pycom16g16040

Helicase-like protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
11948772 .. 11949526
755 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g16040.1

Sequence Viewer

Length: 714 bp
ATGACATCCCAAAATGGCCAATGGGTTTCTTCATCAGCACCCTGGATGTCTGAAGGAAAGTCATGCCTATTGGTTGCACAAGTCATGACCATCGGCGTCACCTCTGTTGAAGAACAGCTAGCTCAGATGAATGAAGCAATCGCAAAGCTCACACAGACTGTGGAAGAGAAGGACTTGCAGATTGCCGCACTTGTCAACCAACTAGATGCGCTGCCCGACGTAAAAGTCGACCCAAATATTGGCCTATTAAAGAAAGAAGGTGACGAAGAAGAGGAGCCACCAGTGGAGAAAGCTGAAGAGAAGCCGAAGCCAGACCAAGCAATGACATCCATGGGATCTCTCTCTATCCAGCAGCTACAGGAGATGATTGCAAGCACTATCAAGACACAGTACGAAGGAAGCTCGCACGACTCCGTACTGTACTCAAAGCCTTACTCCAAGAGGATTGATGCTTTGAAGATGCCAAGGGGTTATCAGCCCCCAAAATTCATGCAGTTCGATGGAAAAGGCAACCCGAAACAACATGTCGCCCATTTCGTTGAAACTTGCAACAATGCTGGGACAGAGGGAGACTACCTCGTCAAACAGTTCGTGCGTTCGCTGAAAAGTAATGCTTTTGACTGGTACACTGACCTCGAACCTGAGTCTATCAACAGTTGGGACCAGCTAGAAAGGGAATTCCTCAACCGTTTCTACAGCACTCTGGAGAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

238

Amino Acids

26.71

Weight (kDa)

4.8

Isoelectric Point (pI)

