Rmu_sc0002958.1_g000002

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002958.1
OG0000128
Physical Location & Seq
Reverse (-)
1075 .. 1932
858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002958.1_g000002.1.cds

Sequence Viewer

Length: 858 bp
atgcatcgtgttaaggatccgaaatactacaagtatcatcgactcgttagtcacccattggagaaatgctttgttctgaaagatttaataatgaatcttgccaagcaagggaggatcgagctggatgtcgacgatgttgctgaggtaaactgcactaccatcgtgtttggttcattcgagcctgccccgttgccttctcttccaatgaaagcagcatatcagctttcgagaaaaccatgcatgaagtcaaagttggaggaaatcaatccaacccagcaagcgagcctcgcacctgttgcaacccctaaaattgactcagttgttgatgatgagagatggatacttgtcactcgaaagaaggcacgcaagagcccatcgccatgtgtacctgtcactcaagcaaaatacaagcagtcacaagaaaatcgtcaatgtctcgagaaaggtaagacaagatttatcaaggaaaggggtaatccttttgttcgaagaccccatggtgtggcttcgtcaacaacagcctttcccaagaaaggcaacaaacaagaaaaggtgagagctgcccacatgaccacaagctatgaatttggttcgaaggattctgccaaggctgagtcaagcacaatcaatgcgaaccaaacgttaaaggagaacgaggtgttgaagcagctaaaagacctagcatttcactttagcatctctgatctactacaattgccaaaatcgacaagaggtgctttggtacaggtgttgatcatgggcaagaactctacagacattaacaaggtgaaaccgaaggaatgcatcacgtgtgttgcagattgtaatgccatccactttacggatgaagacctttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 Retrotrans_gag

Protein Analysis

285

Amino Acids

32.06

Weight (kDa)

9.42

Isoelectric Point (pI)

