pycom09g09870

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0000128
Physical Location & Seq
Forward (+)
7987203 .. 7988111
909 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g09870.1

Sequence Viewer

Length: 909 bp
ATGCAGTGGGGACTACACTACATCCTTCAAGGCATCAAACCACGAACATTTGAGGAGTTAGCCACCCGCGCCCATGATATGGAGTTAAGCATCACCCGTCATGGGAAGAAAGAACAGATCGCCGACTACAAGAATGACAAAGTTTTGGGGCCAAAGGTGGATAAGGCTACGTCGAAACCCACCAAGGAAGCAATGACGGTCAACACAACTCCAGTCAAAATCCATACACGAAGCAAGGCAATTCAAACCGAAGCTTTTCGTGATCAAGAGATACGTAGACGCACTTTGAAGGAGCTTGAGGAGAAGACTTATCCATTCCCCGACTCTGACGTGGTTGCCATGTTGAAAGACTTGCTTGACAAAAAGGTGATTGACCTACCTGAGTGCAAACGGCCAGAAGATATGAACCGTACTGACAGTCCAAGGTACTGTAAATTTCACCGCTTCATTAGTCATCCGACGGAAAAGTGCTTTGTGCTAAAAGATCTCATCATGAAGTTGGCTCAGAAAGGGATCATCGAGCTAGATCTTAATGATGTGGTGAAGTCAGACTATACCACCGTCACTTCTGGCTCTTTGAACTCAAAATCTTCACCTCAACCGCTGGGGGCATGCTCCAAAACCATGTCAGTCAAGTCAAGTGAAGTTGAAGGATGGACTTATGTCACTCCAAAGAAAATGCACAAGAAACATAGGTCTCATCCACAAGTTCACCAATCGGAAAGGGGGCAAAGCAGCTACCGTCAACCTTCAAAGCCACATGAAAATGTTGAGGATGATGAAATTATGACACAAAGATCGTCCGTTACCATCACGATGCGCGATTTCTTCCCAGAAGACTTCTTCAATTACTCGGTCAAGGCTCCTTCCTATAAAGATTGCAAGGAATGCCTCTCTAAGATCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotrans_gag

Protein Analysis

303

Amino Acids

34.87

Weight (kDa)

9.08

Isoelectric Point (pI)

