pycom133g00190

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000133
OG0000128
Physical Location & Seq
Forward (+)
378819 .. 379316
498 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom133g00190.1

Sequence Viewer

Length: 498 bp
ATGGTTGAAGTAGAAATAGAAGAGCCCTCAAAAGGCAAAGCTATCGCCACTAAGGTAGAAAAGACCCTCGCACTTGAAGAAGGTCTGCCAACACACTTTAGCATCGAGGAAGCGCTACAATTGCCAAAAAGGATGCGAAGAGCACTAGCAGCAGTCTTGGCAAGTCCTGGAGACCACGAAGTGCAAGAAAGTAATGACGAAGGCTGGAAGCTTCAGCCACATGAATGTGCCACATGTTGTGCCACCCATGACGCAATTAACTTCACTGACGAAGACCTACTGCTGGGATCAAAGCCACACAACCGTCCTCTCTTCGTCTCGGGGTACGTAAAGGAACACAAAGTCAACCGCATGCTTGTGGATGGTGGGTCGGCCATAAATATCATGCCAAAATCAACAATGACCATAATTGGCATCAAGGTGAATGAACTATCCCTGAGCCGTCTGCTGATCCAGGGTTTTAACCAAGGAGGACAAAGGGCAATGGGCATGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 Retrotrans_gag

Protein Analysis

166

Amino Acids

18.12

Weight (kDa)

5.87

Isoelectric Point (pI)