41.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 48
AccB7I CCANNNNNTGG 1 cut(s) 502
AccI GTMKAC 1 cut(s) 129
AclI AACGTT 1 cut(s) 641
AclWI GGATC 3 cut(s) 11, 24, 122
AcsI RAATTY 1 cut(s) 584
AcvI CACGTG 1 cut(s) 810
AfaI GTAC 2 cut(s) 387, 744
AfiI CCNNNNNNNGG 4 cut(s) 108, 502, 533, 841
AflIII ACRYGT 1 cut(s) 809
AgsI TTSAA 1 cut(s) 664
AjuI GAANNNNNNNTTGG 2 cut(s) 236, 268
AluBI AGCT 5 cut(s) 121, 223, 560, 579, 670
AluI AGCT 5 cut(s) 121, 223, 560, 579, 670
Alw26I GTCTC 1 cut(s) 440
AlwI GGATC 3 cut(s) 11, 24, 122
Ama87I CYCGRG 1 cut(s) 437
ApeKI GCWGC 3 cut(s) 212, 560, 667
ApoI RAATTY 1 cut(s) 584
AsuHPI GGTGA 3 cut(s) 44, 565, 799
AsuII TTCGAA 2 cut(s) 487, 593
AvaI CYCGRG 1 cut(s) 437
BaeI ACNNNNGTAYC 2 cut(s) 734, 767
BamHI GGATCC 1 cut(s) 16
BanII GRGCYC 1 cut(s) 374
BbrPI CACGTG 1 cut(s) 810
BbsI GAAGAC 1 cut(s) 496
BbvCI CCTCAGC 1 cut(s) 141
BbvI GCAGC 3 cut(s) 224, 547, 679
BccI CCATC 4 cut(s) 167, 330, 382, 839
BcgI CGANNNNNNTGC 4 cut(s) 119, 142, 153, 176
BciVI GTATCC 1 cut(s) 333
BclI TGATCA 1 cut(s) 753
BcoDI GTCTC 1 cut(s) 440
BfaI CTAG 1 cut(s) 680
BfmI CTRYAG 1 cut(s) 771
BfuI GTATCC 1 cut(s) 333
BisI GCNGC 3 cut(s) 213, 561, 668
BlsI GCNGC 3 cut(s) 214, 562, 669
BmeT110I CYCGRG 1 cut(s) 437
BmiI GGNNCC 1 cut(s) 18
BmsI GCATC 3 cut(s) 13, 705, 813
BpiI GAAGAC 1 cut(s) 496
Bpu10I CCTNAGC 1 cut(s) 141
Bpu14I TTCGAA 2 cut(s) 487, 593
BpuEI CTTGAG 1 cut(s) 381
BsaAI YACGTR 1 cut(s) 810
BsaJI CCNNGG 2 cut(s) 496, 606
Bsc4I CCNNNNNNNGG 4 cut(s) 108, 502, 533, 841
BseDI CCNNGG 2 cut(s) 496, 606
BseGI GGATG 3 cut(s) 130, 831, 850
BseLI CCNNNNNNNGG 4 cut(s) 108, 502, 533, 841
BseMII CTCAG 3 cut(s) 132, 330, 603
BseXI GCAGC 3 cut(s) 224, 547, 679
BseYI CCCAGC 1 cut(s) 273
BsgI GTGCAG 1 cut(s) 136
BsiHKCI CYCGRG 1 cut(s) 437
BslI CCNNNNNNNGG 4 cut(s) 108, 502, 533, 841
BsmAI GTCTC 1 cut(s) 440
BsmI GAATGC 1 cut(s) 806
BsoBI CYCGRG 1 cut(s) 437
Bsp119I TTCGAA 2 cut(s) 487, 593
Bsp1286I GDGCHC 1 cut(s) 374
Bsp143I GATC 4 cut(s) 16, 114, 703, 753
Bsp19I CCATGG 1 cut(s) 496
BspCNI CTCAG 3 cut(s) 133, 329, 604
BspLI GGNNCC 1 cut(s) 18
BspPI GGATC 3 cut(s) 11, 24, 122
BspT104I TTCGAA 2 cut(s) 487, 593
BssECI CCNNGG 2 cut(s) 496, 606
BssMI GATC 4 cut(s) 16, 114, 703, 753
BssT1I CCWWGG 2 cut(s) 496, 606
Bst6I CTCTTC 1 cut(s) 204
BstAPI GCANNNNNTGC 1 cut(s) 296
BstBAI YACGTR 1 cut(s) 810
BstBI TTCGAA 2 cut(s) 487, 593
BstC8I GCNNGC 4 cut(s) 183, 279, 283, 364