41.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 224, 578
AccB7I CCANNNNNTGG 1 cut(s) 239
AccI GTMKAC 1 cut(s) 228
AciI CCGC 1 cut(s) 186
AclWI GGATC 1 cut(s) 343
AcoI YGGCCR 1 cut(s) 16
AcsI RAATTY 2 cut(s) 485, 677
AcuI CTGAAG 2 cut(s) 72, 315
AcyI GRCGYC 1 cut(s) 96
AfaI GTAC 4 cut(s) 392, 417, 422, 626
AfiI CCNNNNNNNGG 1 cut(s) 239
AflIII ACRYGT 1 cut(s) 523
AgsI TTSAA 3 cut(s) 110, 457, 542
AjnI CCWGG 1 cut(s) 41
AluBI AGCT 7 cut(s) 118, 122, 148, 293, 355, 402, 667
AluI AGCT 7 cut(s) 118, 122, 148, 293, 355, 402, 667
Alw26I GTCTC 1 cut(s) 564
AlwI GGATC 1 cut(s) 343
AoxI GGCC 2 cut(s) 16, 241
ApeKI GCWGC 2 cut(s) 211, 352
ApoI RAATTY 2 cut(s) 485, 677
AspLEI GCGC 1 cut(s) 211
AspS9I GGNCC 1 cut(s) 661
AsuHPI GGTGA 2 cut(s) 91, 272
AsuNHI GCTAGC 1 cut(s) 118
AvaII GGWCC 1 cut(s) 661
BalI TGGCCA 1 cut(s) 18
BbvI GCAGC 2 cut(s) 198, 364
BccI CCATC 2 cut(s) 98, 494
BciT130I CCWGG 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 564
BfaI CTAG 3 cut(s) 119, 203, 668
BfmI CTRYAG 2 cut(s) 356, 694
BisI GCNGC 3 cut(s) 186, 212, 353
BlsI GCNGC 3 cut(s) 187, 213, 354
Bme1390I CCNGG 1 cut(s) 43
Bme18I GGWCC 1 cut(s) 661
BmgT120I GGNCC 1 cut(s) 661
BmiI GGNNCC 2 cut(s) 276, 662
BmrFI CCNGG 1 cut(s) 43
BmsI GCATC 3 cut(s) 196, 439, 450
BmtI GCTAGC 1 cut(s) 122
BplI GAGNNNNNCTC 2 cut(s) 561, 593
BsaHI GRCGYC 1 cut(s) 96
BsaJI CCNNGG 3 cut(s) 41, 330, 464
Bsc4I CCNNNNNNNGG 1 cut(s) 239
Bse1I ACTGG 2 cut(s) 281, 626
Bse3DI GCAATG 1 cut(s) 327
BseBI CCWGG 1 cut(s) 43
BseDI CCNNGG 3 cut(s) 41, 330, 464
BseGI GGATG 3 cut(s) 5, 51, 326
BseLI CCNNNNNNNGG 1 cut(s) 239
BseMI GCAATG 1 cut(s) 327
BseMII CTCAG 2 cut(s) 137, 633
BseNI ACTGG 2 cut(s) 281, 626
BseRI GAGGAG 1 cut(s) 287
BseXI GCAGC 2 cut(s) 198, 364
BseYI CCCAGC 1 cut(s) 557
BshFI GGCC 2 cut(s) 18, 243
BslFI GGGAC 2 cut(s) 574, 674
BslI CCNNNNNNNGG 1 cut(s) 239
BsmAI GTCTC 1 cut(s) 564
BsmFI GGGAC 2 cut(s) 574, 674
BsnI GGCC 2 cut(s) 18, 243
Bsp143I GATC 1 cut(s) 335
Bsp19I CCATGG 1 cut(s) 330
BspACI CCGC 1 cut(s) 186
BspANI GGCC 2 cut(s) 18, 243
BspCNI CTCAG 2 cut(s) 136, 634
BspHI TCATGA 1 cut(s) 84
BspLI GGNNCC 2 cut(s) 276, 662
BspOI GCTAGC 1 cut(s) 122
BspPI GGATC 1 cut(s) 343
BsrDI GCAATG 1 cut(s) 327
BsrI ACTGG 2 cut(s) 281, 626
BssECI CCNNGG 3 cut(s) 41, 330, 464
BssMI GATC 1 cut(s) 335
BssNI GRCGYC 1 cut(s) 96
BssT1I CCWWGG 2 cut(s) 330, 464
Bst2UI CCWGG 1 cut(s) 43
Bst4CI ACNGT 6 cut(s) 160, 390, 420, 588, 656, 689
Bst6I CTCTTC 3 cut(s) 159, 264, 291
