) 369
ApaLI GTGCAC 1 cut(s) 175
ApeKI GCWGC 3 cut(s) 405, 518, 627
ArsI GACNNNNNNTTYG 2 cut(s) 488, 520
AseI ATTAAT 1 cut(s) 663
AspS9I GGNCC 1 cut(s) 570
AvaII GGWCC 1 cut(s) 570
BaeGI GKGCMC 1 cut(s) 179
BalI TGGCCA 1 cut(s) 371
BanI GGYRCC 1 cut(s) 215
BanII GRGCYC 1 cut(s) 444
BbsI GAAGAC 2 cut(s) 296, 466
Bbv12I GWGCWC 1 cut(s) 179
BbvI GCAGC 3 cut(s) 417, 530, 614
BceAI ACGGC 1 cut(s) 149
BciT130I CCWGG 1 cut(s) 583
BcoDI GTCTC 2 cut(s) 52, 197
BfuAI ACCTGC 1 cut(s) 582
BisI GCNGC 3 cut(s) 406, 519, 628
BlsI GCNGC 3 cut(s) 407, 520, 629
Bme1390I CCNGG 1 cut(s) 583
Bme18I GGWCC 1 cut(s) 570
BmgT120I GGNCC 1 cut(s) 570
BmiI GGNNCC 1 cut(s) 217
BmrFI CCNGG 1 cut(s) 583
BmsI GCATC 1 cut(s) 229
BpiI GAAGAC 2 cut(s) 296, 466
BsaI GGTCTC 1 cut(s) 52
BsaJI CCNNGG 2 cut(s) 434, 581
BsaWI WCCGGW 1 cut(s) 193
BsaXI ACNNNNNCTCC 4 cut(s) 283, 313, 534, 564
Bse3DI GCAATG 1 cut(s) 268
BseAI TCCGGA 1 cut(s) 193
BseBI CCWGG 1 cut(s) 583
BseDI CCNNGG 2 cut(s) 434, 581
BseGI GGATG 2 cut(s) 430, 633
BseMI GCAATG 1 cut(s) 268
BseMII CTCAG 2 cut(s) 132, 552
BseSI GKGCMC 1 cut(s) 179
BseXI GCAGC 3 cut(s) 417, 530, 614
BsgI GTGCAG 1 cut(s) 41
Bsh1236I CGCG 1 cut(s) 436
BshFI GGCC 1 cut(s) 371
BshNI GGYRCC 1 cut(s) 215
BsiHKAI GWGCWC 1 cut(s) 179
BsiSI CCGG 1 cut(s) 194
BsmAI GTCTC 2 cut(s) 52, 197
BsmI GAATGC 1 cut(s) 11
BsnI GGCC 1 cut(s) 371
Bso31I GGTCTC 1 cut(s) 52
Bsp1286I GDGCHC 2 cut(s) 179, 444
Bsp13I TCCGGA 1 cut(s) 193
Bsp143I GATC 1 cut(s) 501
BspACI CCGC 3 cut(s) 317, 434, 436
BspANI GGCC 1 cut(s) 371
BspCNI CTCAG 2 cut(s) 133, 551
BspEI TCCGGA 1 cut(s) 193
BspFNI CGCG 1 cut(s) 436
BspHI TCATGA 1 cut(s) 670
BspLI GGNNCC 1 cut(s) 217
BspMI ACCTGC 1 cut(s) 582
BspT107I GGYRCC 1 cut(s) 215
BspTNI GGTCTC 1 cut(s) 52
BsrDI GCAATG 1 cut(s) 268
BssECI CCNNGG 2 cut(s) 434, 581
BssMI GATC 1 cut(s) 501
Bst2UI CCWGG 1 cut(s) 583
Bst4CI ACNGT 4 cut(s) 159, 220, 349, 398
BstC8I GCNNGC 2 cut(s) 259, 283
BstDEI CTNAG 2 cut(s) 141, 538
BstDSI CCRYGG 1 cut(s) 434
BstF5I GGATG 2 cut(s) 430, 633
BstFNI CGCG 1 cut(s) 436
BstKTI GATC 1 cut(s) 504
BstMAI GTCTC 2 cut(s) 52, 197
BstMBI GATC 1 cut(s) 501
BstMWI GCNNNNNNNGC 1 cut(s) 524
BstNI CCWGG 1 cut(s) 583