51.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 79
AccI GTMKAC 1 cut(s) 277
AccII CGCG 2 cut(s) 69, 822
AciI CCGC 3 cut(s) 67, 442, 602
AclWI GGATC 1 cut(s) 521
AcoI YGGCCR 1 cut(s) 392
AcsI RAATTY 1 cut(s) 434
AfaI GTAC 2 cut(s) 412, 428
AfiI CCNNNNNNNGG 2 cut(s) 79, 102
AgsI TTSAA 8 cut(s) 29, 245, 289, 346, 580, 650, 753, 847
AjiI CACGTC 1 cut(s) 331
AluBI AGCT 4 cut(s) 254, 295, 523, 738
AluI AGCT 4 cut(s) 254, 295, 523, 738
Alw26I GTCTC 1 cut(s) 702
AlwI GGATC 1 cut(s) 521
AoxI GGCC 2 cut(s) 149, 392
ApeKI GCWGC 1 cut(s) 735
ApoI RAATTY 1 cut(s) 434
Asp700I GAANNNNTTC 1 cut(s) 255
AspLEI GCGC 2 cut(s) 71, 822
AspS9I GGNCC 1 cut(s) 149
AsuHPI GGTGA 6 cut(s) 85, 379, 431, 553, 585, 704
BbsI GAAGAC 2 cut(s) 311, 843
BbvI GCAGC 1 cut(s) 747
BccI CCATC 2 cut(s) 648, 818
BceAI ACGGC 1 cut(s) 407
BclI TGATCA 1 cut(s) 262
BcoDI GTCTC 1 cut(s) 702
BfaI CTAG 1 cut(s) 524
BglII AGATCT 2 cut(s) 484, 526
BisI GCNGC 1 cut(s) 736
BlsI GCNGC 1 cut(s) 737
BmgBI CACGTC 1 cut(s) 331
BmgT120I GGNCC 1 cut(s) 149
BmiI GGNNCC 2 cut(s) 150, 864
BmsI GCATC 3 cut(s) 42, 99, 807
BoxI GACNNNNGTC 1 cut(s) 662
BpiI GAAGAC 2 cut(s) 311, 843
BpmI CTGGAG 1 cut(s) 195
BpuEI CTTGAG 1 cut(s) 317
BsaAI YACGTR 1 cut(s) 275
BsaI GGTCTC 1 cut(s) 702
BsaJI CCNNGG 2 cut(s) 183, 422
Bsc4I CCNNNNNNNGG 2 cut(s) 79, 102
Bse1I ACTGG 1 cut(s) 212
Bse3DI GCAATG 1 cut(s) 198
BseDI CCNNGG 2 cut(s) 183, 422
BseGI GGATG 5 cut(s) 21, 454, 659, 700, 781
BseLI CCNNNNNNNGG 2 cut(s) 79, 102
BseMI GCAATG 1 cut(s) 198
BseMII CTCAG 2 cut(s) 372, 518
BseNI ACTGG 1 cut(s) 212
BseRI GAGGAG 2 cut(s) 68, 314
BseXI GCAGC 1 cut(s) 747
BseYI CCCAGC 1 cut(s) 604
Bsh1236I CGCG 2 cut(s) 69, 822
BshFI GGCC 2 cut(s) 151, 394
BslFI GGGAC 1 cut(s) 24
BslI CCNNNNNNNGG 2 cut(s) 79, 102
BsmAI GTCTC 1 cut(s) 702
BsmFI GGGAC 1 cut(s) 24
BsmI GAATGC 1 cut(s) 893
BsnI GGCC 2 cut(s) 151, 394
Bso31I GGTCTC 1 cut(s) 702
Bsp143I GATC 7 cut(s) 117, 262, 484, 513, 526, 797, 900
BspACI CCGC 3 cut(s) 67, 442, 602
BspANI GGCC 2 cut(s) 151, 394
BspCNI CTCAG 2 cut(s) 373, 517
BspFNI CGCG 2 cut(s) 69, 822
BspHI TCATGA 1 cut(s) 492
BspLI GGNNCC 2 cut(s) 150, 864
BspPI GGATC 1 cut(s) 521
BspTNI GGTCTC 1 cut(s) 702
BsrDI GCAATG 1 cut(s) 198
BsrI ACTGG 1 cut(s) 212
BssECI CCNNGG 2 cut(s) 183, 422
BssMI GATC 7 cut(s) 117, 262, 484, 513, 526, 797, 900
BssT1I CCWWGG 2 cut(s) 183, 422
Bst4CI ACNGT 6 cut(s) 199, 410, 419, 431, 562, 743
BstAPI GCANNNNNTGC 1 cut(s) 888
BstBAI YACGTR 1 cut(s) 275
BstC8I GCNNGC 1 cut(s) 613
BstDEI CTNAG 3 cut(s) 381, 504, 897
BstF5I GGATG 5 cut(s) 21, 454, 659, 700, 781
