Rmu_sc0000706.1_g000041

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000706.1
OG0000128
Physical Location & Seq
Forward (+)
167583 .. 169425
1843 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000706.1_g000041.1.cds

Sequence Viewer

Length: 1647 bp
atgactaatcatatgtattacttgtttgccacaggatacaagatggcaccacaagttacagtgtatttccaagagcttaaggctattgggtcgaaagctggacaagcaacacgagctgaacatcatgtctcattcaccgttgatcaagctccactgacaagcaatgttcagaagctcaaccatgatgtcagagtcatcaagaccgttacgctcaatgctaaccatgcccctgtcagtactcagataatgatcgggtctattccaatcaatttggtcattacaccacatagacccgaagccccgtgcctcgagtccccacaacaagtacatttacaatcagcgacagctactatagcttctgaacctcagatagtcaagttcatctcaacctctgacaactcatctggcacacaggacaaagttgttaaggcacaccaccgaaagaatctatcagtggtcaacaaaacagcctctacaactggaaagtccaagaaaatacgtataccagtgggggcattccaagcacataaatcacatggggcatttccagttaacgtaccacagggggccttcccggactcttcagcagaatcaagaccatttatggtccctgttgttagtcaacatactcaagcattgtttgagacaaatgacggcacaaagcctgagactatgtcagttatggtcacaaacgcatcaacaatagaagaacagctagaagaaatgaagagaatgctagctgaaaaagatgctcaaatagcagcactgacttctcaattggctactatggccaacataagcgatcataaaaatgatgaaaagagtgatcgtgaaaagaacatcggaggacatggttccacaatcgcaagtcttgaagacataaagacactaattgcagaaggaatccgtgaagtatacacctcctcaaatctacagttctctgggtacttgaaaccctaccctgctcattacgatgcactaccattccctaaaggctatcagaagccaacttttgacaagttcgacggaatagatggctctccccatgaacatttggctcatttcttctcagcttgtggggaaacatcacaatggaggagcttaaacctccaatgctcagaaaaattgacagagatttcggcagtacaaatgtgctcaaacaatctcttaccagagatagcaacttttgttagcactgcagaacctcaaacatttgaagcactagtctcaaaggctagtaatgttgaaagacaagttgcccgtaaaaagtttatgacacaaagggcactctttaaagaccatagagttgacaacacagatgagtcgctggcaacctttgtcaggactgacaacaagtcaaacacatgcgaaggaaaagaagggtctagaaagctcaccctcaaagaaagaaaagaagtcaaatactctttcgatgatgatgatgtcgaacatattttcagtgagctcatcaacgcacaagctattgagcttcctgaaccgaaacgacgaggtgaagttaatgaaaccaacgaccccaaattttgccagtatcatcgaatcgtaagtcattcaacaagggattgttttgttctgaaggacataatccaaaatatggtcgataacaaggaaattgaggtggagacgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 Retrotrans_gag rve

Protein Analysis

548

Amino Acids

61.01

Weight (kDa)

6.43

Isoelectric Point (pI)

