pycom10g08060

Helicase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0000128
Physical Location & Seq
Forward (+)
10314268 .. 10315266
999 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g08060.1

Sequence Viewer

Length: 999 bp
ATGACCACTGGAGCAACTTCAATCGAGGAGCAGCTAGCTCAGATGAATGAAGCAATCGCAAAGCTCACACGGACTGTGGAAGAGAAGGACTTGCAGATTGCCGCACTTGTCAACCAACTAGATGCGCTGCCCGACGTGAAAGTCGACCCAAATATTGGCCTATTAAAGAAAGAAGACGACGAAGAAGAGGAGCCACCAGCGGAGAAAGTTGAAGAGAAGCCGAAGCTAGACCAAGCAACGGCATTCATGGGATCTCTCTCTATCCAGCAGCTACAGGAGATGATCGCAAACACTATCAAGACACAGTACGAAGGAAGCTCGCATGACTCTGTACTATACTCAAAGCCTTACTCCAAGAAGATTGATGCTTTGAAGATGCCAAGGGGTTATCAACCCCCAAAATTCATGCAGTTCGATGGAAAAGGCAACCCGAAGCAACATGTCGCCCATTTCGTTGAAACTTGCAACAATGCTGGGACAGAGGGAGACTACCTCGTCAAACAGTTCGTGCGTTCGCTGAAAAGTAACGCTTTTGACTGGTACACTGACCTCGAACCTGAGTCTATCAACAGTTGGGACCAGCTAGAAAGGGAATTCCTCAACCGTTTCTACAGCACTCGTCGTACTGTAAGCATGTTAGAGCTGACCAGTACGAAACAGTGGAAAGATGAACCTGTCGTCGACTACATAAATAGATGGCGTTCTTTAAGTCTGGATTGCAAAGATCGGCTTTCTGAAACCTCTGCCATTGAGATGTGCGTTCAAGGCATGCAGTGGGGACTACACTACATCCTTCAAGGCATCAAACCACGAACATTTGAGGAGTTAGCCACTCGCGCCCATGATATGGAGTTAAGCATCACCCGTCATGGGAAGAAAGAACAGATCGCCGACTACAAGAATGACAAAGTTTTGGGGCCAAAGGTGGATAAGGCTACGTGGAAACCCACCAAGGAAGCAATGACGGTCAACACAACTCCAGTCAAAGTCCATACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Helitron_like_N PIF1

Protein Analysis

333

Amino Acids

37.99

Weight (kDa)

5.55

Isoelectric Point (pI)