BstACI GRCGYC 1 cut(s) 96
BstC8I GCNNGC 3 cut(s) 120, 373, 404
BstDEI CTNAG 2 cut(s) 123, 642
BstDSI CCRYGG 1 cut(s) 330
BstF5I GGATG 3 cut(s) 5, 51, 326
BstHHI GCGC 1 cut(s) 211
BstKTI GATC 1 cut(s) 338
BstMAI GTCTC 1 cut(s) 564
BstMBI GATC 1 cut(s) 335
BstNI CCWGG 1 cut(s) 43
BstNSI RCATGY 1 cut(s) 527
BstSCI CCNGG 1 cut(s) 41
BstSFI CTRYAG 2 cut(s) 356, 694
BstV1I GCAGC 2 cut(s) 198, 364
BstX2I RGATCY 1 cut(s) 335
BstYI RGATCY 1 cut(s) 335
BsuRI GGCC 2 cut(s) 18, 243
BtgI CCRYGG 1 cut(s) 330
BtsCI GGATG 3 cut(s) 5, 51, 326
BtsIMutI CAGTG 2 cut(s) 288, 627
Cac8I GCNNGC 3 cut(s) 120, 373, 404
CciI TCATGA 1 cut(s) 84
CfoI GCGC 1 cut(s) 211
Cfr13I GGNCC 1 cut(s) 661
CseI GACGC 1 cut(s) 85
Csp6I GTAC 4 cut(s) 391, 416, 421, 625
CviAII CATG 5 cut(s) 63, 85, 331, 490, 524
CviQI GTAC 4 cut(s) 391, 416, 421, 625
DdeI CTNAG 2 cut(s) 123, 642
DpnI GATC 1 cut(s) 337
DpnII GATC 1 cut(s) 335
DrdI GACNNNNNNGTC 2 cut(s) 224, 578
DseDI GACNNNNNNGTC 2 cut(s) 224, 578
EaeI YGGCCR 1 cut(s) 16
Eam1104I CTCTTC 3 cut(s) 159, 264, 291
EarI CTCTTC 3 cut(s) 159, 264, 291
Eco130I CCWWGG 2 cut(s) 330, 464
Eco47I GGWCC 1 cut(s) 661
Eco57I CTGAAG 2 cut(s) 72, 315
EcoRI GAATTC 1 cut(s) 677
EcoRII CCWGG 1 cut(s) 41
EcoT14I CCWWGG 2 cut(s) 330, 464
ErhI CCWWGG 2 cut(s) 330, 464
FaeI CATG 5 cut(s) 66, 88, 334, 493, 527
FaiI YATR 5 cut(s) 64, 86, 332, 491, 525
FalI AAGNNNNNCTT 2 cut(s) 598, 630
FaqI GGGAC 2 cut(s) 574, 674
FatI CATG 5 cut(s) 62, 84, 330, 489, 523
FblI GTMKAC 1 cut(s) 228
Fnu4HI GCNGC 3 cut(s) 186, 212, 353
FokI GGATG 2 cut(s) 58, 313
Fsp4HI GCNGC 3 cut(s) 186, 212, 353
FspBI CTAG 3 cut(s) 119, 203, 668
GlaI GCGC 1 cut(s) 210
GluI GCNGC 3 cut(s) 186, 212, 353
GsaI CCCAGC 1 cut(s) 561
HaeIII GGCC 2 cut(s) 18, 243
HgaI GACGC 1 cut(s) 85
HhaI GCGC 1 cut(s) 211
Hin1I GRCGYC 1 cut(s) 96
Hin1II CATG 5 cut(s) 66, 88, 334, 493, 527
Hin6I GCGC 1 cut(s) 209
HinP1I GCGC 1 cut(s) 209
HincII GTYRAC 2 cut(s) 196, 229
HindII GTYRAC 2 cut(s) 196, 229
HinfI GANTC 2 cut(s) 410, 644
HphI GGTGA 2 cut(s) 91, 272
Hpy166II GTNNAC 3 cut(s) 196, 229, 627
Hpy188I TCNGA 2 cut(s) 52, 126
Hpy188III TCNNGA 3 cut(s) 85, 382, 704
Hpy8I GTNNAC 3 cut(s) 196, 229, 627
Hpy99I CGWCG 1 cut(s) 221
HpyAV CCTTC 4 cut(s) 47, 163, 251, 389
HpyCH4III ACNGT 6 cut(s) 160, 390, 420, 588, 656, 689
HpyCH4IV ACGT 1 cut(s) 219
HpyCH4V TGCA 5 cut(s) 77, 178, 371, 493, 549
HpyF3I CTNAG 2 cut(s) 123, 642
HpySE526I ACGT 1 cut(s) 219
Hsp92I GRCGYC 1 cut(s) 96
Hsp92II CATG 5 cut(s) 66, 88, 334, 493, 527