39.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 46
AccB7I CCANNNNNTGG 1 cut(s) 1612
AccI GTMKAC 2 cut(s) 502, 915
AcoI YGGCCR 1 cut(s) 789
AcsI RAATTY 1 cut(s) 1538
AcuI CTGAAG 2 cut(s) 567, 1613
AfaI GTAC 5 cut(s) 238, 327, 558, 947, 1146
AfiI CCNNNNNNNGG 2 cut(s) 1341, 1612
AflII CTTAAG 1 cut(s) 77
AgsI TTSAA 5 cut(s) 875, 952, 1217, 1247, 1572
AhdI GACNNNNNGTC 1 cut(s) 1354
AhlI ACTAGT 1 cut(s) 1222
Alw21I GWGCWC 2 cut(s) 1157, 1467
Alw26I GTCTC 5 cut(s) 133, 638, 662, 1231, 1634
Ama87I CYCGRG 1 cut(s) 308
AoxI GGCC 2 cut(s) 567, 789
ApeKI GCWGC 1 cut(s) 761
ApoI RAATTY 1 cut(s) 1538
ArsI GACNNNNNNTTYG 4 cut(s) 1120, 1152, 1549, 1581
AspS9I GGNCC 2 cut(s) 567, 607
AsuC2I CCSGG 1 cut(s) 575
AsuHPI GGTGA 3 cut(s) 127, 1387, 1523
AsuNHI GCTAGC 1 cut(s) 736
AvaI CYCGRG 1 cut(s) 308
AvaII GGWCC 1 cut(s) 607
BaeGI GKGCMC 1 cut(s) 1288
BalI TGGCCA 1 cut(s) 791
BanI GGYRCC 1 cut(s) 46
BanII GRGCYC 1 cut(s) 1467
BauI CACGAG 1 cut(s) 111
BbsI GAAGAC 1 cut(s) 882
Bbv12I GWGCWC 2 cut(s) 1157, 1467
BbvI GCAGC 1 cut(s) 773
BccI CCATC 2 cut(s) 37, 1028
BceAI ACGGC 1 cut(s) 670
BciVI GTATCC 1 cut(s) 29
BclI TGATCA 1 cut(s) 142
BcnI CCSGG 1 cut(s) 575
BcoDI GTCTC 5 cut(s) 133, 638, 662, 1231, 1634
BcuI ACTAGT 1 cut(s) 1222
BfaI CTAG 5 cut(s) 716, 737, 1223, 1236, 1386
BfmI CTRYAG 3 cut(s) 351, 932, 1197
BfrI CTTAAG 1 cut(s) 77
BfuI GTATCC 1 cut(s) 29
BisI GCNGC 1 cut(s) 762
BlsI GCNGC 1 cut(s) 763
BmcAI AGTACT 1 cut(s) 238
Bme1390I CCNGG 1 cut(s) 575
Bme18I GGWCC 1 cut(s) 607
BmeRI GACNNNNNGTC 1 cut(s) 1354
BmeT110I CYCGRG 1 cut(s) 308
BmgT120I GGNCC 2 cut(s) 567, 607
BmiI GGNNCC 4 cut(s) 48, 568, 609, 856
BmrFI CCNGG 1 cut(s) 575
BmsI GCATC 3 cut(s) 704, 739, 964
BmtI GCTAGC 1 cut(s) 740
BpiI GAAGAC 1 cut(s) 882
BpuEI CTTGAG 1 cut(s) 615
BpuMI CCSGG 1 cut(s) 575
BsaAI YACGTR 1 cut(s) 500
BsaBI GATNNNNATC 1 cut(s) 248
Bsc4I CCNNNNNNNGG 2 cut(s) 1341, 1612
Bse1I ACTGG 4 cut(s) 484, 506, 548, 1546
Bse3DI GCAATG 1 cut(s) 169
Bse8I GATNNNNATC 1 cut(s) 248
BseJI GATNNNNATC 1 cut(s) 248
BseLI CCNNNNNNNGG 2 cut(s) 1341, 1612
BseMI GCAATG 1 cut(s) 169
BseMII CTCAG 5 cut(s) 254, 380, 657, 1083, 1131
BseNI ACTGG 4 cut(s) 484, 506, 548, 1546
BseRI GAGGAG 2 cut(s) 913, 1111
BseSI GKGCMC 1 cut(s) 1288
BseXI GCAGC 1 cut(s) 773
BshFI GGCC 2 cut(s) 569, 791
BshNI GGYRCC 1 cut(s) 46
BsiHKAI GWGCWC 2 cut(s) 1157, 1467
BsiHKCI CYCGRG 1 cut(s) 308
BsiSI CCGG 1 cut(s) 575
BslFI GGGAC 2 cut(s) 298, 593
BslI CCNNNNNNNGG 2 cut(s) 1341, 1612