BstFNI CGCG 2 cut(s) 69, 822
BstHHI GCGC 2 cut(s) 71, 822
BstKTI GATC 7 cut(s) 120, 265, 487, 516, 529, 800, 903
BstMAI GTCTC 1 cut(s) 702
BstMBI GATC 7 cut(s) 117, 262, 484, 513, 526, 797, 900
BstMWI GCNNNNNNNGC 2 cut(s) 68, 888
BstNSI RCATGY 1 cut(s) 615
BstPAI GACNNNNGTC 1 cut(s) 662
BstSNI TACGTA 1 cut(s) 275
BstUI CGCG 2 cut(s) 69, 822
BstV1I GCAGC 1 cut(s) 747
BstV2I GAAGAC 2 cut(s) 311, 843
BstX2I RGATCY 2 cut(s) 484, 526
BstYI RGATCY 2 cut(s) 484, 526
BsuRI GGCC 2 cut(s) 151, 394
BtrI CACGTC 1 cut(s) 331
BtsCI GGATG 5 cut(s) 21, 454, 659, 700, 781
BtsI GCAGTG 1 cut(s) 11
BtsIMutI CAGTG 1 cut(s) 11
Cac8I GCNNGC 1 cut(s) 613
CciI TCATGA 1 cut(s) 492
CfoI GCGC 2 cut(s) 71, 822
Cfr13I GGNCC 1 cut(s) 149
CseI GACGC 1 cut(s) 288
Csp6I GTAC 2 cut(s) 411, 427
CviAII CATG 7 cut(s) 74, 101, 340, 493, 612, 625, 761
CviQI GTAC 2 cut(s) 411, 427
DdeI CTNAG 3 cut(s) 381, 504, 897
DpnI GATC 7 cut(s) 119, 264, 486, 515, 528, 799, 902
DpnII GATC 7 cut(s) 117, 262, 484, 513, 526, 797, 900
EaeI YGGCCR 1 cut(s) 392
Eco105I TACGTA 1 cut(s) 275
Eco130I CCWWGG 2 cut(s) 183, 422
Eco31I GGTCTC 1 cut(s) 702
EcoT14I CCWWGG 2 cut(s) 183, 422
ErhI CCWWGG 2 cut(s) 183, 422
FaeI CATG 7 cut(s) 77, 104, 343, 496, 615, 628, 764
FalI AAGNNNNNCTT 2 cut(s) 339, 371
FaqI GGGAC 1 cut(s) 24
FatI CATG 7 cut(s) 73, 100, 339, 492, 611, 624, 760
FauI CCCGC 1 cut(s) 74
FbaI TGATCA 1 cut(s) 262
FblI GTMKAC 1 cut(s) 277
Fnu4HI GCNGC 1 cut(s) 736
FokI GGATG 5 cut(s) 8, 441, 666, 687, 788
Fsp4HI GCNGC 1 cut(s) 736
FspBI CTAG 1 cut(s) 524
GlaI GCGC 2 cut(s) 70, 821
GluI GCNGC 1 cut(s) 736
GsaI CCCAGC 1 cut(s) 608
GsuI CTGGAG 1 cut(s) 195
HaeIII GGCC 2 cut(s) 151, 394
HgaI GACGC 1 cut(s) 288
HhaI GCGC 2 cut(s) 71, 822
Hin1II CATG 7 cut(s) 77, 104, 343, 496, 615, 628, 764
Hin6I GCGC 2 cut(s) 69, 820
HinP1I GCGC 2 cut(s) 69, 820
HincII GTYRAC 2 cut(s) 202, 746
HindII GTYRAC 2 cut(s) 202, 746
HindIII AAGCTT 1 cut(s) 252
HinfI GANTC 1 cut(s) 323
HphI GGTGA 6 cut(s) 85, 379, 431, 553, 585, 704
Hpy166II GTNNAC 4 cut(s) 202, 278, 712, 746
Hpy188I TCNGA 5 cut(s) 328, 459, 507, 550, 721
Hpy188III TCNNGA 4 cut(s) 260, 266, 493, 814
Hpy8I GTNNAC 4 cut(s) 202, 278, 712, 746
Hpy99I CGWCG 2 cut(s) 175, 463
HpyAV CCTTC 5 cut(s) 35, 283, 644, 759, 876
HpyCH4III ACNGT 6 cut(s) 199, 410, 419, 431, 562, 743
HpyCH4IV ACGT 3 cut(s) 170, 274, 330
HpyCH4V TGCA 4 cut(s) 4, 387, 682, 882
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 888
HpyF3I CTNAG 3 cut(s) 381, 504, 897
HpySE526I ACGT 3 cut(s) 170, 274, 330
Hsp92II CATG 7 cut(s) 77, 104, 343, 496, 615, 628, 764
HspAI GCGC 2 cut(s) 69, 820