35.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotrans_gag PF03732 169 - 258 4.2e-14 Retrotransposon gag protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 140, 494
AccB7I CCANNNNNTGG 2 cut(s) 155, 847
AccI GTMKAC 2 cut(s) 144, 681
AccII CGCG 1 cut(s) 837
AciI CCGC 2 cut(s) 102, 200
AclWI GGATC 1 cut(s) 259
AcsI RAATTY 2 cut(s) 401, 593
AfaI GTAC 5 cut(s) 308, 333, 542, 625, 652
AfiI CCNNNNNNNGG 4 cut(s) 155, 238, 847, 870
AflIII ACRYGT 1 cut(s) 439
AgsI TTSAA 6 cut(s) 21, 212, 373, 458, 764, 797
AjiI CACGTC 1 cut(s) 136
AluBI AGCT 8 cut(s) 34, 38, 64, 226, 271, 318, 583, 643
AluI AGCT 8 cut(s) 34, 38, 64, 226, 271, 318, 583, 643
Alw26I GTCTC 1 cut(s) 480
AlwI GGATC 1 cut(s) 259
AoxI GGCC 2 cut(s) 157, 917
ApeKI GCWGC 3 cut(s) 31, 127, 268
ApoI RAATTY 2 cut(s) 401, 593
AspLEI GCGC 2 cut(s) 127, 839
AspS9I GGNCC 2 cut(s) 577, 917
AsuHPI GGTGA 1 cut(s) 853
AsuNHI GCTAGC 1 cut(s) 34
AvaII GGWCC 1 cut(s) 577
BbsI GAAGAC 1 cut(s) 180
BbvI GCAGC 3 cut(s) 43, 114, 280
BccI CCATC 2 cut(s) 410, 690
BceAI ACGGC 1 cut(s) 255
BcoDI GTCTC 1 cut(s) 480
BfaI CTAG 4 cut(s) 35, 119, 227, 584
BfmI CTRYAG 2 cut(s) 272, 610
BisI GCNGC 4 cut(s) 32, 102, 128, 269
BlsI GCNGC 4 cut(s) 33, 103, 129, 270
Bme18I GGWCC 1 cut(s) 577
BmgBI CACGTC 1 cut(s) 136
BmgT120I GGNCC 2 cut(s) 577, 917
BmiI GGNNCC 3 cut(s) 192, 578, 918
BmsI GCATC 5 cut(s) 112, 355, 366, 810, 867
BmtI GCTAGC 1 cut(s) 38
BpiI GAAGAC 1 cut(s) 180
BplI GAGNNNNNCTC 2 cut(s) 477, 509
BpmI CTGGAG 2 cut(s) 30, 963
BsaAI YACGTR 1 cut(s) 939
BsaJI CCNNGG 2 cut(s) 380, 951
Bsc4I CCNNNNNNNGG 4 cut(s) 155, 238, 847, 870
Bse1I ACTGG 4 cut(s) 13, 542, 648, 980
Bse3DI GCAATG 1 cut(s) 966
BseDI CCNNGG 2 cut(s) 380, 951
BseGI GGATG 1 cut(s) 789
BseLI CCNNNNNNNGG 4 cut(s) 155, 238, 847, 870
BseMI GCAATG 1 cut(s) 966
BseMII CTCAG 2 cut(s) 53, 549
BseNI ACTGG 4 cut(s) 13, 542, 648, 980
BseRI GAGGAG 3 cut(s) 41, 203, 836
BseXI GCAGC 3 cut(s) 43, 114, 280
BseYI CCCAGC 1 cut(s) 473
Bsh1236I CGCG 1 cut(s) 837
BshFI GGCC 2 cut(s) 159, 919
BslFI GGGAC 3 cut(s) 490, 590, 792
BslI CCNNNNNNNGG 4 cut(s) 155, 238, 847, 870
BsmAI GTCTC 1 cut(s) 480
BsmFI GGGAC 3 cut(s) 490, 590, 792
BsmI GAATGC 1 cut(s) 242
BsnI GGCC 2 cut(s) 159, 919
Bsp143I GATC 4 cut(s) 251, 282, 724, 885
BspACI CCGC 2 cut(s) 102, 200
BspANI GGCC 2 cut(s) 159, 919
BspCNI CTCAG 2 cut(s) 52, 550
BspFNI CGCG 1 cut(s) 837
BspLI GGNNCC 3 cut(s) 192, 578, 918
BspOI GCTAGC 1 cut(s) 38
BspPI GGATC 1 cut(s) 259
BsrDI GCAATG 1 cut(s) 966
BsrI ACTGG 4 cut(s) 13, 542, 648, 980
BssECI CCNNGG 2 cut(s) 380, 951
BssMI GATC 4 cut(s) 251, 282, 724, 885
BssT1I CCWWGG 2 cut(s) 380, 951
Bst4CI ACNGT 8 cut(s) 76, 306, 504, 572, 605, 628, 660, 967