BsmAI GTCTC 5 cut(s) 133, 638, 662, 1231, 1634
BsmBI CGTCTC 1 cut(s) 1634
BsmFI GGGAC 2 cut(s) 298, 593
BsmI GAATGC 2 cut(s) 515, 738
BsnI GGCC 2 cut(s) 569, 791
BsoBI CYCGRG 1 cut(s) 308
Bsp1286I GDGCHC 3 cut(s) 1157, 1288, 1467
Bsp143I GATC 4 cut(s) 142, 249, 802, 826
BspANI GGCC 2 cut(s) 569, 791
BspCNI CTCAG 5 cut(s) 253, 379, 658, 1082, 1130
BspLI GGNNCC 4 cut(s) 48, 568, 609, 856
BspMAI CTGCAG 1 cut(s) 1201
BspOI GCTAGC 1 cut(s) 740
BspT107I GGYRCC 1 cut(s) 46
BspTI CTTAAG 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 169
BsrI ACTGG 4 cut(s) 484, 506, 548, 1546
BssMI GATC 4 cut(s) 142, 249, 802, 826
BssNAI GTATAC 2 cut(s) 503, 916
BssSI CACGAG 1 cut(s) 111
Bst1107I GTATAC 2 cut(s) 503, 916
Bst2BI CACGAG 1 cut(s) 111
Bst4CI ACNGT 4 cut(s) 61, 139, 205, 936
Bst6I CTCTTC 2 cut(s) 586, 722
BstAFI CTTAAG 1 cut(s) 77
BstBAI YACGTR 1 cut(s) 500
BstC8I GCNNGC 2 cut(s) 738, 1329
BstDEI CTNAG 5 cut(s) 240, 366, 666, 1069, 1117
BstENI CCTNNNNNAGG 1 cut(s) 1339
BstKTI GATC 4 cut(s) 145, 252, 805, 829
BstMAI GTCTC 5 cut(s) 133, 638, 662, 1231, 1634
BstMBI GATC 4 cut(s) 142, 249, 802, 826
BstMWI GCNNNNNNNGC 7 cut(s) 104, 113, 224, 353, 521, 758, 788
BstNSI RCATGY 1 cut(s) 1368
BstSCI CCNGG 1 cut(s) 573
BstSFI CTRYAG 3 cut(s) 351, 932, 1197
BstSLI GKGCMC 1 cut(s) 1288
BstSNI TACGTA 1 cut(s) 500
BstV1I GCAGC 1 cut(s) 773
BstV2I GAAGAC 1 cut(s) 882
BstZ17I GTATAC 2 cut(s) 503, 916
BsuI GTATCC 1 cut(s) 29
BsuRI GGCC 2 cut(s) 569, 791
BtsI GCAGTG 1 cut(s) 1194
BtsIMutI CAGTG 7 cut(s) 66, 152, 459, 513, 764, 1194, 1465
Cac8I GCNNGC 2 cut(s) 738, 1329
Cfr13I GGNCC 2 cut(s) 567, 607
Csp6I GTAC 5 cut(s) 237, 326, 557, 946, 1145
CviAII CATG 7 cut(s) 125, 182, 224, 536, 851, 1046, 1365
CviQI GTAC 5 cut(s) 237, 326, 557, 946, 1145
DdeI CTNAG 5 cut(s) 240, 366, 666, 1069, 1117
DpnI GATC 4 cut(s) 144, 251, 804, 828
DpnII GATC 4 cut(s) 142, 249, 802, 826
DraI TTTAAA 1 cut(s) 1294
DriI GACNNNNNGTC 1 cut(s) 1354
EaeI YGGCCR 1 cut(s) 789
Eam1104I CTCTTC 2 cut(s) 586, 722
Eam1105I GACNNNNNGTC 1 cut(s) 1354
EarI CTCTTC 2 cut(s) 586, 722
Ecl136II GAGCTC 1 cut(s) 1465
Eco105I TACGTA 1 cut(s) 500
Eco24I GRGCYC 1 cut(s) 1467
Eco47I GGWCC 1 cut(s) 607
Eco53kI GAGCTC 1 cut(s) 1465
Eco57I CTGAAG 2 cut(s) 567, 1613
Eco88I CYCGRG 1 cut(s) 308
EcoICRI GAGCTC 1 cut(s) 1465
EcoNI CCTNNNNNAGG 1 cut(s) 1339
EcoO109I RGGNCCY 1 cut(s) 567
EcoT38I GRGCYC 1 cut(s) 1467
Esp3I CGTCTC 1 cut(s) 1634
FaeI CATG 7 cut(s) 128, 185, 227, 539, 854, 1049, 1368
