Rmu_sc0015930.1_g000006

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015930.1
OG0000128
Physical Location & Seq
Forward (+)
21281 .. 22697
1417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015930.1_g000006.1.cds

Sequence Viewer

Length: 855 bp
atgggatccaaccgctacttgcatcttgtagccctatgttcaagctacactacggtatccggaagccgcaaatccatcgccgggaagccacctttccggccttgccaacatgccctcacaaataggctttctagactagaaatggtggtactgtgcactagtgacgggacaatagcggacagagctgggagtgcagaacaagttcgaggctcgcggcactgtgacgtgcttaagttggtgaggtgcagcttggggcgttacagcgtcaatgcattcatttttagatggattagcttaaatctccaatgctcagagaaattgacagaacagtctatagttcaaatatgctcaaacaatctccttccagaaatagcaacttttgttagcaccgcagaacctcaaacattcaacgctcttgtctcaaaagctagtaatgtcaaaagacagattgctcgtaagaaaacctcgacacaagggatgatcttcaaaagtaagaaaactaacaatacaggcgactccttagctacctttgtcaaaactgacgaaaagtcaaatgcatgcaaaggaaaagaaaggtcaagaaaactcactctcaaagaaataagaaaagaagacaagtactcttttgatgatgatgacgtcgaacaaatattcattgagctctacaaagcaaaagcaattgagcttcttgaaccaaaacgaccgagtgatatcagcaagaccaagaaccgcgaattttgttgctaccatcgtattgtcagtcatccaacaagtgactgtttcattttgaagaacatcattcaagaaatgatcaaaaacaaggaaatagaggtggagacatcgtcaccaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 Retrotrans_gag rve

Protein Analysis

284

Amino Acids

32.07

Weight (kDa)

9.41

Isoelectric Point (pI)

