pycom520g01010

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_520
OG0000128
Physical Location & Seq
Reverse (-)
770833 .. 771385
553 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom520g01010.2

Sequence Viewer

Length: 360 bp
ATGTCAAGGGCCGGGTACGACTTCGCTTCTTCTGCAGTGGCTGGAAAGAAGGTTTCAAACACTGTCAATGACGAAGAACGTAACCTCACCAAAACTCAAAAGAAGTTGAAGGAGCATGGTTACGGAGTTGACAACAACAAAGCCGGACTTGGTTTCACACCAAATGCACCTGTGATGATTTCAAACAAAGCAAAAAACACTAACAAGACAGCACTGAAGAGGAGATCCAAGATGTTTTCCACATCACGGTTCAAGAAGGTAAAGAAGACGAAATCCCCGAGGAAGATGTCACTGCTGCACCACCACAGCTCGAAGATGGGGGGCAAGCCACGATCGATGATCTCAAGGAACTCAACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 rve

Protein Analysis

120

Amino Acids

13.21

Weight (kDa)

11.05

Isoelectric Point (pI)

52.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 219
AcuI CTGAAG 1 cut(s) 236
AfaI GTAC 1 cut(s) 17
AfiI CCNNNNNNNGG 1 cut(s) 246
AgsI TTSAA 4 cut(s) 57, 109, 183, 253
AluBI AGCT 1 cut(s) 309
AluI AGCT 1 cut(s) 309
AlwI GGATC 1 cut(s) 219
AlwNI CAGNNNCTG 1 cut(s) 41
Ama87I CYCGRG 1 cut(s) 277
AoxI GGCC 1 cut(s) 9
ApeKI GCWGC 1 cut(s) 295
AspS9I GGNCC 1 cut(s) 9
AsuC2I CCSGG 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 79
AvaI CYCGRG 1 cut(s) 277
BbsI GAAGAC 1 cut(s) 272
BbvI GCAGC 1 cut(s) 282
BccI CCATC 1 cut(s) 310
BcnI CCSGG 1 cut(s) 13
BfmI CTRYAG 1 cut(s) 33
BisI GCNGC 1 cut(s) 296
BlsI GCNGC 1 cut(s) 297
Bme1390I CCNGG 1 cut(s) 13
BmeT110I CYCGRG 1 cut(s) 277
BmgT120I GGNCC 1 cut(s) 9
BmrFI CCNGG 1 cut(s) 13
BpiI GAAGAC 1 cut(s) 272
BpuEI CTTGAG 1 cut(s) 328
BpuMI CCSGG 1 cut(s) 13
Bsa29I ATCGAT 1 cut(s) 335
BsaJI CCNNGG 1 cut(s) 278
Bsc4I CCNNNNNNNGG 1 cut(s) 246
BseCI ATCGAT 1 cut(s) 335
BseDI CCNNGG 1 cut(s) 278
BseLI CCNNNNNNNGG 1 cut(s) 246
BseRI GAGGAG 1 cut(s) 235
BseXI GCAGC 1 cut(s) 282
BsgI GTGCAG 1 cut(s) 281
Bsh1285I CGRYCG 1 cut(s) 335
BshFI GGCC 1 cut(s) 11
BshVI ATCGAT 1 cut(s) 335
BsiEI CGRYCG 1 cut(s) 335
BsiHKCI CYCGRG 1 cut(s) 277
BsiSI CCGG 2 cut(s) 12, 144
BslI CCNNNNNNNGG 1 cut(s) 246
BsnI GGCC 1 cut(s) 11
BsoBI CYCGRG 1 cut(s) 277
Bsp143I GATC 3 cut(s) 224, 332, 339
BspANI GGCC 1 cut(s) 11
BspDI ATCGAT 1 cut(s) 335
BspMAI CTGCAG 1 cut(s) 37
BspPI GGATC 1 cut(s) 219
BssECI CCNNGG 1 cut(s) 278
BssMI GATC 3 cut(s) 224, 332, 339
Bst4CI ACNGT 2 cut(s) 64, 249
Bst6I CTCTTC 1 cut(s) 212
BstC8I GCNNGC 1 cut(s) 326
BstDEI CTNAG 1 cut(s) 357
BstKTI GATC 3 cut(s) 227, 335, 342
BstMBI GATC 3 cut(s) 224, 332, 339
BstMCI CGRYCG 1 cut(s) 335
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 11
BstSFI CTRYAG 1 cut(s) 33
BstV1I GCAGC 1 cut(s) 282
BstV2I GAAGAC 1 cut(s) 272
BstX2I RGATCY 1 cut(s) 224
BstYI RGATCY 1 cut(s) 224
Bsu15I ATCGAT 1 cut(s) 335