Bst6I CTCTTC 3 cut(s) 75, 180, 207
BstBAI YACGTR 1 cut(s) 939
BstC8I GCNNGC 3 cut(s) 36, 320, 770
BstDEI CTNAG 2 cut(s) 39, 558
BstF5I GGATG 1 cut(s) 789
BstFNI CGCG 1 cut(s) 837
BstHHI GCGC 2 cut(s) 127, 839
BstKTI GATC 4 cut(s) 254, 285, 727, 888
BstMAI GTCTC 1 cut(s) 480
BstMBI GATC 4 cut(s) 251, 282, 724, 885
BstMWI GCNNNNNNNGC 2 cut(s) 765, 836
BstNSI RCATGY 3 cut(s) 443, 637, 772
BstSFI CTRYAG 2 cut(s) 272, 610
BstUI CGCG 1 cut(s) 837
BstV1I GCAGC 3 cut(s) 43, 114, 280
BstV2I GAAGAC 1 cut(s) 180
BstX2I RGATCY 1 cut(s) 251
BstYI RGATCY 1 cut(s) 251
BsuRI GGCC 2 cut(s) 159, 919
BtrI CACGTC 1 cut(s) 136
BtsCI GGATG 1 cut(s) 789
BtsI GCAGTG 1 cut(s) 779
BtsIMutI CAGTG 4 cut(s) 6, 543, 665, 779
Cac8I GCNNGC 3 cut(s) 36, 320, 770
CfoI GCGC 2 cut(s) 127, 839
Cfr13I GGNCC 2 cut(s) 577, 917
Csp6I GTAC 5 cut(s) 307, 332, 541, 624, 651
CviAII CATG 9 cut(s) 247, 323, 406, 440, 634, 769, 842, 869, 996
CviQI GTAC 5 cut(s) 307, 332, 541, 624, 651
DdeI CTNAG 2 cut(s) 39, 558
DpnI GATC 4 cut(s) 253, 284, 726, 887
DpnII GATC 4 cut(s) 251, 282, 724, 885
DrdI GACNNNNNNGTC 2 cut(s) 140, 494
DseDI GACNNNNNNGTC 2 cut(s) 140, 494
Eam1104I CTCTTC 3 cut(s) 75, 180, 207
EarI CTCTTC 3 cut(s) 75, 180, 207
Eco130I CCWWGG 2 cut(s) 380, 951
Eco47I GGWCC 1 cut(s) 577
EcoRI GAATTC 1 cut(s) 593
EcoT14I CCWWGG 2 cut(s) 380, 951
ErhI CCWWGG 2 cut(s) 380, 951
FaeI CATG 9 cut(s) 250, 326, 409, 443, 637, 772, 845, 872, 999
FalI AAGNNNNNCTT 4 cut(s) 514, 546, 714, 746
FaqI GGGAC 3 cut(s) 490, 590, 792
FatI CATG 9 cut(s) 246, 322, 405, 439, 633, 768, 841, 868, 995
FblI GTMKAC 2 cut(s) 144, 681
Fnu4HI GCNGC 4 cut(s) 32, 102, 128, 269
FokI GGATG 1 cut(s) 776
Fsp4HI GCNGC 4 cut(s) 32, 102, 128, 269
FspBI CTAG 4 cut(s) 35, 119, 227, 584
GlaI GCGC 2 cut(s) 126, 838
GluI GCNGC 4 cut(s) 32, 102, 128, 269
GsaI CCCAGC 1 cut(s) 477
GsuI CTGGAG 2 cut(s) 30, 963
HaeIII GGCC 2 cut(s) 159, 919
HhaI GCGC 2 cut(s) 127, 839
Hin1II CATG 9 cut(s) 250, 326, 409, 443, 637, 772, 845, 872, 999
Hin6I GCGC 2 cut(s) 125, 837
HinP1I GCGC 2 cut(s) 125, 837
HincII GTYRAC 4 cut(s) 112, 145, 682, 970
HindII GTYRAC 4 cut(s) 112, 145, 682, 970
HinfI GANTC 2 cut(s) 326, 560
HphI GGTGA 1 cut(s) 853
Hpy166II GTNNAC 5 cut(s) 112, 145, 543, 682, 970
Hpy188I TCNGA 2 cut(s) 42, 736
Hpy188III TCNNGA 2 cut(s) 298, 713
Hpy8I GTNNAC 5 cut(s) 112, 145, 543, 682, 970
Hpy99I CGWCG 4 cut(s) 137, 182, 624, 683
HpyAV CCTTC 3 cut(s) 79, 305, 803
HpyCH4III ACNGT 8 cut(s) 76, 306, 504, 572, 605, 628, 660, 967
HpyCH4IV ACGT 2 cut(s) 135, 938
HpyCH4V TGCA 5 cut(s) 94, 409, 465, 720, 772
HpyF10VI GCNNNNNNNGC 2 cut(s) 765, 836
HpyF3I CTNAG 2 cut(s) 39, 558
HpySE526I ACGT 2 cut(s) 135, 938
Hsp92II CATG 9 cut(s) 250, 326, 409, 443, 637, 772, 845, 872, 999