BstNSI RCATGY 1 cut(s) 619
BstSCI CCNGG 1 cut(s) 581
BstSLI GKGCMC 1 cut(s) 179
BstUI CGCG 1 cut(s) 436
BstV1I GCAGC 3 cut(s) 417, 530, 614
BstV2I GAAGAC 2 cut(s) 296, 466
BsuRI GGCC 1 cut(s) 371
BtgI CCRYGG 1 cut(s) 434
BtsCI GGATG 2 cut(s) 430, 633
BtsIMutI CAGTG 2 cut(s) 354, 403
BveI ACCTGC 1 cut(s) 582
Cac8I GCNNGC 2 cut(s) 259, 283
CciI TCATGA 1 cut(s) 670
Cfr13I GGNCC 1 cut(s) 570
Cfr42I CCGCGG 1 cut(s) 437
Csp6I GTAC 1 cut(s) 595
CviAII CATG 3 cut(s) 447, 616, 671
CviJI RGCY 9 cut(s) 65, 123, 148, 226, 281, 371, 442, 527, 627
CviKI_1 RGCY 9 cut(s) 65, 123, 148, 226, 281, 371, 442, 527, 627
CviQI GTAC 1 cut(s) 595
DdeI CTNAG 2 cut(s) 141, 538
DpnI GATC 1 cut(s) 503
DpnII GATC 1 cut(s) 501
DraIII CACNNNGTG 1 cut(s) 114
DrdI GACNNNNNNGTC 1 cut(s) 157
DseDI GACNNNNNNGTC 1 cut(s) 157
EaeI YGGCCR 1 cut(s) 369
Eco24I GRGCYC 1 cut(s) 444
Eco31I GGTCTC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 570
EcoRII CCWGG 1 cut(s) 581
EcoT22I ATGCAT 1 cut(s) 244
EcoT38I GRGCYC 1 cut(s) 444
FaeI CATG 3 cut(s) 450, 619, 674
FaiI YATR 6 cut(s) 448, 530, 617, 672, 709, 711
FatI CATG 3 cut(s) 446, 615, 670
FauI CCCGC 1 cut(s) 429
FauNDI CATATG 1 cut(s) 709
FblI GTMKAC 1 cut(s) 495
Fnu4HI GCNGC 3 cut(s) 406, 519, 628
FokI GGATG 2 cut(s) 437, 620
FriOI GRGCYC 1 cut(s) 444
Fsp4HI GCNGC 3 cut(s) 406, 519, 628
GluI GCNGC 3 cut(s) 406, 519, 628
HaeIII GGCC 1 cut(s) 371
HapII CCGG 1 cut(s) 194
Hin1II CATG 3 cut(s) 450, 619, 674
HindIII AAGCTT 1 cut(s) 121
HinfI GANTC 4 cut(s) 292, 362, 497, 686
HpaII CCGG 1 cut(s) 194
Hpy166II GTNNAC 3 cut(s) 91, 177, 496
Hpy188I TCNGA 1 cut(s) 312
Hpy188III TCNNGA 4 cut(s) 194, 540, 653, 671
Hpy8I GTNNAC 3 cut(s) 91, 177, 496
HpyAV CCTTC 3 cut(s) 349, 385, 414
HpyCH4III ACNGT 4 cut(s) 159, 220, 349, 398
HpyCH4IV ACGT 1 cut(s) 129
HpyCH4V TGCA 8 cut(s) 4, 22, 177, 242, 518, 591, 707, 713
HpyF10VI GCNNNNNNNGC 1 cut(s) 524
HpyF3I CTNAG 2 cut(s) 141, 538
HpySE526I ACGT 1 cut(s) 129
Hsp92II CATG 3 cut(s) 450, 619, 674
Kpn2I TCCGGA 1 cut(s) 193
KspI CCGCGG 1 cut(s) 437
Kzo9I GATC 1 cut(s) 501
Lsp1109I GCAGC 3 cut(s) 417, 530, 614
LweI GCATC 1 cut(s) 229
MaeII ACGT 1 cut(s) 129
MaeIII GTNAC 1 cut(s) 611