BsuRI GGCC 1 cut(s) 11
BsuTUI ATCGAT 1 cut(s) 335
BtsI GCAGTG 2 cut(s) 42, 290
BtsIMutI CAGTG 4 cut(s) 42, 60, 212, 290
Cac8I GCNNGC 1 cut(s) 326
CaiI CAGNNNCTG 1 cut(s) 41
Cfr13I GGNCC 1 cut(s) 9
ClaI ATCGAT 1 cut(s) 335
Csp6I GTAC 1 cut(s) 16
CviAII CATG 1 cut(s) 116
CviJI RGCY 5 cut(s) 11, 41, 143, 309, 328
CviKI_1 RGCY 5 cut(s) 11, 41, 143, 309, 328
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 1 cut(s) 357
DpnI GATC 3 cut(s) 226, 334, 341
DpnII GATC 3 cut(s) 224, 332, 339
Eam1104I CTCTTC 1 cut(s) 212
EarI CTCTTC 1 cut(s) 212
Eco57I CTGAAG 1 cut(s) 236
Eco88I CYCGRG 1 cut(s) 277
FaeI CATG 1 cut(s) 119
FaiI YATR 1 cut(s) 117
FalI AAGNNNNNCTT 2 cut(s) 132, 164
FatI CATG 1 cut(s) 115
Fnu4HI GCNGC 1 cut(s) 296
Fsp4HI GCNGC 1 cut(s) 296
GluI GCNGC 1 cut(s) 296
HaeIII GGCC 1 cut(s) 11
HapII CCGG 2 cut(s) 12, 144
Hin1II CATG 1 cut(s) 119
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HpaII CCGG 2 cut(s) 12, 144
HphI GGTGA 1 cut(s) 79
Hpy166II GTNNAC 1 cut(s) 130
Hpy188III TCNNGA 1 cut(s) 253
Hpy8I GTNNAC 1 cut(s) 130
HpyAV CCTTC 3 cut(s) 43, 103, 250
HpyCH4III ACNGT 2 cut(s) 64, 249
HpyCH4IV ACGT 1 cut(s) 79
HpyCH4V TGCA 3 cut(s) 35, 167, 298
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 357
HpySE526I ACGT 1 cut(s) 79
Hsp92II CATG 1 cut(s) 119
Kzo9I GATC 3 cut(s) 224, 332, 339
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 4 cut(s) 25, 27, 157, 183
Lsp1109I GCAGC 1 cut(s) 282
MaeII ACGT 1 cut(s) 79
MaeIII GTNAC 3 cut(s) 80, 119, 288
MalI GATC 3 cut(s) 226, 334, 341
MboI GATC 3 cut(s) 224, 332, 339
MboII GAAGA 6 cut(s) 21, 86, 229, 277, 295, 325
MflI RGATCY 1 cut(s) 224
MnlI CCTC 3 cut(s) 95, 213, 273
MspI CCGG 2 cut(s) 12, 144
MspR9I CCNGG 1 cut(s) 13
MwoI GCNNNNNNNGC 1 cut(s) 32
NciI CCSGG 1 cut(s) 13
NdeII GATC 3 cut(s) 224, 332, 339
NlaIII CATG 1 cut(s) 119
NmuCI GTSAC 1 cut(s) 288
PcsI WCGNNNNNNNCGW 1 cut(s) 275
PkrI GCNGC 1 cut(s) 297
Ple19I CGATCG 1 cut(s) 335
PspPI GGNCC 1 cut(s) 9
PstI CTGCAG 1 cut(s) 37
PstNI CAGNNNCTG 1 cut(s) 41
PsuI RGATCY 1 cut(s) 224
PvuI CGATCG 1 cut(s) 335
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
SatI GCNGC 1 cut(s) 296
Sau3AI GATC 3 cut(s) 224, 332, 339
Sau96I GGNCC 1 cut(s) 9
ScrFI CCNGG 1 cut(s) 13
SetI ASST 6 cut(s) 54, 82, 87, 172, 261, 311
SfcI CTRYAG 1 cut(s) 33
SmlI CTYRAG 1 cut(s) 343
SmoI CTYRAG 1 cut(s) 343
StyD4I CCNGG 1 cut(s) 11
TaaI ACNGT 2 cut(s) 64, 249
TaiI ACGT 1 cut(s) 82
TaqI TCGA 2 cut(s) 311, 335
TscAI CASTG 4 cut(s) 42, 67, 219, 297
TseFI GTSAC 1 cut(s) 288
TseI GCWGC 1 cut(s) 295
Tsp45I GTSAC 1 cut(s) 288
TspGWI ACGGA 1 cut(s) 138
TspRI CASTG 4 cut(s) 42, 67, 219, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.