BstDEI CTNAG 3 cut(s) 141, 316, 612
BstDSI CCRYGG 1 cut(s) 496
BstF5I GGATG 3 cut(s) 130, 831, 850
BstKTI GATC 4 cut(s) 19, 117, 706, 756
BstMAI GTCTC 1 cut(s) 440
BstMBI GATC 4 cut(s) 16, 114, 703, 753
BstMWI GCNNNNNNNGC 2 cut(s) 287, 296
BstSFI CTRYAG 1 cut(s) 771
BstV1I GCAGC 3 cut(s) 224, 547, 679
BstV2I GAAGAC 1 cut(s) 496
BstX2I RGATCY 1 cut(s) 16
BstYI RGATCY 1 cut(s) 16
BsuI GTATCC 1 cut(s) 333
BtgI CCRYGG 1 cut(s) 496
BtgZI GCGATG 1 cut(s) 360
BtsCI GGATG 3 cut(s) 130, 831, 850
Cac8I GCNNGC 4 cut(s) 183, 279, 283, 364
Csp6I GTAC 2 cut(s) 386, 743
CviAII CATG 6 cut(s) 237, 241, 381, 497, 568, 757
CviQI GTAC 2 cut(s) 386, 743
DdeI CTNAG 3 cut(s) 141, 316, 612
DpnI GATC 4 cut(s) 18, 116, 705, 755
DpnII GATC 4 cut(s) 16, 114, 703, 753
DrdI GACNNNNNNGTC 1 cut(s) 48
DseDI GACNNNNNNGTC 1 cut(s) 48
Eam1104I CTCTTC 1 cut(s) 204
EarI CTCTTC 1 cut(s) 204
Eco130I CCWWGG 2 cut(s) 496, 606
Eco24I GRGCYC 1 cut(s) 374
Eco72I CACGTG 1 cut(s) 810
Eco88I CYCGRG 1 cut(s) 437
EcoT14I CCWWGG 2 cut(s) 496, 606
EcoT22I ATGCAT 3 cut(s) 6, 242, 806
EcoT38I GRGCYC 1 cut(s) 374
ErhI CCWWGG 2 cut(s) 496, 606
FaeI CATG 6 cut(s) 240, 244, 384, 500, 571, 760
FaiI YATR 8 cut(s) 217, 238, 242, 382, 498, 569, 582, 758
FalI AAGNNNNNCTT 2 cut(s) 721, 753
FatI CATG 6 cut(s) 236, 240, 380, 496, 567, 756
FbaI TGATCA 1 cut(s) 753
FblI GTMKAC 1 cut(s) 129
Fnu4HI GCNGC 3 cut(s) 213, 561, 668
FokI GGATG 2 cut(s) 137, 818
FriOI GRGCYC 1 cut(s) 374
Fsp4HI GCNGC 3 cut(s) 213, 561, 668
FspBI CTAG 1 cut(s) 680
GluI GCNGC 3 cut(s) 213, 561, 668
GsaI CCCAGC 1 cut(s) 277
Hin1II CATG 6 cut(s) 240, 244, 384, 500, 571, 760
HincII GTYRAC 2 cut(s) 130, 513
HindII GTYRAC 2 cut(s) 130, 513
HinfI GANTC 5 cut(s) 42, 94, 314, 599, 614
HphI GGTGA 3 cut(s) 44, 565, 799
Hpy166II GTNNAC 4 cut(s) 130, 148, 386, 513
Hpy188I TCNGA 3 cut(s) 21, 78, 703
Hpy188III TCNNGA 3 cut(s) 228, 437, 439
Hpy8I GTNNAC 4 cut(s) 130, 148, 386, 513
Hpy99I CGWCG 1 cut(s) 134
HpyAV CCTTC 4 cut(s) 204, 352, 589, 790
HpyCH4IV ACGT 2 cut(s) 641, 809
HpyCH4V TGCA 6 cut(s) 4, 153, 240, 299, 804, 818
HpyF10VI GCNNNNNNNGC 2 cut(s) 287, 296
HpyF3I CTNAG 3 cut(s) 141, 316, 612
HpySE526I ACGT 2 cut(s) 641, 809
Hsp92II CATG 6 cut(s) 240, 244, 384, 500, 571, 760
Ksp22I TGATCA 1 cut(s) 753
Kzo9I GATC 4 cut(s) 16, 114, 703, 753
LpnPI CCDG 6 cut(s) 107, 195, 287, 306, 402, 731
Lsp1109I GCAGC 3 cut(s) 224, 547, 679
LweI GCATC 3 cut(s) 13, 705, 813
MaeI CTAG 1 cut(s) 680