MalI GATC 1 cut(s) 503
MboI GATC 1 cut(s) 501
MboII GAAGA 3 cut(s) 301, 364, 471
MhlI GDGCHC 2 cut(s) 179, 444
MlsI TGGCCA 1 cut(s) 371
MluCI AATT 1 cut(s) 648
MluNI TGGCCA 1 cut(s) 371
MlyI GAGTC 3 cut(s) 286, 371, 491
MnlI CCTC 3 cut(s) 237, 259, 410
Mox20I TGGCCA 1 cut(s) 371
Mph1103I ATGCAT 1 cut(s) 244
MroI TCCGGA 1 cut(s) 193
MscI TGGCCA 1 cut(s) 371
MseI TTAA 3 cut(s) 639, 647, 663
Msp20I TGGCCA 1 cut(s) 371
MspA1I CMGCKG 1 cut(s) 436
MspI CCGG 1 cut(s) 194
MspR9I CCNGG 1 cut(s) 583
Mva1269I GAATGC 1 cut(s) 11
MvaI CCWGG 1 cut(s) 583
MvnI CGCG 1 cut(s) 436
MwoI GCNNNNNNNGC 1 cut(s) 524
NdeI CATATG 1 cut(s) 709
NdeII GATC 1 cut(s) 501
NlaIII CATG 3 cut(s) 450, 619, 674
NlaIV GGNNCC 1 cut(s) 217
NmuCI GTSAC 1 cut(s) 611
NsiI ATGCAT 1 cut(s) 244
NspI RCATGY 1 cut(s) 619
PagI TCATGA 1 cut(s) 670
PctI GAATGC 1 cut(s) 11
PfeI GAWTC 1 cut(s) 686
PkrI GCNGC 3 cut(s) 407, 520, 629
PleI GAGTC 3 cut(s) 286, 370, 491
PpsI GAGTC 3 cut(s) 286, 370, 491
PshBI ATTAAT 1 cut(s) 663
Psp6I CCWGG 1 cut(s) 581
PspGI CCWGG 1 cut(s) 581
PspN4I GGNNCC 1 cut(s) 217
PspPI GGNCC 1 cut(s) 570
RsaI GTAC 1 cut(s) 596
RsaNI GTAC 1 cut(s) 595
SacII CCGCGG 1 cut(s) 437
SaqAI TTAA 3 cut(s) 639, 647, 663
SatI GCNGC 3 cut(s) 406, 519, 628
Sau3AI GATC 1 cut(s) 501
Sau96I GGNCC 1 cut(s) 570
SchI GAGTC 3 cut(s) 286, 371, 491
ScrFI CCNGG 1 cut(s) 583
SduI GDGCHC 2 cut(s) 179, 444
SfaNI GCATC 1 cut(s) 229
Sfr303I CCGCGG 1 cut(s) 437
SgrBI CCGCGG 1 cut(s) 437
SinI GGWCC 1 cut(s) 570
Sse9I AATT 1 cut(s) 648
SsiI CCGC 3 cut(s) 317, 434, 436
StyD4I CCNGG 1 cut(s) 581
TaaI ACNGT 4 cut(s) 159, 220, 349, 398
TaiI ACGT 1 cut(s) 132
TaqI TCGA 2 cut(s) 415, 500
TasI AATT 1 cut(s) 648
TfiI GAWTC 1 cut(s) 686
Tru1I TTAA 3 cut(s) 639, 647, 663
Tru9I TTAA 3 cut(s) 639, 647, 663
TscAI CASTG 2 cut(s) 354, 403
TseFI GTSAC 1 cut(s) 611
TseI GCWGC 3 cut(s) 405, 518, 627
Tsp45I GTSAC 1 cut(s) 611
TspDTI ATGAA 6 cut(s) 367, 465, 525, 578, 678, 687
TspRI CASTG 2 cut(s) 354, 403
VneI GTGCAC 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 570
VspI ATTAAT 1 cut(s) 663
XceI RCATGY 1 cut(s) 619
XmiI GTMKAC 1 cut(s) 495
Zsp2I ATGCAT 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.