42.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 328
AatII GACGTC 1 cut(s) 642
AccII CGCG 2 cut(s) 214, 732
AccIII TCCGGA 1 cut(s) 59
AciI CCGC 6 cut(s) 13, 67, 176, 214, 390, 730
AclWI GGATC 1 cut(s) 13
AcsI RAATTY 1 cut(s) 734
AcyI GRCGYC 1 cut(s) 639
AfaI GTAC 2 cut(s) 150, 620
AfiI CCNNNNNNNGG 1 cut(s) 81
AflII CTTAAG 1 cut(s) 230
AgsI TTSAA 7 cut(s) 42, 341, 409, 487, 692, 790, 803
AhdI GACNNNNNGTC 1 cut(s) 547
AhlI ACTAGT 1 cut(s) 158
AjiI CACGTC 1 cut(s) 226
AleI CACNNNNGTG 1 cut(s) 850
AluBI AGCT 8 cut(s) 45, 185, 249, 294, 428, 524, 661, 685
AluI AGCT 8 cut(s) 45, 185, 249, 294, 428, 524, 661, 685
Alw21I GWGCWC 2 cut(s) 158, 663
Alw26I GTCTC 2 cut(s) 424, 830
Alw44I GTGCAC 1 cut(s) 154
AlwI GGATC 1 cut(s) 13
Aor13HI TCCGGA 1 cut(s) 59
AoxI GGCC 1 cut(s) 98
ApaLI GTGCAC 1 cut(s) 154
ApeKI GCWGC 1 cut(s) 246
ApoI RAATTY 1 cut(s) 734
Asp700I GAANNNNTTC 1 cut(s) 201
AsuC2I CCSGG 1 cut(s) 82
AsuHPI GGTGA 2 cut(s) 250, 837
BaeGI GKGCMC 1 cut(s) 158
BaeI ACNNNNGTAYC 2 cut(s) 39, 72
BamHI GGATCC 1 cut(s) 5
BanII GRGCYC 1 cut(s) 663
BbsI GAAGAC 1 cut(s) 618
Bbv12I GWGCWC 2 cut(s) 158, 663
BbvI GCAGC 1 cut(s) 258
BccI CCATC 3 cut(s) 83, 279, 756
BcgI CGANNNNNNTGC 2 cut(s) 58, 92
BciVI GTATCC 1 cut(s) 67
BclI TGATCA 1 cut(s) 810
BcnI CCSGG 1 cut(s) 82
BcoDI GTCTC 2 cut(s) 424, 830
BcuI ACTAGT 1 cut(s) 158
BfaI CTAG 4 cut(s) 132, 137, 159, 429
BfmI CTRYAG 1 cut(s) 333
BfrI CTTAAG 1 cut(s) 230
BfuI GTATCC 1 cut(s) 67
BisI GCNGC 3 cut(s) 67, 215, 247
BlsI GCNGC 3 cut(s) 68, 216, 248
BmcAI AGTACT 1 cut(s) 620
Bme1390I CCNGG 1 cut(s) 82
BmeRI GACNNNNNGTC 1 cut(s) 547
BmgBI CACGTC 1 cut(s) 226
BmiI GGNNCC 1 cut(s) 7
BmrFI CCNGG 1 cut(s) 82
BmsI GCATC 1 cut(s) 31
BpiI GAAGAC 1 cut(s) 618
Bpu10I CCTNAGC 1 cut(s) 520
BpuMI CCSGG 1 cut(s) 82
BsaHI GRCGYC 1 cut(s) 639
BsaWI WCCGGW 1 cut(s) 59
BsaXI ACNNNNNCTCC 1 cut(s) 827
Bsc4I CCNNNNNNNGG 1 cut(s) 81
BseAI TCCGGA 1 cut(s) 59
BseGI GGATG 2 cut(s) 483, 763
BseLI CCNNNNNNNGG 1 cut(s) 81
BseMII CTCAG 1 cut(s) 324
BseSI GKGCMC 1 cut(s) 158
BseXI GCAGC 1 cut(s) 258
BseYI CCCAGC 1 cut(s) 185
BsgI GTGCAG 2 cut(s) 213, 265
Bsh1236I CGCG 2 cut(s) 214, 732
Bsh1285I CGRYCG 1 cut(s) 704
BshFI GGCC 1 cut(s) 100
BsiEI CGRYCG 1 cut(s) 704
BsiHKAI GWGCWC 2 cut(s) 158, 663
BsiSI CCGG 3 cut(s) 60, 81, 97
BslFI GGGAC 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 81
BsmAI GTCTC 2 cut(s) 424, 830
BsmFI GGGAC 1 cut(s) 181
BsmI GAATGC 1 cut(s) 272
BsnI GGCC 1 cut(s) 100
Bsp1286I GDGCHC 2 cut(s) 158, 663
Bsp13I TCCGGA 1 cut(s) 59
Bsp143I GATC 3 cut(s) 5, 480, 810
BspACI CCGC 6 cut(s) 13, 67, 176, 214, 390, 730
BspANI GGCC 1 cut(s) 100
BspCNI CTCAG 1 cut(s) 323
BspEI TCCGGA 1 cut(s) 59
BspFNI CGCG 2 cut(s) 214, 732
BspLI GGNNCC 1 cut(s) 7
BspPI GGATC 1 cut(s) 13
BspTI CTTAAG 1 cut(s) 230