49.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 349
AclWI GGATC 2 cut(s) 295, 445
AcoI YGGCCR 1 cut(s) 372
AcuI CTGAAG 1 cut(s) 197
AdeI CACNNNGTG 1 cut(s) 181
AfaI GTAC 1 cut(s) 326
AfeI AGCGCT 1 cut(s) 114
AfiI CCNNNNNNNGG 2 cut(s) 32, 283
AflIII ACRYGT 1 cut(s) 233
AgsI TTSAA 2 cut(s) 8, 77
AjnI CCWGG 2 cut(s) 166, 453
AluBI AGCT 2 cut(s) 41, 211
AluI AGCT 2 cut(s) 41, 211
Alw21I GWGCWC 1 cut(s) 145
Alw26I GTCTC 2 cut(s) 165, 322
AlwI GGATC 2 cut(s) 295, 445
Ama87I CYCGRG 1 cut(s) 319
Aor51HI AGCGCT 1 cut(s) 114
AoxI GGCC 1 cut(s) 372
ApeKI GCWGC 1 cut(s) 149
AspLEI GCGC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 433
AvaI CYCGRG 1 cut(s) 319
BanII GRGCYC 1 cut(s) 27
BbsI GAAGAC 1 cut(s) 279
Bbv12I GWGCWC 1 cut(s) 145
BbvI GCAGC 1 cut(s) 161
BccI CCATC 1 cut(s) 356
BceAI ACGGC 1 cut(s) 426
BcgI CGANNNNNNTGC 2 cut(s) 25, 59
BciT130I CCWGG 2 cut(s) 168, 455
BcoDI GTCTC 2 cut(s) 165, 322
BfaI CTAG 1 cut(s) 146
BfoI RGCGCY 1 cut(s) 116
BisI GCNGC 1 cut(s) 150
BlsI GCNGC 1 cut(s) 151
Bme1390I CCNGG 2 cut(s) 168, 455
BmeT110I CYCGRG 1 cut(s) 319
BmrFI CCNGG 2 cut(s) 168, 455
BmsI GCATC 3 cut(s) 111, 123, 423
BpiI GAAGAC 1 cut(s) 279
BpmI CTGGAG 1 cut(s) 189
Bpu10I CCTNAGC 1 cut(s) 437
BsaAI YACGTR 1 cut(s) 328
BsaI GGTCTC 1 cut(s) 165
BsaJI CCNNGG 2 cut(s) 454, 466
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 283
Bse3DI GCAATG 1 cut(s) 489
BseBI CCWGG 2 cut(s) 168, 455
BseDI CCNNGG 2 cut(s) 454, 466
BseGI GGATG 2 cut(s) 138, 367
BseLI CCNNNNNNNGG 2 cut(s) 32, 283
BseMI GCAATG 1 cut(s) 489
BseMII CTCAG 1 cut(s) 428
BseXI GCAGC 1 cut(s) 161
BseYI CCCAGC 1 cut(s) 283
BshFI GGCC 1 cut(s) 374
BsiHKAI GWGCWC 1 cut(s) 145
BsiHKCI CYCGRG 1 cut(s) 319
BslI CCNNNNNNNGG 2 cut(s) 32, 283
BsmAI GTCTC 2 cut(s) 165, 322
BsmBI CGTCTC 1 cut(s) 322
BsnI GGCC 1 cut(s) 374
Bso31I GGTCTC 1 cut(s) 165
BsoBI CYCGRG 1 cut(s) 319
Bsp1286I GDGCHC 2 cut(s) 27, 145
Bsp143I GATC 3 cut(s) 287, 450, 492
BspACI CCGC 1 cut(s) 349
BspANI GGCC 1 cut(s) 374
BspCNI CTCAG 1 cut(s) 429
BspPI GGATC 2 cut(s) 295, 445
BspQI GCTCTTC 2 cut(s) 15, 133
BspTNI GGTCTC 1 cut(s) 165
BsrDI GCAATG 1 cut(s) 489
BssECI CCNNGG 2 cut(s) 454, 466
BssMI GATC 3 cut(s) 287, 450, 492
BssT1I CCWWGG 1 cut(s) 466
Bst2UI CCWGG 2 cut(s) 168, 455
Bst4CI ACNGT 1 cut(s) 305
Bst6I CTCTTC 3 cut(s) 15, 133, 317
BstBAI YACGTR 1 cut(s) 328
BstC8I GCNNGC 1 cut(s) 353
BstDEI CTNAG 2 cut(s) 51, 437
BstF5I GGATG 2 cut(s) 138, 367
BstH2I RGCGCY 1 cut(s) 116
BstHHI GCGC 1 cut(s) 115
BstKTI GATC 3 cut(s) 290, 453, 495
BstMAI GTCTC 2 cut(s) 165, 322
BstMBI GATC 3 cut(s) 287, 450, 492
BstMWI GCNNNNNNNGC 3 cut(s) 121, 149, 158
BstNI CCWGG 2 cut(s) 168, 455
BstNSI RCATGY 2 cut(s) 237, 355
BstSCI CCNGG 2 cut(s) 166, 453
BstSNI TACGTA 1 cut(s) 328
BstV1I GCAGC 1 cut(s) 161
BstV2I GAAGAC 1 cut(s) 279
BsuRI GGCC 1 cut(s) 374
BtsCI GGATG 2 cut(s) 138, 367
BtsIMutI CAGTG 1 cut(s) 264
Cac8I GCNNGC 1 cut(s) 353
CfoI GCGC 1 cut(s) 115
CseI GACGC 1 cut(s) 260
Csp6I GTAC 1 cut(s) 325
CviAII CATG 6 cut(s) 221, 234, 248, 352, 385, 490
CviJI RGCY 8 cut(s) 25, 41, 204, 211, 217, 295, 374, 441
CviKI_1 RGCY 8 cut(s) 25, 41, 204, 211, 217, 295, 374, 441
CviQI GTAC 1 cut(s) 325
DdeI CTNAG 2 cut(s) 51, 437
DpnI GATC 3 cut(s) 289, 452, 494
DpnII GATC 3 cut(s) 287, 450, 492
DraIII CACNNNGTG 1 cut(s) 181
EaeI YGGCCR 1 cut(s) 372
Eam1104I CTCTTC 3 cut(s) 15, 133, 317
EarI CTCTTC 3 cut(s) 15, 133, 317