HspAI GCGC 2 cut(s) 125, 837
Kzo9I GATC 4 cut(s) 251, 282, 724, 885
LmnI GCTCC 3 cut(s) 11, 28, 190
Lsp1109I GCAGC 3 cut(s) 43, 114, 280
LweI GCATC 5 cut(s) 112, 355, 366, 810, 867
MaeI CTAG 4 cut(s) 35, 119, 227, 584
MaeII ACGT 2 cut(s) 135, 938
MaeIII GTNAC 1 cut(s) 524
MalI GATC 4 cut(s) 253, 284, 726, 887
MboI GATC 4 cut(s) 251, 282, 724, 885
MboII GAAGA 8 cut(s) 92, 185, 194, 197, 224, 370, 385, 886
MflI RGATCY 1 cut(s) 251
MluCI AATT 2 cut(s) 401, 593
MlyI GAGTC 2 cut(s) 320, 569
MnlI CCTC 8 cut(s) 19, 181, 475, 503, 560, 608, 751, 814
MseI TTAA 3 cut(s) 164, 707, 854
MslI CAYNNNNRTG 1 cut(s) 752
MspA1I CMGCKG 1 cut(s) 200
Mva1269I GAATGC 1 cut(s) 242
MvnI CGCG 1 cut(s) 837
MwoI GCNNNNNNNGC 2 cut(s) 765, 836
NdeII GATC 4 cut(s) 251, 282, 724, 885
NheI GCTAGC 1 cut(s) 34
NlaIII CATG 9 cut(s) 250, 326, 409, 443, 637, 772, 845, 872, 999
NlaIV GGNNCC 3 cut(s) 192, 578, 918
NspI RCATGY 3 cut(s) 443, 637, 772
PaeI GCATGC 1 cut(s) 772
PciI ACATGT 1 cut(s) 439
PcsI WCGNNNNNNNCGW 2 cut(s) 141, 450
PctI GAATGC 1 cut(s) 242
PflMI CCANNNNNTGG 2 cut(s) 155, 847
PkrI GCNGC 4 cut(s) 33, 103, 129, 270
PleI GAGTC 2 cut(s) 320, 568
PpsI GAGTC 2 cut(s) 320, 568
Ppu21I YACGTR 1 cut(s) 939
PscI ACATGT 1 cut(s) 439
PspFI CCCAGC 1 cut(s) 473
PspN4I GGNNCC 3 cut(s) 192, 578, 918
PspPI GGNCC 2 cut(s) 577, 917
PsuI RGATCY 1 cut(s) 251
RsaI GTAC 5 cut(s) 308, 333, 542, 625, 652
RsaNI GTAC 5 cut(s) 307, 332, 541, 624, 651
RseI CAYNNNNRTG 1 cut(s) 752
SalI GTCGAC 2 cut(s) 143, 680
SaqAI TTAA 3 cut(s) 164, 707, 854
SatI GCNGC 4 cut(s) 32, 102, 128, 269
Sau3AI GATC 4 cut(s) 251, 282, 724, 885
Sau96I GGNCC 2 cut(s) 577, 917
SchI GAGTC 2 cut(s) 320, 569
SfaNI GCATC 5 cut(s) 112, 355, 366, 810, 867
SfcI CTRYAG 2 cut(s) 272, 610
SinI GGWCC 1 cut(s) 577
SmiMI CAYNNNNRTG 1 cut(s) 752
SphI GCATGC 1 cut(s) 772
Sse9I AATT 2 cut(s) 401, 593
SsiI CCGC 2 cut(s) 102, 200
SspI AATATT 1 cut(s) 154
SspMI CTAG 4 cut(s) 35, 119, 227, 584
StyI CCWWGG 2 cut(s) 380, 951
TaaI ACNGT 8 cut(s) 76, 306, 504, 572, 605, 628, 660, 967
TaiI ACGT 2 cut(s) 138, 941
TaqI TCGA 5 cut(s) 24, 144, 414, 552, 681
TasI AATT 2 cut(s) 401, 593
TatI WGTACW 1 cut(s) 331
TauI GCSGC 1 cut(s) 104
Tru1I TTAA 3 cut(s) 164, 707, 854
Tru9I TTAA 3 cut(s) 164, 707, 854
TscAI CASTG 4 cut(s) 13, 550, 665, 779
TseI GCWGC 3 cut(s) 31, 127, 268
TspDTI ATGAA 5 cut(s) 59, 63, 235, 394, 684
TspGWI ACGGA 1 cut(s) 85
TspRI CASTG 4 cut(s) 13, 550, 665, 779
Van91I CCANNNNNTGG 2 cut(s) 155, 847
VpaK11BI GGWCC 1 cut(s) 577
XapI RAATTY 2 cut(s) 401, 593
XceI RCATGY 3 cut(s) 443, 637, 772
XmiI GTMKAC 2 cut(s) 144, 681
XspI CTAG 4 cut(s) 35, 119, 227, 584
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.