BssMI GATC 3 cut(s) 5, 480, 810
BssNI GRCGYC 1 cut(s) 639
Bst4CI ACNGT 5 cut(s) 55, 153, 221, 330, 779
BstACI GRCGYC 1 cut(s) 639
BstAFI CTTAAG 1 cut(s) 230
BstC8I GCNNGC 2 cut(s) 212, 559
BstDEI CTNAG 2 cut(s) 310, 520
BstF5I GGATG 2 cut(s) 483, 763
BstFNI CGCG 2 cut(s) 214, 732
BstKTI GATC 3 cut(s) 8, 483, 813
BstMAI GTCTC 2 cut(s) 424, 830
BstMBI GATC 3 cut(s) 5, 480, 810
BstMCI CGRYCG 1 cut(s) 704
BstMWI GCNNNNNNNGC 2 cut(s) 182, 191
BstNSI RCATGY 2 cut(s) 113, 561
BstSCI CCNGG 1 cut(s) 80
BstSFI CTRYAG 1 cut(s) 333
BstSLI GKGCMC 1 cut(s) 158
BstUI CGCG 2 cut(s) 214, 732
BstV1I GCAGC 1 cut(s) 258
BstV2I GAAGAC 1 cut(s) 618
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
BsuI GTATCC 1 cut(s) 67
BsuRI GGCC 1 cut(s) 100
BtgZI GCGATG 1 cut(s) 61
BtrI CACGTC 1 cut(s) 226
BtsCI GGATG 2 cut(s) 483, 763
BtsIMutI CAGTG 1 cut(s) 217
Cac8I GCNNGC 2 cut(s) 212, 559
CseI GACGC 1 cut(s) 253
Csp6I GTAC 2 cut(s) 149, 619
CviAII CATG 2 cut(s) 110, 558
CviQI GTAC 2 cut(s) 149, 619
DdeI CTNAG 2 cut(s) 310, 520
DpnI GATC 3 cut(s) 7, 482, 812
DpnII GATC 3 cut(s) 5, 480, 810
DrdI GACNNNNNNGTC 1 cut(s) 328
DriI GACNNNNNGTC 1 cut(s) 547
DseDI GACNNNNNNGTC 1 cut(s) 328
Eam1105I GACNNNNNGTC 1 cut(s) 547
Ecl136II GAGCTC 1 cut(s) 661
Eco24I GRGCYC 1 cut(s) 663
Eco32I GATATC 1 cut(s) 712
Eco53kI GAGCTC 1 cut(s) 661
EcoICRI GAGCTC 1 cut(s) 661
EcoRV GATATC 1 cut(s) 712
EcoT22I ATGCAT 2 cut(s) 274, 559
EcoT38I GRGCYC 1 cut(s) 663
FaeI CATG 2 cut(s) 113, 561
FaiI YATR 5 cut(s) 37, 111, 335, 346, 559
FaqI GGGAC 1 cut(s) 181
FatI CATG 2 cut(s) 109, 557
FbaI TGATCA 1 cut(s) 810
Fnu4HI GCNGC 3 cut(s) 67, 215, 247
FokI GGATG 2 cut(s) 490, 750
FriOI GRGCYC 1 cut(s) 663
Fsp4HI GCNGC 3 cut(s) 67, 215, 247
FspBI CTAG 4 cut(s) 132, 137, 159, 429
GluI GCNGC 3 cut(s) 67, 215, 247
GsaI CCCAGC 1 cut(s) 189
HaeIII GGCC 1 cut(s) 100
HapII CCGG 3 cut(s) 60, 81, 97
HgaI GACGC 1 cut(s) 253
Hin1I GRCGYC 1 cut(s) 639
Hin1II CATG 2 cut(s) 113, 561
HinfI GANTC 1 cut(s) 515
HpaII CCGG 3 cut(s) 60, 81, 97
HphI GGTGA 2 cut(s) 250, 837
Hpy166II GTNNAC 1 cut(s) 156
Hpy188I TCNGA 1 cut(s) 313
Hpy188III TCNNGA 6 cut(s) 60, 132, 365, 579, 689, 803
Hpy8I GTNNAC 1 cut(s) 156
Hpy99I CGWCG 1 cut(s) 644
HpyAV CCTTC 1 cut(s) 371
HpyCH4III ACNGT 5 cut(s) 55, 153, 221, 330, 779
HpyCH4IV ACGT 2 cut(s) 225, 639
HpyCH4V TGCA 7 cut(s) 22, 156, 194, 246, 272, 557, 561
HpyF10VI GCNNNNNNNGC 2 cut(s) 182, 191
HpyF3I CTNAG 2 cut(s) 310, 520
HpySE526I ACGT 2 cut(s) 225, 639
Hsp92I GRCGYC 1 cut(s) 639
Hsp92II CATG 2 cut(s) 113, 561
Kpn2I TCCGGA 1 cut(s) 59
Ksp22I TGATCA 1 cut(s) 810
Kzo9I GATC 3 cut(s) 5, 480, 810
LpnPI CCDG 6 cut(s) 73, 94, 110, 171, 378, 495
Lsp1109I GCAGC 1 cut(s) 258
LweI GCATC 1 cut(s) 31
MaeI CTAG 4 cut(s) 132, 137, 159, 429
MaeII ACGT 2 cut(s) 225, 639
