Rmu_ssc0000170.1_g000024

Retrotransposon gag protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000170.1
Physical Location & Seq
Reverse (-)
106882 .. 107340
459 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000170.1_g000024.1.cds

Sequence Viewer

Length: 459 bp
atggagtccttggcgatcacaactcctgtcaagatcacaacacgagtcaagtcaaacaatcaaaacaagttggagccgactcatgatcaaacaaggcggcgcactcttaaagagctagaagctaaaagttacccttttccagattccgatgttgctgacatgttggaagacttgcttcaaaagaaagtaattaaactgccagactgcaaacgtctaaaagagatgcatcgcatcaatgaaccaaagtattgcaaataccactgtgtcatcggttacccgacgaagaagtgctttgtgttgaaagacctcatcatgaagcttgcacaacaaggaaaaatctgtttagacattgaagatgacgtggctcaatcaaatcatgctgctatcatctttgatcaacttgaagcagagtcgtcatcgcctttgctgggggcatgctacttgcctaaattgccttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

152

Amino Acids

17.39

Weight (kDa)

8.47

Isoelectric Point (pI)

52.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 97
AfiI CCNNNNNNNGG 1 cut(s) 428
AflIII ACRYGT 1 cut(s) 159
AgsI TTSAA 4 cut(s) 179, 301, 353, 404
AjiI CACGTC 1 cut(s) 361
AluBI AGCT 3 cut(s) 115, 122, 319
AluI AGCT 3 cut(s) 115, 122, 319
ApeKI GCWGC 1 cut(s) 380
AspLEI GCGC 1 cut(s) 102
BauI CACGAG 1 cut(s) 42
BbsI GAAGAC 1 cut(s) 174
BbvI GCAGC 1 cut(s) 367
BclI TGATCA 2 cut(s) 85, 394
BfaI CTAG 1 cut(s) 116
BisI GCNGC 2 cut(s) 98, 381
BlsI GCNGC 2 cut(s) 99, 382
BmgBI CACGTC 1 cut(s) 361
BmiI GGNNCC 1 cut(s) 75
BmsI GCATC 3 cut(s) 213, 235, 240
BpiI GAAGAC 1 cut(s) 174
BsaJI CCNNGG 1 cut(s) 9
Bsc4I CCNNNNNNNGG 1 cut(s) 428
BseDI CCNNGG 1 cut(s) 9
BseLI CCNNNNNNNGG 1 cut(s) 428
BseXI GCAGC 1 cut(s) 367
BseYI CCCAGC 1 cut(s) 427
BslI CCNNNNNNNGG 1 cut(s) 428
Bsp143I GATC 4 cut(s) 15, 33, 85, 394
BspACI CCGC 1 cut(s) 97
BspHI TCATGA 2 cut(s) 82, 312
BspLI GGNNCC 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 4 cut(s) 15, 33, 85, 394
BssSI CACGAG 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 9
Bst2BI CACGAG 1 cut(s) 42
Bst4CI ACNGT 1 cut(s) 263
BstC8I GCNNGC 2 cut(s) 321, 436
BstDEI CTNAG 1 cut(s) 456
BstEII GGTNACC 1 cut(s) 272
BstHHI GCGC 1 cut(s) 102
BstKTI GATC 4 cut(s) 18, 36, 88, 397
BstMBI GATC 4 cut(s) 15, 33, 85, 394
BstMWI GCNNNNNNNGC 1 cut(s) 451
BstNSI RCATGY 2 cut(s) 163, 438
BstPI GGTNACC 1 cut(s) 272
BstV1I GCAGC 1 cut(s) 367
BstV2I GAAGAC 1 cut(s) 174
BtgZI GCGATG 2 cut(s) 212, 402
BtrI CACGTC 1 cut(s) 361
BtsIMutI CAGTG 1 cut(s) 259
Cac8I GCNNGC 2 cut(s) 321, 436
CciI TCATGA 2 cut(s) 82, 312
CfoI GCGC 1 cut(s) 102
CviAII CATG 5 cut(s) 83, 160, 313, 377, 435
CviJI RGCY 5 cut(s) 76, 115, 122, 319, 365
CviKI_1 RGCY 5 cut(s) 76, 115, 122, 319, 365
DdeI CTNAG 1 cut(s) 456
DpnI GATC 4 cut(s) 17, 35, 87, 396
DpnII GATC 4 cut(s) 15, 33, 85, 394
Eco130I CCWWGG 1 cut(s) 9
Eco91I GGTNACC 1 cut(s) 272
EcoO65I GGTNACC 1 cut(s) 272
EcoT14I CCWWGG 1 cut(s) 9