HspAI GCGC 1 cut(s) 209
Kzo9I GATC 1 cut(s) 335
LmnI GCTCC 1 cut(s) 274
Lsp1109I GCAGC 2 cut(s) 198, 364
LweI GCATC 3 cut(s) 196, 439, 450
MaeI CTAG 3 cut(s) 119, 203, 668
MaeII ACGT 1 cut(s) 219
MaeIII GTNAC 2 cut(s) 97, 260
MalI GATC 1 cut(s) 337
MboI GATC 1 cut(s) 335
MboII GAAGA 7 cut(s) 21, 122, 176, 278, 281, 308, 469
MflI RGATCY 1 cut(s) 335
MlsI TGGCCA 1 cut(s) 18
MluCI AATT 2 cut(s) 485, 677
MluNI TGGCCA 1 cut(s) 18
MlyI GAGTC 2 cut(s) 404, 653
MnlI CCTC 7 cut(s) 112, 265, 435, 559, 587, 644, 692
Mox20I TGGCCA 1 cut(s) 18
MscI TGGCCA 1 cut(s) 18
MseI TTAA 1 cut(s) 248
Msp20I TGGCCA 1 cut(s) 18
MspR9I CCNGG 1 cut(s) 43
MvaI CCWGG 1 cut(s) 43
NcoI CCATGG 1 cut(s) 330
NdeII GATC 1 cut(s) 335
NheI GCTAGC 1 cut(s) 118
NlaIII CATG 5 cut(s) 66, 88, 334, 493, 527
NlaIV GGNNCC 2 cut(s) 276, 662
NmuCI GTSAC 2 cut(s) 97, 260
NspI RCATGY 1 cut(s) 527
PagI TCATGA 1 cut(s) 84
PciI ACATGT 1 cut(s) 523
PcsI WCGNNNNNNNCGW 2 cut(s) 225, 534
PflMI CCANNNNNTGG 1 cut(s) 239
PkrI GCNGC 3 cut(s) 187, 213, 354
PleI GAGTC 2 cut(s) 404, 652
PpsI GAGTC 2 cut(s) 404, 652
PscI ACATGT 1 cut(s) 523
Psp6I CCWGG 1 cut(s) 41
PspFI CCCAGC 1 cut(s) 557
PspGI CCWGG 1 cut(s) 41
PspN4I GGNNCC 2 cut(s) 276, 662
PspPI GGNCC 1 cut(s) 661
PsuI RGATCY 1 cut(s) 335
RsaI GTAC 4 cut(s) 392, 417, 422, 626
RsaNI GTAC 4 cut(s) 391, 416, 421, 625
SalI GTCGAC 1 cut(s) 227
SaqAI TTAA 1 cut(s) 248
SatI GCNGC 3 cut(s) 186, 212, 353
Sau3AI GATC 1 cut(s) 335
Sau96I GGNCC 1 cut(s) 661
SchI GAGTC 2 cut(s) 404, 653
ScrFI CCNGG 1 cut(s) 43
SfaNI GCATC 3 cut(s) 196, 439, 450
SfcI CTRYAG 2 cut(s) 356, 694
SinI GGWCC 1 cut(s) 661
Sse9I AATT 2 cut(s) 485, 677
SsiI CCGC 1 cut(s) 186
SspI AATATT 1 cut(s) 238
SspMI CTAG 3 cut(s) 119, 203, 668
StyD4I CCNGG 1 cut(s) 41
StyI CCWWGG 2 cut(s) 330, 464
TaaI ACNGT 6 cut(s) 160, 390, 420, 588, 656, 689
TaiI ACGT 1 cut(s) 222
TaqI TCGA 3 cut(s) 228, 498, 636
TasI AATT 2 cut(s) 485, 677
TatI WGTACW 1 cut(s) 420
TauI GCSGC 1 cut(s) 188
Tru1I TTAA 1 cut(s) 248
Tru9I TTAA 1 cut(s) 248
TscAI CASTG 2 cut(s) 288, 634
TseFI GTSAC 2 cut(s) 97, 260
TseI GCWGC 2 cut(s) 211, 352
Tsp45I GTSAC 2 cut(s) 97, 260
TspDTI ATGAA 4 cut(s) 21, 143, 147, 478
TspGWI ACGGA 1 cut(s) 403
TspRI CASTG 2 cut(s) 288, 634
Van91I CCANNNNNTGG 1 cut(s) 239
VpaK11BI GGWCC 1 cut(s) 661
XapI RAATTY 2 cut(s) 485, 677
XceI RCATGY 1 cut(s) 527
XmiI GTMKAC 1 cut(s) 228
XspI CTAG 3 cut(s) 119, 203, 668
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.