Eco105I TACGTA 1 cut(s) 328
Eco130I CCWWGG 1 cut(s) 466
Eco24I GRGCYC 1 cut(s) 27
Eco31I GGTCTC 1 cut(s) 165
Eco47III AGCGCT 1 cut(s) 114
Eco57I CTGAAG 1 cut(s) 197
Eco88I CYCGRG 1 cut(s) 319
EcoRII CCWGG 2 cut(s) 166, 453
EcoT14I CCWWGG 1 cut(s) 466
EcoT38I GRGCYC 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 466
Esp3I CGTCTC 1 cut(s) 322
FaeI CATG 6 cut(s) 224, 237, 251, 355, 388, 493
FaiI YATR 8 cut(s) 222, 235, 249, 353, 377, 386, 407, 491
FatI CATG 6 cut(s) 220, 233, 247, 351, 384, 489
Fnu4HI GCNGC 1 cut(s) 150
FokI GGATG 2 cut(s) 145, 374
FriOI GRGCYC 1 cut(s) 27
Fsp4HI GCNGC 1 cut(s) 150
FspBI CTAG 1 cut(s) 146
GlaI GCGC 1 cut(s) 114
GluI GCNGC 1 cut(s) 150
GsaI CCCAGC 1 cut(s) 287
GsuI CTGGAG 1 cut(s) 189
HaeII RGCGCY 1 cut(s) 116
HaeIII GGCC 1 cut(s) 374
HgaI GACGC 1 cut(s) 260
HhaI GCGC 1 cut(s) 115
Hin1II CATG 6 cut(s) 224, 237, 251, 355, 388, 493
Hin6I GCGC 1 cut(s) 113
HinP1I GCGC 1 cut(s) 113
HincII GTYRAC 1 cut(s) 346
HindII GTYRAC 1 cut(s) 346
HindIII AAGCTT 1 cut(s) 209
HphI GGTGA 1 cut(s) 433
Hpy166II GTNNAC 1 cut(s) 346
Hpy188I TCNGA 1 cut(s) 497
Hpy8I GTNNAC 1 cut(s) 346
HpyAV CCTTC 2 cut(s) 74, 194
HpyCH4III ACNGT 1 cut(s) 305
HpyCH4IV ACGT 1 cut(s) 327
HpyCH4V TGCA 1 cut(s) 184
HpyF10VI GCNNNNNNNGC 3 cut(s) 121, 149, 158
HpyF3I CTNAG 2 cut(s) 51, 437
HpySE526I ACGT 1 cut(s) 327
Hsp92II CATG 6 cut(s) 224, 237, 251, 355, 388, 493
HspAI GCGC 1 cut(s) 113
Kzo9I GATC 3 cut(s) 287, 450, 492
LguI GCTCTTC 2 cut(s) 15, 133
LpnPI CCDG 7 cut(s) 153, 180, 190, 269, 440, 449, 467
Lsp1109I GCAGC 1 cut(s) 161
LweI GCATC 3 cut(s) 111, 123, 423
MaeI CTAG 1 cut(s) 146
MaeII ACGT 1 cut(s) 327
MalI GATC 3 cut(s) 289, 452, 494
MboI GATC 3 cut(s) 287, 450, 492
MboII GAAGA 5 cut(s) 32, 89, 150, 284, 304
MfeI CAATTG 1 cut(s) 119
MhlI GDGCHC 2 cut(s) 27, 145
MluCI AATT 3 cut(s) 119, 255, 408
MnlI CCTC 5 cut(s) 37, 77, 100, 318, 464
MseI TTAA 2 cut(s) 258, 462
MslI CAYNNNNRTG 4 cut(s) 223, 225, 356, 419
MspR9I CCNGG 2 cut(s) 168, 455
MunI CAATTG 1 cut(s) 119
MvaI CCWGG 2 cut(s) 168, 455
MwoI GCNNNNNNNGC 3 cut(s) 121, 149, 158
NdeII GATC 3 cut(s) 287, 450, 492
NlaIII CATG 6 cut(s) 224, 237, 251, 355, 388, 493
NspI RCATGY 2 cut(s) 237, 355
PaeI GCATGC 1 cut(s) 355
PciI ACATGT 1 cut(s) 233
PciSI GCTCTTC 2 cut(s) 15, 133
PfoI TCCNGGA 1 cut(s) 166
PkrI GCNGC 1 cut(s) 151
Ppu21I YACGTR 1 cut(s) 328
PscI ACATGT 1 cut(s) 233
Psp6I CCWGG 2 cut(s) 166, 453
PspFI CCCAGC 1 cut(s) 283
PspGI CCWGG 2 cut(s) 166, 453
RsaI GTAC 1 cut(s) 326
RsaNI GTAC 1 cut(s) 325
RseI CAYNNNNRTG 4 cut(s) 223, 225, 356, 419
SapI GCTCTTC 2 cut(s) 15, 133
SaqAI TTAA 2 cut(s) 258, 462
SatI GCNGC 1 cut(s) 150
Sau3AI GATC 3 cut(s) 287, 450, 492
ScrFI CCNGG 2 cut(s) 168, 455
SduI GDGCHC 2 cut(s) 27, 145
SetI ASST 7 cut(s) 43, 57, 85, 213, 279, 330, 423
SfaNI GCATC 3 cut(s) 111, 123, 423
SmiMI CAYNNNNRTG 4 cut(s) 223, 225, 356, 419
SnaBI TACGTA 1 cut(s) 328
SphI GCATGC 1 cut(s) 355
Sse9I AATT 3 cut(s) 119, 255, 408
SsiI CCGC 1 cut(s) 349
SspMI CTAG 1 cut(s) 146
StyD4I CCNGG 2 cut(s) 166, 453
StyI CCWWGG 1 cut(s) 466
TaaI ACNGT 1 cut(s) 305
TaiI ACGT 1 cut(s) 330
TaqI TCGA 1 cut(s) 105
TasI AATT 3 cut(s) 119, 255, 408
Tru1I TTAA 2 cut(s) 258, 462
Tru9I TTAA 2 cut(s) 258, 462
TscAI CASTG 1 cut(s) 271
TseI GCWGC 1 cut(s) 149
TspDTI ATGAA 2 cut(s) 237, 441
TspRI CASTG 1 cut(s) 271
XceI RCATGY 2 cut(s) 237, 355
XspI CTAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.