FaqI GGGAC 2 cut(s) 298, 593
FatI CATG 7 cut(s) 124, 181, 223, 535, 850, 1045, 1364
FauNDI CATATG 1 cut(s) 12
FbaI TGATCA 1 cut(s) 142
FblI GTMKAC 2 cut(s) 502, 915
Fnu4HI GCNGC 1 cut(s) 762
FriOI GRGCYC 1 cut(s) 1467
Fsp4HI GCNGC 1 cut(s) 762
FspBI CTAG 5 cut(s) 716, 737, 1223, 1236, 1386
GluI GCNGC 1 cut(s) 762
HaeIII GGCC 2 cut(s) 569, 791
HapII CCGG 1 cut(s) 575
Hin1II CATG 7 cut(s) 128, 185, 227, 539, 854, 1049, 1368
HincII GTYRAC 4 cut(s) 460, 553, 623, 1309
HindII GTYRAC 4 cut(s) 460, 553, 623, 1309
HinfI GANTC 8 cut(s) 192, 311, 445, 578, 590, 903, 1322, 1557
HpaI GTTAAC 1 cut(s) 553
HpaII CCGG 1 cut(s) 575
HphI GGTGA 3 cut(s) 127, 1387, 1523
Hpy166II GTNNAC 6 cut(s) 460, 503, 553, 623, 916, 1309
Hpy188III TCNNGA 7 cut(s) 199, 594, 830, 872, 1342, 1386, 1493
Hpy8I GTNNAC 6 cut(s) 460, 503, 553, 623, 916, 1309
Hpy99I CGWCG 2 cut(s) 1028, 1509
HpyAV CCTTC 5 cut(s) 580, 893, 1364, 1373, 1588
HpyCH4III ACNGT 4 cut(s) 61, 139, 205, 936
HpyCH4IV ACGT 3 cut(s) 499, 555, 1643
HpyCH4V TGCA 3 cut(s) 896, 977, 1199
HpyF10VI GCNNNNNNNGC 7 cut(s) 104, 113, 224, 353, 521, 758, 788
HpyF3I CTNAG 5 cut(s) 240, 366, 666, 1069, 1117
HpySE526I ACGT 3 cut(s) 499, 555, 1643
Hsp92II CATG 7 cut(s) 128, 185, 227, 539, 854, 1049, 1368
Ksp22I TGATCA 1 cut(s) 142
KspAI GTTAAC 1 cut(s) 553
Kzo9I GATC 4 cut(s) 142, 249, 802, 826
LmnI GCTCC 2 cut(s) 154, 1098
Lsp1109I GCAGC 1 cut(s) 773
LweI GCATC 3 cut(s) 704, 739, 964
MaeI CTAG 5 cut(s) 716, 737, 1223, 1236, 1386
MaeII ACGT 3 cut(s) 499, 555, 1643
MaeIII GTNAC 3 cut(s) 55, 205, 685
MalI GATC 4 cut(s) 144, 251, 804, 828
MboI GATC 4 cut(s) 142, 249, 802, 826
MboII GAAGA 6 cut(s) 573, 719, 731, 739, 887, 1057
MfeI CAATTG 1 cut(s) 776
MhlI GDGCHC 3 cut(s) 1157, 1288, 1467
MlsI TGGCCA 1 cut(s) 791
MluCI AATT 6 cut(s) 268, 776, 891, 1124, 1538, 1629
MluNI TGGCCA 1 cut(s) 791
MlyI GAGTC 4 cut(s) 201, 320, 572, 1331
Mox20I TGGCCA 1 cut(s) 791
MscI TGGCCA 1 cut(s) 791
MseI TTAA 6 cut(s) 78, 426, 552, 1103, 1293, 1518
MslI CAYNNNNRTG 3 cut(s) 810, 972, 1090
Msp20I TGGCCA 1 cut(s) 791
MspCI CTTAAG 1 cut(s) 77
MspI CCGG 1 cut(s) 575
MspR9I CCNGG 1 cut(s) 575
MunI CAATTG 1 cut(s) 776
Mva1269I GAATGC 2 cut(s) 515, 738
MwoI GCNNNNNNNGC 7 cut(s) 104, 113, 224, 353, 521, 758, 788
NciI CCSGG 1 cut(s) 575
NdeI CATATG 1 cut(s) 12
NdeII GATC 4 cut(s) 142, 249, 802, 826
NheI GCTAGC 1 cut(s) 736
NlaIII CATG 7 cut(s) 128, 185, 227, 539, 854, 1049, 1368
NlaIV GGNNCC 4 cut(s) 48, 568, 609, 856
NmuCI GTSAC 1 cut(s) 685