EcoT22I ATGCAT 1 cut(s) 228
ErhI CCWWGG 1 cut(s) 9
FaeI CATG 5 cut(s) 86, 163, 316, 380, 438
FaiI YATR 5 cut(s) 84, 161, 314, 378, 436
FalI AAGNNNNNCTT 6 cut(s) 118, 150, 159, 191, 275, 307
FatI CATG 5 cut(s) 82, 159, 312, 376, 434
FbaI TGATCA 2 cut(s) 85, 394
Fnu4HI GCNGC 2 cut(s) 98, 381
Fsp4HI GCNGC 2 cut(s) 98, 381
FspBI CTAG 1 cut(s) 116
GlaI GCGC 1 cut(s) 101
GluI GCNGC 2 cut(s) 98, 381
GsaI CCCAGC 1 cut(s) 431
HhaI GCGC 1 cut(s) 102
Hin1II CATG 5 cut(s) 86, 163, 316, 380, 438
Hin6I GCGC 1 cut(s) 100
HinP1I GCGC 1 cut(s) 100
HindIII AAGCTT 1 cut(s) 317
HinfI GANTC 5 cut(s) 5, 45, 79, 143, 410
Hpy188I TCNGA 1 cut(s) 148
Hpy188III TCNNGA 4 cut(s) 31, 83, 140, 313
Hpy99I CGWCG 1 cut(s) 283
HpyCH4III ACNGT 1 cut(s) 263
HpyCH4IV ACGT 2 cut(s) 211, 360
HpyCH4V TGCA 4 cut(s) 207, 226, 252, 323
HpyF10VI GCNNNNNNNGC 1 cut(s) 451
HpyF3I CTNAG 1 cut(s) 456
HpySE526I ACGT 2 cut(s) 211, 360
Hsp92II CATG 5 cut(s) 86, 163, 316, 380, 438
HspAI GCGC 1 cut(s) 100
Ksp22I TGATCA 2 cut(s) 85, 394
Kzo9I GATC 4 cut(s) 15, 33, 85, 394
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 4 cut(s) 39, 153, 213, 413
Lsp1109I GCAGC 1 cut(s) 367
LweI GCATC 3 cut(s) 213, 235, 240
MaeI CTAG 1 cut(s) 116
MaeII ACGT 2 cut(s) 211, 360
MaeIII GTNAC 2 cut(s) 128, 272
MalI GATC 4 cut(s) 17, 35, 87, 396
MboI GATC 4 cut(s) 15, 33, 85, 394
MboII GAAGA 3 cut(s) 179, 295, 365
MluCI AATT 2 cut(s) 189, 449
MlyI GAGTC 4 cut(s) 14, 54, 73, 419
MmeI TCCRAC 2 cut(s) 51, 144
MnlI CCTC 1 cut(s) 317
Mph1103I ATGCAT 1 cut(s) 228
MseI TTAA 2 cut(s) 108, 192
MwoI GCNNNNNNNGC 1 cut(s) 451
NdeII GATC 4 cut(s) 15, 33, 85, 394
NlaIII CATG 5 cut(s) 86, 163, 316, 380, 438
NlaIV GGNNCC 1 cut(s) 75
NsiI ATGCAT 1 cut(s) 228
NspI RCATGY 2 cut(s) 163, 438
PaeI GCATGC 1 cut(s) 438
PagI TCATGA 2 cut(s) 82, 312
PciI ACATGT 1 cut(s) 159
PfeI GAWTC 1 cut(s) 143
PkrI GCNGC 2 cut(s) 99, 382
PleI GAGTC 4 cut(s) 13, 53, 73, 418
PpsI GAGTC 4 cut(s) 13, 53, 73, 418
PscI ACATGT 1 cut(s) 159
PspEI GGTNACC 1 cut(s) 272
PspFI CCCAGC 1 cut(s) 427
PspN4I GGNNCC 1 cut(s) 75
SaqAI TTAA 2 cut(s) 108, 192
SatI GCNGC 2 cut(s) 98, 381
Sau3AI GATC 4 cut(s) 15, 33, 85, 394
SchI GAGTC 4 cut(s) 14, 54, 73, 419
SetI ASST 6 cut(s) 117, 124, 214, 309, 321, 363
SfaNI GCATC 3 cut(s) 213, 235, 240
SphI GCATGC 1 cut(s) 438
Sse9I AATT 2 cut(s) 189, 449
SsiI CCGC 1 cut(s) 97
SspMI CTAG 1 cut(s) 116
StyI CCWWGG 1 cut(s) 9
TaaI ACNGT 1 cut(s) 263
TaiI ACGT 2 cut(s) 214, 363
TasI AATT 2 cut(s) 189, 449
TauI GCSGC 1 cut(s) 100
TfiI GAWTC 1 cut(s) 143
Tru1I TTAA 2 cut(s) 108, 192
Tru9I TTAA 2 cut(s) 108, 192
TscAI CASTG 1 cut(s) 266
TseI GCWGC 1 cut(s) 380
TspDTI ATGAA 2 cut(s) 252, 329
TspRI CASTG 1 cut(s) 266
XceI RCATGY 2 cut(s) 163, 438
XspI CTAG 1 cut(s) 116
Zsp2I ATGCAT 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.