MaeIII GTNAC 5 cut(s) 161, 221, 257, 773, 843
MalI GATC 3 cut(s) 7, 482, 812
MboI GATC 3 cut(s) 5, 480, 810
MboII GAAGA 3 cut(s) 475, 623, 802
MfeI CAATTG 1 cut(s) 678
MflI RGATCY 1 cut(s) 5
MhlI GDGCHC 2 cut(s) 158, 663
MluCI AATT 3 cut(s) 317, 678, 734
MlyI GAGTC 1 cut(s) 509
MmeI TCCRAC 2 cut(s) 33, 791
MnlI CCTC 6 cut(s) 125, 200, 234, 408, 475, 823
Mph1103I ATGCAT 2 cut(s) 274, 559
MroI TCCGGA 1 cut(s) 59
MroXI GAANNNNTTC 1 cut(s) 201
MseI TTAA 2 cut(s) 231, 296
MslI CAYNNNNRTG 1 cut(s) 850
MspCI CTTAAG 1 cut(s) 230
MspI CCGG 3 cut(s) 60, 81, 97
MspR9I CCNGG 1 cut(s) 82
MunI CAATTG 1 cut(s) 678
Mva1269I GAATGC 1 cut(s) 272
MvnI CGCG 2 cut(s) 214, 732
MwoI GCNNNNNNNGC 2 cut(s) 182, 191
NciI CCSGG 1 cut(s) 82
NdeII GATC 3 cut(s) 5, 480, 810
NlaIII CATG 2 cut(s) 113, 561
NlaIV GGNNCC 1 cut(s) 7
NmuCI GTSAC 4 cut(s) 161, 221, 773, 843
NsiI ATGCAT 2 cut(s) 274, 559
NspI RCATGY 2 cut(s) 113, 561
OliI CACNNNNGTG 1 cut(s) 850
PaeI GCATGC 1 cut(s) 561
PctI GAATGC 1 cut(s) 272
PdmI GAANNNNTTC 1 cut(s) 201
PflFI GACNNNGTC 1 cut(s) 841
PkrI GCNGC 3 cut(s) 68, 216, 248
PleI GAGTC 1 cut(s) 509
PpsI GAGTC 1 cut(s) 509
Psp124BI GAGCTC 1 cut(s) 663
PspFI CCCAGC 1 cut(s) 185
PspN4I GGNNCC 1 cut(s) 7
PsuI RGATCY 1 cut(s) 5
PsyI GACNNNGTC 1 cut(s) 841
RsaI GTAC 2 cut(s) 150, 620
RsaNI GTAC 2 cut(s) 149, 619
RseI CAYNNNNRTG 1 cut(s) 850
SacI GAGCTC 1 cut(s) 663
SaqAI TTAA 2 cut(s) 231, 296
SatI GCNGC 3 cut(s) 67, 215, 247
Sau3AI GATC 3 cut(s) 5, 480, 810
ScaI AGTACT 1 cut(s) 620
SchI GAGTC 1 cut(s) 509
ScrFI CCNGG 1 cut(s) 82
SduI GDGCHC 2 cut(s) 158, 663
SfaNI GCATC 1 cut(s) 31
SfcI CTRYAG 1 cut(s) 333
SmiMI CAYNNNNRTG 1 cut(s) 850
SmlI CTYRAG 1 cut(s) 230
SmoI CTYRAG 1 cut(s) 230
SpeI ACTAGT 1 cut(s) 158
SphI GCATGC 1 cut(s) 561
Sse9I AATT 3 cut(s) 317, 678, 734
SsiI CCGC 6 cut(s) 13, 67, 176, 214, 390, 730
SspI AATATT 1 cut(s) 651
SspMI CTAG 4 cut(s) 132, 137, 159, 429
SstI GAGCTC 1 cut(s) 663
StyD4I CCNGG 1 cut(s) 80
TaaI ACNGT 5 cut(s) 55, 153, 221, 330, 779
TaiI ACGT 2 cut(s) 228, 642
TaqI TCGA 3 cut(s) 205, 467, 642
TaqII GACCGA 1 cut(s) 718
TasI AATT 3 cut(s) 317, 678, 734
TatI WGTACW 1 cut(s) 618
TauI GCSGC 2 cut(s) 69, 217
Tru1I TTAA 2 cut(s) 231, 296
Tru9I TTAA 2 cut(s) 231, 296
TscAI CASTG 1 cut(s) 224
TseFI GTSAC 4 cut(s) 161, 221, 773, 843
TseI GCWGC 1 cut(s) 246
Tsp45I GTSAC 4 cut(s) 161, 221, 773, 843
TspDTI ATGAA 3 cut(s) 265, 643, 772
TspRI CASTG 1 cut(s) 224
Tth111I GACNNNGTC 1 cut(s) 841
Vha464I CTTAAG 1 cut(s) 230
VneI GTGCAC 1 cut(s) 154
XapI RAATTY 1 cut(s) 734
XbaI TCTAGA 1 cut(s) 131
XceI RCATGY 2 cut(s) 113, 561
XmnI GAANNNNTTC 1 cut(s) 201
XspI CTAG 4 cut(s) 132, 137, 159, 429
ZraI GACGTC 1 cut(s) 640
ZrmI AGTACT 1 cut(s) 620
Zsp2I ATGCAT 2 cut(s) 274, 559
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.