Ksp22I TGATCA 1 cut(s) 262
Kzo9I GATC 7 cut(s) 117, 262, 484, 513, 526, 797, 900
LmnI GCTCC 3 cut(s) 292, 620, 868
LpnPI CCDG 6 cut(s) 225, 393, 408, 555, 590, 846
Lsp1109I GCAGC 1 cut(s) 747
LweI GCATC 3 cut(s) 42, 99, 807
MaeI CTAG 1 cut(s) 524
MaeII ACGT 3 cut(s) 170, 274, 330
MaeIII GTNAC 3 cut(s) 562, 664, 805
MalI GATC 7 cut(s) 119, 264, 486, 515, 528, 799, 902
MboI GATC 7 cut(s) 117, 262, 484, 513, 526, 797, 900
MboII GAAGA 7 cut(s) 118, 316, 410, 582, 820, 835, 848
MflI RGATCY 2 cut(s) 484, 526
MluCI AATT 4 cut(s) 240, 434, 783, 847
MlyI GAGTC 1 cut(s) 317
MmeI TCCRAC 1 cut(s) 482
MnlI CCTC 5 cut(s) 46, 292, 606, 766, 902
MroXI GAANNNNTTC 1 cut(s) 255
MseI TTAA 2 cut(s) 86, 531
MslI CAYNNNNRTG 2 cut(s) 765, 815
MspA1I CMGCKG 1 cut(s) 604
Mva1269I GAATGC 1 cut(s) 893
MvnI CGCG 2 cut(s) 69, 822
MwoI GCNNNNNNNGC 2 cut(s) 68, 888
NdeII GATC 7 cut(s) 117, 262, 484, 513, 526, 797, 900
NlaIII CATG 7 cut(s) 77, 104, 343, 496, 615, 628, 764
NlaIV GGNNCC 2 cut(s) 150, 864
NmuCI GTSAC 2 cut(s) 562, 664
NspI RCATGY 1 cut(s) 615
PaeI GCATGC 1 cut(s) 615
PagI TCATGA 1 cut(s) 492
PctI GAATGC 1 cut(s) 893
PdmI GAANNNNTTC 1 cut(s) 255
PflMI CCANNNNNTGG 1 cut(s) 79
PkrI GCNGC 1 cut(s) 737
PleI GAGTC 1 cut(s) 317
PpsI GAGTC 1 cut(s) 317
Ppu21I YACGTR 1 cut(s) 275
PshAI GACNNNNGTC 1 cut(s) 662
PspFI CCCAGC 1 cut(s) 604
PspN4I GGNNCC 2 cut(s) 150, 864
PspPI GGNCC 1 cut(s) 149
PsuI RGATCY 2 cut(s) 484, 526
RsaI GTAC 2 cut(s) 412, 428
RsaNI GTAC 2 cut(s) 411, 427
RseI CAYNNNNRTG 2 cut(s) 765, 815
SaqAI TTAA 2 cut(s) 86, 531
SatI GCNGC 1 cut(s) 736
Sau3AI GATC 7 cut(s) 117, 262, 484, 513, 526, 797, 900
Sau96I GGNCC 1 cut(s) 149
SchI GAGTC 1 cut(s) 317
SfaNI GCATC 3 cut(s) 42, 99, 807
SmiMI CAYNNNNRTG 2 cut(s) 765, 815
SmlI CTYRAG 1 cut(s) 296
SmoI CTYRAG 1 cut(s) 296
SnaBI TACGTA 1 cut(s) 275
SphI GCATGC 1 cut(s) 615
Sse9I AATT 4 cut(s) 240, 434, 783, 847
SsiI CCGC 3 cut(s) 67, 442, 602
SspMI CTAG 1 cut(s) 524
StyI CCWWGG 2 cut(s) 183, 422
TaaI ACNGT 6 cut(s) 199, 410, 419, 431, 562, 743
TaiI ACGT 3 cut(s) 173, 277, 333
TaqI TCGA 2 cut(s) 173, 519
TaqII GACCGA 1 cut(s) 844
TasI AATT 4 cut(s) 240, 434, 783, 847
Tru1I TTAA 2 cut(s) 86, 531
Tru9I TTAA 2 cut(s) 86, 531
TseFI GTSAC 2 cut(s) 562, 664
TseI GCWGC 1 cut(s) 735
Tsp45I GTSAC 2 cut(s) 562, 664
TspDTI ATGAA 5 cut(s) 419, 436, 509, 777, 795
TspGWI ACGGA 2 cut(s) 476, 793
Van91I CCANNNNNTGG 1 cut(s) 79
XapI RAATTY 1 cut(s) 434
XceI RCATGY 1 cut(s) 615
XmiI GTMKAC 1 cut(s) 277
XmnI GAANNNNTTC 1 cut(s) 255
XspI CTAG 1 cut(s) 524
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.