NspI RCATGY 1 cut(s) 1368
PaeR7I CTCGAG 1 cut(s) 308
PctI GAATGC 2 cut(s) 515, 738
PfeI GAWTC 4 cut(s) 445, 590, 903, 1557
PflFI GACNNNGTC 1 cut(s) 673
PflMI CCANNNNNTGG 1 cut(s) 1612
PfoI TCCNGGA 1 cut(s) 573
PkrI GCNGC 1 cut(s) 763
PleI GAGTC 4 cut(s) 200, 319, 572, 1330
PpsI GAGTC 4 cut(s) 200, 319, 572, 1330
Ppu21I YACGTR 1 cut(s) 500
Psp124BI GAGCTC 1 cut(s) 1467
PspN4I GGNNCC 4 cut(s) 48, 568, 609, 856
PspPI GGNCC 2 cut(s) 567, 607
PspXI VCTCGAGB 1 cut(s) 308
PstI CTGCAG 1 cut(s) 1201
PsyI GACNNNGTC 1 cut(s) 673
RsaI GTAC 5 cut(s) 238, 327, 558, 947, 1146
RsaNI GTAC 5 cut(s) 237, 326, 557, 946, 1145
RseI CAYNNNNRTG 3 cut(s) 810, 972, 1090
SacI GAGCTC 1 cut(s) 1467
SaqAI TTAA 6 cut(s) 78, 426, 552, 1103, 1293, 1518
SatI GCNGC 1 cut(s) 762
Sau3AI GATC 4 cut(s) 142, 249, 802, 826
Sau96I GGNCC 2 cut(s) 567, 607
ScaI AGTACT 1 cut(s) 238
SchI GAGTC 4 cut(s) 201, 320, 572, 1331
ScrFI CCNGG 1 cut(s) 575
SduI GDGCHC 3 cut(s) 1157, 1288, 1467
SfaNI GCATC 3 cut(s) 704, 739, 964
SfcI CTRYAG 3 cut(s) 351, 932, 1197
Sfr274I CTCGAG 1 cut(s) 308
SinI GGWCC 1 cut(s) 607
SlaI CTCGAG 1 cut(s) 308
SmiMI CAYNNNNRTG 3 cut(s) 810, 972, 1090
SmlI CTYRAG 3 cut(s) 77, 308, 630
SmoI CTYRAG 3 cut(s) 77, 308, 630
SnaBI TACGTA 1 cut(s) 500
SpeI ACTAGT 1 cut(s) 1222
Sse9I AATT 6 cut(s) 268, 776, 891, 1124, 1538, 1629
SspMI CTAG 5 cut(s) 716, 737, 1223, 1236, 1386
SstI GAGCTC 1 cut(s) 1467
StyD4I CCNGG 1 cut(s) 573
TaaI ACNGT 4 cut(s) 61, 139, 205, 936
TaiI ACGT 3 cut(s) 502, 558, 1646
TaqI TCGA 7 cut(s) 92, 309, 1023, 1431, 1446, 1555, 1617
TasI AATT 6 cut(s) 268, 776, 891, 1124, 1538, 1629
TatI WGTACW 3 cut(s) 236, 325, 1144
TfiI GAWTC 4 cut(s) 445, 590, 903, 1557
Tru1I TTAA 6 cut(s) 78, 426, 552, 1103, 1293, 1518
Tru9I TTAA 6 cut(s) 78, 426, 552, 1103, 1293, 1518
TscAI CASTG 7 cut(s) 66, 159, 459, 513, 771, 1201, 1465
TseFI GTSAC 1 cut(s) 685
TseI GCWGC 1 cut(s) 761
Tsp45I GTSAC 1 cut(s) 685
TspDTI ATGAA 5 cut(s) 370, 740, 831, 1062, 1536
TspGWI ACGGA 2 cut(s) 896, 1041
TspRI CASTG 7 cut(s) 66, 159, 459, 513, 771, 1201, 1465
Tth111I GACNNNGTC 1 cut(s) 673
Van91I CCANNNNNTGG 1 cut(s) 1612
Vha464I CTTAAG 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 607
XagI CCTNNNNNAGG 1 cut(s) 1339
XapI RAATTY 1 cut(s) 1538
XbaI TCTAGA 1 cut(s) 1385
XceI RCATGY 1 cut(s) 1368
XhoI CTCGAG 1 cut(s) 308
XmiI GTMKAC 2 cut(s) 502, 915
XspI CTAG 5 cut(s) 716, 737, 1223, 1236, 1386
ZrmI AGTACT 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.