MaeII ACGT 2 cut(s) 641, 809
MaeIII GTNAC 4 cut(s) 50, 346, 391, 414
MalI GATC 4 cut(s) 18, 116, 705, 755
MboI GATC 4 cut(s) 16, 114, 703, 753
MboII GAAGA 2 cut(s) 191, 501
MfeI CAATTG 1 cut(s) 713
MflI RGATCY 1 cut(s) 16
MhlI GDGCHC 1 cut(s) 374
MluCI AATT 3 cut(s) 309, 584, 713
MlyI GAGTC 3 cut(s) 36, 308, 623
MmeI TCCRAC 2 cut(s) 234, 293
MnlI CCTC 6 cut(s) 105, 136, 250, 296, 649, 725
Mph1103I ATGCAT 3 cut(s) 6, 242, 806
MseI TTAA 4 cut(s) 12, 86, 644, 780
MslI CAYNNNNRTG 1 cut(s) 379
MunI CAATTG 1 cut(s) 713
Mva1269I GAATGC 1 cut(s) 806
MwoI GCNNNNNNNGC 2 cut(s) 287, 296
NcoI CCATGG 1 cut(s) 496
NdeII GATC 4 cut(s) 16, 114, 703, 753
NlaIII CATG 6 cut(s) 240, 244, 384, 500, 571, 760
NlaIV GGNNCC 1 cut(s) 18
NmuCI GTSAC 4 cut(s) 50, 346, 391, 414
NsiI ATGCAT 3 cut(s) 6, 242, 806
NspV TTCGAA 2 cut(s) 487, 593
PaeR7I CTCGAG 1 cut(s) 437
PctI GAATGC 1 cut(s) 806
PfeI GAWTC 2 cut(s) 94, 599
PflMI CCANNNNNTGG 1 cut(s) 502
PkrI GCNGC 3 cut(s) 214, 562, 669
PleI GAGTC 3 cut(s) 36, 308, 622
PmaCI CACGTG 1 cut(s) 810
PmlI CACGTG 1 cut(s) 810
PpsI GAGTC 3 cut(s) 36, 308, 622
Ppu21I YACGTR 1 cut(s) 810
Psp1406I AACGTT 1 cut(s) 641
PspCI CACGTG 1 cut(s) 810
PspFI CCCAGC 1 cut(s) 273
PspN4I GGNNCC 1 cut(s) 18
PsuI RGATCY 1 cut(s) 16
RsaI GTAC 2 cut(s) 387, 744
RsaNI GTAC 2 cut(s) 386, 743
RseI CAYNNNNRTG 1 cut(s) 379
SalI GTCGAC 1 cut(s) 128
SaqAI TTAA 4 cut(s) 12, 86, 644, 780
SatI GCNGC 3 cut(s) 213, 561, 668
Sau3AI GATC 4 cut(s) 16, 114, 703, 753
SchI GAGTC 3 cut(s) 36, 308, 623
SduI GDGCHC 1 cut(s) 374
SfaNI GCATC 3 cut(s) 13, 705, 813
SfcI CTRYAG 1 cut(s) 771
Sfr274I CTCGAG 1 cut(s) 437
SfuI TTCGAA 2 cut(s) 487, 593
SlaI CTCGAG 1 cut(s) 437
SmiMI CAYNNNNRTG 1 cut(s) 379
SmlI CTYRAG 2 cut(s) 396, 437
SmoI CTYRAG 2 cut(s) 396, 437
Sse9I AATT 3 cut(s) 309, 584, 713
SspMI CTAG 1 cut(s) 680
StyI CCWWGG 2 cut(s) 496, 606
TaiI ACGT 2 cut(s) 644, 812
TasI AATT 3 cut(s) 309, 584, 713
TfiI GAWTC 2 cut(s) 94, 599
Tru1I TTAA 4 cut(s) 12, 86, 644, 780
Tru9I TTAA 4 cut(s) 12, 86, 644, 780
TseFI GTSAC 4 cut(s) 50, 346, 391, 414
TseI GCWGC 3 cut(s) 212, 560, 667
Tsp45I GTSAC 4 cut(s) 50, 346, 391, 414
TspDTI ATGAA 5 cut(s) 107, 162, 221, 257, 597
TspGWI ACGGA 1 cut(s) 857
Van91I CCANNNNNTGG 1 cut(s) 502
XapI RAATTY 1 cut(s) 584
XhoI CTCGAG 1 cut(s) 437
XmiI GTMKAC 1 cut(s) 129
XspI CTAG 1 cut(s) 680
Zsp2I ATGCAT 3 cut(s) 6, 242, 806
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.